Evolution of the sex-Related Locus and Genomic Features Shared in Microsporidia and Fungi

Abstract

Background

Microsporidia are obligate intracellular, eukaryotic pathogens that infect a wide range of animals from nematodes to humans, and in some cases, protists. The preponderance of evidence as to the origin of the microsporidia reveals a close relationship with the fungi, either within the kingdom or as a sister group to it. Recent phylogenetic studies and gene order analysis suggest that microsporidia share a particularly close evolutionary relationship with the zygomycetes.

Methodology/Principal Findings

Here we expanded this analysis and also examined a putative sex-locus for variability between microsporidian populations. Whole genome inspection reveals a unique syntenic gene pair (RPS9-RPL21) present in the vast majority of fungi and the microsporidians but not in other eukaryotic lineages. Two other unique gene fusions (glutamyl-prolyl tRNA synthetase and ubiquitin-ribosomal subunit S30) that are present in metazoans, choanoflagellates, and filasterean opisthokonts are unfused in the fungi and microsporidians. One locus previously found to be conserved in many microsporidian genomes is similar to the sex locus of zygomycetes in gene order and architecture. Both sex-related and sex loci harbor TPT, HMG, and RNA helicase genes forming a syntenic gene cluster. We sequenced and analyzed the sex-related locus in 11 different Encephalitozoon cuniculi isolates and the sibling species E. intestinalis (3 isolates) and E. hellem (1 isolate). There was no evidence for an idiomorphic sex-related locus in this Encephalitozoon species sample. According to sequence-based phylogenetic analyses, the TPT and RNA helicase genes flanking the HMG genes are paralogous rather than orthologous between zygomycetes and microsporidians.

Conclusion/Significance

The unique genomic hallmarks between microsporidia and fungi are independent of sequence based phylogenetic comparisons and further contribute to define the borders of the fungal kingdom and support the classification of microsporidia as unusual derived fungi. And the sex/sex-related loci appear to have been subject to frequent gene conversion and translocations in microsporidia and zygomycetes.

About the Authors:

Soo Chan Lee

Affiliation: Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, United States of America

Nicolas Corradi

Affiliation: Canadian Institute for Advanced Research, Department of Botany, University of British Columbia, Vancouver, Canada

Sylvia Doan

Affiliation: Canadian Institute for Advanced Research, Department of Botany, University of British Columbia, Vancouver, Canada

Fred S. Dietrich

Affiliations Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, United States of America, Institute for Genome Sciences and Policy, Duke University, Durham, North Carolina, United States of America

Patrick J. Keeling

Affiliation: Canadian Institute for Advanced Research, Department of Botany, University of British Columbia, Vancouver, Canada

Joseph Heitman

* E-mail: [email protected]

Affiliation: Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, United States of America

Introduction

Microsporidia are obligate intracellular pathogens that mainly infect animals including fish and insects, and also some protists and crustaceans [1], [2]. In microsporidia, ∼150 genera and approximately 1,300 species are known [3]. Thirteen microsporidian species infect humans causing chronic diarrhea in immunocompromised individuals, mainly AIDS patients; in some cases, infection can also occur in otherwise healthy hosts [4]. Microsporidia have a uniquely specialized infection device called the polar tube [5]. The polar spore tube is coiled within dormant spores and when stimulation occurs by encountering and recognizing the host, the polar tube is everted and penetrates the host cell membrane. The polar tube then serves as a conduit for delivery of the infectious material, the sporoplasm. Microsporidial cells lacking a cell wall replicate inside the host and produce meronts, which eventually form mature spores that are released from the host.

The phylogenetic placement of microsporidia has long been debated [6], [7]. Originally, microsporidia were placed within an artificial group, the schizomycetes (reviewed in [7]). They were then long considered to be related to other spore forming parasites, but due to the perceived lack of mitochondria, microsporidia were eventually considered to be an ancient eukaryotic lineage [8], [9]. Phylogenetic analysis based on protein coding sequences then aligned the microsporidia within the fungal kingdom [10], [11], [12], [13], [14], [15], and the lack of mitochondria was soon undermined by the discovery of a reduced “mitosome” in microsporidia [8], [16]. In addition, recent findings that microsporidian genomes harbor two syntenic ribosomal genes (RPL21 and RPS9) that are also syntenic throughout the fungi (with a few exceptions, such as Schizosaccharomyces pombe), supports a fungal origin. The RPL21-RPS9 synteny is only found in microsporidia and fungi [17], [18] and not in other opisthokonts or other eukaryotic groups, where these genes are unlinked.

Within the fungi, molecular phylogenetic analyses have suggested a relationship between microsporidia and either ascomycetes and basidiomycetes [19], [20] based on some genes, or with zygomycetes based on other genes [21], [22]. A phylogenetic relationship with the zygomycetes is also supported by the findings that microsporidian genome architecture is similar to that of zygomycetes, and strongly differs from any other extant fungal phyla [17]. One of the shared loci is of particular potential interest because it may represent a sex locus in microsporidia. This microsporidian sex-related locus is highly similar to the sex locus of the zygomycetes: both contain genes for a triose phosphate transporter (TPT), a high-mobility group (HMG) protein, and an RNA helicase. In zygomycetes, the sex locus orchestrates and regulates sexual reproduction [17], [23], [24], [25], [26], [27]. This synteny is unique to microsporidia and zygomycetes and absent in other fungi whose genomes are available, including chytridiomycetes, ascomycetes, and basidiomycetes. Therefore, the microsporidian sex-related locus could be involved in an extant sexual cycle, if it is indeed homologous. Furthermore, several recent studies identified the existence of the meiosis specific genes for ‘core meiotic recombination machinery’ including Spo11, Rad50/Mre11, Dmc1, Rad51, and Mlh1 in the microsporidian genomes [17], [28], which could be an indication of the possible existence of sex in microsporidia [29], [30]. However, bona fide sexual development of microsporidia has not been reported although there are some observations and inferences about the possibility based on morphological approaches [31], [32].

