About the Authors:
Heiman F. L. Wertheim
* E-mail: [email protected]
Affiliations Oxford University Clinical Research Unit, National Institute of Infectious and Tropical Diseases, Hanoi, Viet Nam, Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom
Huyen Nguyen Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Walter Taylor
Affiliations Oxford University Clinical Research Unit, National Institute of Infectious and Tropical Diseases, Hanoi, Viet Nam, Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom
Trinh Thi Minh Lien
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Hoa Thi Ngo
Affiliation: Oxford University Clinical Research Unit, Hospital of Tropical Diseases, Ho Chi Minh City, Viet Nam
Thai Quoc Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Bich Ngoc Thi Nguyen
Affiliation: Oxford University Clinical Research Unit, National Institute of Infectious and Tropical Diseases, Hanoi, Viet Nam
Ha Hong Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Ha Minh Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Cap Trung Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Trinh Tuyet Dao
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Trung Vu Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Annette Fox
Affiliations Oxford University Clinical Research Unit, National Institute of Infectious and Tropical Diseases, Hanoi, Viet Nam, Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom
Jeremy Farrar
Affiliations Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom, Oxford University Clinical Research Unit, Hospital of Tropical Diseases, Ho Chi Minh City, Viet Nam
Constance Schultsz
Affiliations Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom, Oxford University Clinical Research Unit, Hospital of Tropical Diseases, Ho Chi Minh City, Viet Nam, Centre for Poverty-Related Communicable Diseases, Academic Medical Center, Amsterdam, The Netherlands
Hien Duc Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Kinh Van Nguyen
Affiliation: National Institute of Infectious and Tropical Diseases, Hanoi, Vietnam
Peter Horby
Affiliations Oxford University Clinical Research Unit, National Institute of Infectious and Tropical Diseases, Hanoi, Viet Nam, Centre for Tropical Medicine, Nuffield Department of Clinical Medicine, Oxford University, Oxford, United Kingdom
Introduction
Streptococcus suis infection is a zoonosis which can cause severe systemic infection in humans exposed to infected pig tissue [1]. To date there have been relatively few reports of S. suis infection in humans, with around 700 cases reported worldwide, most of them in the last few years [1], [2], [3], [4]. In developed countries most cases are described in people with occupational exposure to pigs, such as pig farmers and abattoir workers. One study estimated the annual risk of developing S. suis infection in abattoir workers and pig farmers in a developed country to be approximately 3/100.000 per year [5].
In developing countries with intense pig farming, like those in Southeast Asia, the risk of acquiring S. suis infection is unknown as it is not a notifiable disease and under diagnosis is common. However the two largest published case series are from this region and together account for more than 50% of all reported cases [1], [3]. It is therefore possible that S. suis infection is a considerable, unrecognized burden in large parts of Southeast Asia [1], [2]. Whilst a recent study in southern Viet Nam showed that S. suis was the most common cause of bacterial meningitis in adults, S. suis has never been reported in northern Viet Nam [2]. Northern Viet Nam is more than 1000 miles from southern Viet Nam and experiences a very different climate, which may influence the local epidemiology of bacterial meningitis. In order to determine whether S. suis is a common cause of bacterial meningitis in northern Viet Nam we established enhanced diagnostics for S. suis at the National Institute of Infectious and Tropical Disease (NIIITD), a tertiary referral hospital in Hanoi. Here we report the data from 2007.
Methods
This study was conducted at the National Institute of Infectious and Tropical Diseases (NIITD), Hanoi, from January 2007 to December 2007. The NIITD is a 160 bed tertiary care center for adult patients with infectious diseases and also serves as a referral center for central nervous system infections in northern Viet Nam. Admitted patients with suspected meningitis were managed by local physicians, according to local practice that included the taking of cerebrospinal fluid (CSF) by lumbar puncture. Patient data were collected retrospectively using a pre-printed data collection form from their medical records. For sepsis classification we used standard criteria [6].
Specimens were processed using standard microbiological methods. Optochin negative alpha-haemolytic streptococci on blood agars, isolated from blood and CSF were tested with API 20 Strep® [Biomerieux, France] for identification at the NIITD laboratory. S. suis isolates were tested for penicillin and ceftriaxone susceptibility by E-test (AB Biodisk, Solna, Sweden) on Mueller Hinton agars (Biorad, USA). Real time polymerase chain reaction (PCR) diagnostics for S. suis serotype 2 with cps2J as gene target (primers and probe: forward GGTTACTTGCTACTTTTGATGGAAATT, reverse CGCACCTCTTTTATCTCTTCCAA, probe FAM-TCAAGAATCTGAGCTGCAAAAGTGTCAAATTGA-TAMRA) were implemented according to a previously described method [2]. Furthermore, isolated S. suis strains were genotyped by pulsed field gel electrophoresis (PFGE), after SmaI digestion. Four representative strains from the main clusters in southern Viet Nam (A, B, C, and D) were included [2]. Also reference strains were included (89–151 and 31533). A dendrogram was generated by Dice analysis (optimization, 0.5%; band tolerance, 1.5%) and cluster analysis with unweighted pair group method with arithmetic mean, using Bionumerics software (Applied Maths).
S. suis cases were geo-coded using the patient's address and overlaid onto a map depicting the estimated number of pigs per square kilometer (pig density data from the National Statistics Office, Hanoi, Viet Nam). Statistical differences in proportions were assessed by Fisher exact test. P values below 0.05 were considered significant. Institutional Review Board approval for this study was obtained.
Ethical considerations
This study was approved by the Oxford Tropical Research Ethics Committee and the Scientific Committee of the National Institute of Infectious and Tropical Diseases. Written informed consent was obtained.
Results
Between January and December 2007, 562 CSF specimens were submitted to the microbiology laboratory for analysis. Eleven specimens were positive for Cryptococcus neoformans (1.9%), three for Streptococcus pneumoniae (0.5%), three for Streptococcus species (0.5%), one for Enterobacter cloace (0.2%) and 43 for S. suis (7.7%). Of the 43 S. suis positive CSF samples, S. suis was isolated in 32 and 11 were only positive by PCR. An additional seven patients were blood culture positive for S. suis but CSF culture and PCR negative; making a total of 50 (8.9%) patients with laboratory confirmed S. suis infection (Table 1). The number of S. suis cases peaked during the summer months of May to July (Figure 1B). The 50 patients with S. suis disease were mostly older males (44 males [88.0%], median age all patients: 48 years, range: 17–78 years). The majority was farmer (n = 35, 70.0%) and a total of 16 patients reported a recent exposure to pigs or pork (32.0%): eight male patients had slaughtered pigs, five patients were exposed to pork products, and three consumed raw pig blood. Thirteen patients (26%) reported excessive alcohol consumption. None of the patients had a history of splenectomy.
[Figure omitted. See PDF.]
Figure 1. Location and seasonality of S. suis infections.
(A) Location of residence of 50 human S. suis cases diagnosed in northern Viet Nam in 2007 (black dot is one case) and pig density; (B) Month of diagnosis of S. suis cases during 2007.
https://doi.org/10.1371/journal.pone.0005973.g001
[Figure omitted. See PDF.]
Table 1. Diagnosis of 50 S. suis cases in Hanoi in 2007.
https://doi.org/10.1371/journal.pone.0005973.t001
Most patients presented with fever and meningism (Table 2). Complications developed in 15 (30%) patients, including renal and liver impairment (n = 14 and n = 7, respectively), septic shock (n = 6), ARDS (n = 3), endophthalmitis (n = 2) and a spinal abscess (n = 1). Seven patients (14%) had a purpuric/ecchymotic skin rash or purpura fulminans. Eight (16%) patients experienced respiratory failure requiring mechanical ventilation. Twenty-six patients (52%) recovered completely, 21 patients (42%) recovered with sequelae, and three patients died with septicemia. Hearing loss was the most common sequela (n = 19, 38%); others were: paralysis (n = 2), loss of vision (n = 2), dysarthria with gait ataxia (n = 2), abscess spinal column (n = 1), and residual renal impairment (n = 1). The most common empirical antibiotic treatment was ceftriaxone in combination with ampicillin. The latter antibiotic was given empirically to cover for Listeriosis. Twenty-six (52%) of the patients also received corticosteroids, as determined by the attending physician based on disease severity. Hearing loss occurred both in patients treated and not treated with corticosteroids, 11/26 (42.3%) versus 8/24 (33.3%).
[Figure omitted. See PDF.]
Table 2. Characteristics of 50 patients with S. suis infection.
https://doi.org/10.1371/journal.pone.0005973.t002
Laboratory findings at admission showed leukocytosis in 40 patients (80%) and thrombocytopenia in 29 patients (58%, Table 2). The CSF in patients showed high protein concentration (mean 1.7 g/l, range 0.6–5.1), low glucose levels (mean 1.7 mmol/l, range 0.2–4.7) and neutrophilia (mean white blood cell count 3253/mm3, range 0.4–26,500). Microscopic examination of Gram- stained CSF specimens revealed Gram-positive cocci in 28 patients (56.0%). Tested S. suis isolates were susceptible to penicillin and ceftriaxone (data not shown). PFGE analysis demonstrated that the bacterial population structure in northern Viet Nam has important similarities to that seen in the south (Figure 2). There was one large cluster III, similar to the dominant group D seen in southern Vietnam[2]. The group A cluster that was seen in southern Vietnam was not found in the north. Most patients lived in the Red River delta, where there is a high density of pigs (Figure 1). There was no obvious spatial or temporal clustering of cases to suggest an outbreak.
[Figure omitted. See PDF.]
Figure 2. PFGE after SmaI digestion of Streptococcus suis serotype 2 strains isolated from patients in northern Vietnam.
A dendrogram was generated by Dice analysis (optimization, 0.5%; band tolerance, 1.5%) and cluster analysis with unweighted pair group method with arithmetic mean, using Bionumerics software (Applied Maths). Bars indicate 95% CIs. Four representative strains from the main clusters in southern Viet Nam (A, B, C, and D) were included. Also reference strains were included (89–151 and 31533). Strains with the annotation old are from before 2007.
https://doi.org/10.1371/journal.pone.0005973.g002
Discussion
Data from our study complement those of an earlier report from a tertiary referral hospital in southern Viet Nam and demonstrate that S. suis type 2 is the most commonly detected organism in acute adult bacterial meningitis in both north and south Vietnam (unpublished data). Together they represent a case series of 193 patients and illustrate that S. suis meningitis is an endemic zoonosis of adults in Vietnam, which may also be true for other Southeast Asian countries where pig farming is common. This information has important public health consequences since S. suis infection is preventable through applying protective measures during the slaughtering and processing of pigs, and through proper cooking of pig meat and other pig body parts.
There are estimated to be around 26.8 million pigs in Vietnam, of which 40% live in the Red River and Mekong River Delta (source: FAOSTAT 2006). Many rural households have a small number of pigs, thus putting a high proportion of the Vietnamese population at risk. In our study, there were considerably more patients during the summer months from May to July than during the rest of the year. Whether this pattern observed in 2007 is typical of other years and represents seasonality in risk of infection remains to be determined.
During the study period there was a Porcine Respiratory and Reproductive System (PRRS) virus outbreak in the pig population in the same region [7]. This respiratory syndrome is often associated with severe secondary infection with bacterial agents like S. suis [8]. Therefore the PRRS virus outbreak may have led to an increased the risk of transmission of S. suis to humans through exposure to pigs with PRRS virus infection and concomitant S. suis disease. This hypothesis requires further investigation.
The large majority of S. suis cases were male and this probably represents gender-associated behavioural or occupational risk factors. The finding of a history of excessive alcohol consumption in 26% of patients may indicate that alcoholism is a risk factor for S. suis infection or disease. Almost 70% of cases did not report recent contact with pigs or pork products and therefore further work is needed to better define the risk factors for acquiring S. suis infection, like consumption of uncooked pig meat or blood.
S. suis can be cultured easily from cerebral spinal fluid (CSF) or blood with standard microbiological techniques. S. suis grows on blood agar as small, greyish and mucoid colonies with a zone of alpha-haemolysis and is optochin resistant. Determination to the species level is performed with biochemical tests, like optochin, Voges-Proskauer, salicin, trehalose, and 6.5% NaCl. Commercial systems, like API Strep® (Biomerieux, France), can also be used. These tests, including simple biochemical reactions for presumptive identification, are usually not available in developing countries and S. suis may therefore remain often undiagnosed or misdiagnosed. Furthermore, false negative culture results may occur due to antibiotic use prior to obtaining the specimens for culture. Approximately twenty percent of the cases reported here would have been missed without access to PCR, illustrating the important diagnostic potential of this technique. Fortunately, S. suis is generally susceptible to the readily available antibiotics penicillin and ceftriaxone. However, the severity of the sepsis syndrome seen in some patients requires careful clinical management and three patients in our series died despite being managed in an intensive care unit.
Most of our patients presented with severe disease and typical symptoms of meningitis. The mortality rate in our case series was 6%; higher than the reported 2.6% mortality in south Viet Nam. Hearing loss was the most common sequelae at discharge, affecting one third of the patients. The higher rates of hearing loss (66%) reported elsewhere probably reflect the use of audiometry to detect milder degrees of hearing loss than we were able to detect without access to an audiometer [2]. Our observation of a higher rate of hearing loss in the patients treated with corticosteroids cannot be interpreted since we have not been able to adjust for the severity of illness or hearing impairment prior to commencing corticosteriod treatment. In a recent, placebo controlled clinical trial, high dose dexamethasone significantly reduced the rate of post treatment hearing loss (12 vs. 38%) and therefore corticosteriod treatment should be used in all cases of S. suis meningitis [9].
In conclusion, S. suis is an important cause of adult meningitis in both north and south Viet Nam. Hearing loss as an early complaint is an important clue in the history in this setting. Laboratory capacity building to culture and identify S. suis from CSF and blood would aid greatly the ability to diagnose S. suis correctly and give reliable estimates of its burden in the community. This may also apply to other Southeast Asian countries. As far as we know the main reservoir for S. suis is pigs and it is not normally carried by humans. Countries where pig farming is common and S. suis has not yet been identified as a cause of bacterial meningitis should establish diagnostic assays to identify this bacterium. Identifying this disease is essential as it may be readily preventable through actions directed at the rearing and slaughter of pigs and food preparation practices.
Author Contributions
Conceived and designed the experiments: HFLW HNN WRJT TTML HHN HMN CTN TTD TVN CS HDN PH. Performed the experiments: HFLW HNN HTN BTNN TTD CS. Analyzed the data: HFLW HNN WRJT HTN TQN BTNN TVN CS PH. Contributed reagents/materials/analysis tools: TTML HTN TQN HHN HMN CTN TTD TVN AF JF CS HDN KVN PH. Wrote the paper: HFLW HNN WRJT JF CS PH.
Citation: Wertheim HFL, Nguyen HN, Taylor W, Lien TTM, Ngo HT, Nguyen TQ, et al. (2009) Streptococcus suis, an Important Cause of Adult Bacterial Meningitis in Northern Vietnam. PLoS ONE4(6): e5973. https://doi.org/10.1371/journal.pone.0005973
1. Lun ZR, Wang QP, Chen XG, Li AX, Zhu XQ (2007) Streptococcus suis: an emerging zoonotic pathogen. Lancet Infect Dis 7: 201–209.ZR LunQP WangXG ChenAX LiXQ Zhu2007Streptococcus suis: an emerging zoonotic pathogen.Lancet Infect Dis7201209
2. Mai NT, Hoa NT, Nga TV, Linh le D, Chau TT, et al. (2008) Streptococcus suis meningitis in adults in Vietnam. Clin Infect Dis 46: 659–667.NT MaiNT HoaTV NgaD. Linh leTT Chau2008Streptococcus suis meningitis in adults in Vietnam.Clin Infect Dis46659667
3. Wertheim HF, Nghia HD, Taylor W, Schultsz C (2009) Streptococcus suis: an emerging human pathogen. Clin Infect Dis 48: 617–625.HF WertheimHD NghiaW. TaylorC. Schultsz2009Streptococcus suis: an emerging human pathogen.Clin Infect Dis48617625
4. Wang G, Zeng YL, Liu HY, Xiong ZY (2007) An outbreak of Streptococcus suis in Chengdu, China. Int J Clin Pract 61: 1056–1057.G. WangYL ZengHY LiuZY Xiong2007An outbreak of Streptococcus suis in Chengdu, China.Int J Clin Pract6110561057
5. Arends JP, Zanen HC (1988) Meningitis caused by Streptococcus suis in humans. Rev Infect Dis 10: 131–137.JP ArendsHC Zanen1988Meningitis caused by Streptococcus suis in humans.Rev Infect Dis10131137
6. Bone RC, Balk RA, Cerra FB, Dellinger RP, Fein AM, et al. (1992) Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine. Chest 101: 1644–1655.RC BoneRA BalkFB CerraRP DellingerAM Fein1992Definitions for sepsis and organ failure and guidelines for the use of innovative therapies in sepsis. The ACCP/SCCM Consensus Conference Committee. American College of Chest Physicians/Society of Critical Care Medicine.Chest10116441655
7. Beltran-Alcrudo D, Lubroth J, Njeumi F, Pinto J, Depner K, et al. (2007) Porcine reproductive and respiratory syndrome (PRRS). FAO EMPRES Focus on 1–5.D. Beltran-AlcrudoJ. LubrothF. NjeumiJ. PintoK. Depner2007Porcine reproductive and respiratory syndrome (PRRS).FAO EMPRES Focus on15
8. Done SH, Paton DJ (1995) Porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression. Vet Rec 136: 32–35.SH DoneDJ Paton1995Porcine reproductive and respiratory syndrome: clinical disease, pathology and immunosuppression.Vet Rec1363235
9. Nguyen TH, Tran TH, Thwaites G, Ly VC, Dinh XS, et al. (2007) Dexamethasone in Vietnamese adolescents and adults with bacterial meningitis. N Engl J Med 357: 2431–2440.TH NguyenTH TranG. ThwaitesVC LyXS Dinh2007Dexamethasone in Vietnamese adolescents and adults with bacterial meningitis.N Engl J Med35724312440
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2009 Wertheim et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background
Streptococcus suis can cause severe systemic infection in adults exposed to infected pigs or after consumption of undercooked pig products. S. suis is often misdiagnosed, due to lack of awareness and improper testing. Here we report the first fifty cases diagnosed with S. suis infection in northern Viet Nam.
Methodology/Principal Findings
In 2007, diagnostics for S. suis were set up at a national hospital in Hanoi. That year there were 43 S. suis positive cerebrospinal fluid samples, of which S. suis could be cultured in 32 cases and 11 cases were only positive by PCR. Seven patients were blood culture positive for S. suis but CSF culture and PCR negative; making a total of 50 patients with laboratory confirmed S. suis infection in 2007. The number of S. suis cases peaked during the warmer months.
Conclusions/Significance
S. suis was commonly diagnosed as a cause of bacterial meningitis in adults in northern Viet Nam. In countries where there is intense and widespread exposure of humans to pigs, S. suis can be an important human pathogen.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