Here, we have examined the genomic architecture of microsporidia to identify further conserved characteristics to help determine the relationship between microsporidia and other opisthokonts. We have identified unique genomic characteristics shared only in microsporidia and fungi rather than other lineages in the opisthokonts and more divergent eukaryotic lineages that contribute to define the boundaries of the fungal kingdom by features independent of sequence based phylogenetic approaches. We have also analyzed the sex-related locus from multiple isolates of Encephalitozoon species to test for the presence of idiomorphic HMG genes as observed in the zygomycete sex locus, in which divergent sexP and sexM genes are encoded by the sex locus of (+) and (−) mating type strains, respectively. Further, we analyzed the TPT, HMG, and RNA helicase genes to determine the phylogenetic relationship with the homologous genes of zygomycetes. We discuss the evolutionary trajectory of the sex locus within the basal fungal lineages for the zygomycetes and microsporidia.

Results and Discussion

Genome structure data support the Microsporidia as fungi

Virtually all available evidence now supports a phylogenetic relationship between microsporidia and the fungi, but whether they are within or sisters to the fungi remains contentious, as does exactly what fungal lineage they might be most closely related to. Individual gene phylogenies place the microsporidia close to the ascomycetes, basidiomycetes, or zygomycetes [19], [20], [22], [33], whereas combined tubulin phylogenies place them with the zygomycetes [21] and a four gene phylogeny suggests that microsporidia are related to Rozella [15]. We have found that microsporidian genomes share an overall higher degree of gene order conservation with zygomycetes than with any other fungal lineage that has been well sampled at the genomic level. Interestingly, one conserved gene pair found in microsporidia (RPS9-RPL21) was also identified in all known fungal genomes except that of Schizosaccharomyces pombe (Figure 1 and Figure S1) [17], [18], [34]. To test whether this gene pair is a stable marker for fungi, we searched more broadly within the fungi and other opisthokonts. Three other Schizosaccharomyces fission yeast species, S. japonicus, S. octosporus, and S. cryophobus were also found to lack this gene pair, and interestingly the chytrid Spizellomyces punctatus was also found to lack the RPS9-RPL21 pair (Figure 1), and in these species homologs for both genes are present but unlinked. Thus, independent chromosome translocations might have occurred in the two fungal lineages that unlinked the two ribosomal genes in these exceptional species in the fungal kingdom.

[Figure omitted. See PDF.]

Figure 1. Unique genome characteristics for the fungi and microsporidia.

The RPS9-RPL21 synteny is uniquely found in the fungal and microsporidian genomes with two exceptions including Schizosaccharomyces species and S. punctatus. The two ribosomal genes, RPS9 and RPL21, are present but unlinked in other non-fungal eukaryotes. Two gene fusions are present in the metazoan and pre-metazoan lineages. Ubiquitin and ribosomal small subunit S30 are encoded by one fused gene (ubiquitin-S30) and two amino-acyl synthetase domains for glutamine and proline are encoded by one gene (glu-pro tRNA synthetase). However, within the opisthokonts, the fungi and microsporidia do not contain either fused gene and two unlinked and separate genes encode each domain.

https://doi.org/10.1371/journal.pone.0010539.g001

Searching for similar genomic markers revealed two other highly conserved characteristics that help distinguish microsporidia from non-fungal opisthokonts. First, a gene encoding a fusion protein between ubiquitin and the ribosomal S30 protein is found in choanozoans as well as metazoans [35], whereas in all fungal lineages, including microsporidia, these two domains are present as separate genes that are unlinked (Figure 1 and Figure S2). Similarly, a glutamyl-prolyl tRNA synthetase fusion protein is also found in metazoans, choanoflagellates and the filasterean Capsaspora [36]. Here, two tRNA synthetase domains are linked by an RNA binding domain that regulates gene expression through controlling translation [37], [38]. We found no such fusion gene in the fungal genomes analyzed, including microsporidia, zygomycetes, chytridiomycetes, ascomycetes, and basidiomycetes (Figure 1 and Figure S3). Thus, these two fusion proteins appear to have arisen within the opisthokonts, after the divergence of the ancestors of fungi and metazoans. While these fusions do not suggest a specific fungal lineage that is particularly close to microsporidia, they do support the specific relationship between microsporidia and fungi as a whole to the exclusion of other major opisthokont lineages.

Conservation of sex-related loci in microsporidia

Among the many gene pairs found to be conserved between microsporidia and zygomycetes in our previous study, one of particular interest was a putative sex-related locus in microsporidia [39]. This locus, which comprises an HMG domain-containing gene flanked by RNA helicase and triose phosphate transporter (TPT) genes, is similar in architecture to the sex loci of the zygomycetes Mucor circinelloides, Phycomyces blakesleeanus, and Rhizopus oryzae. In microsporidia, an additional hypothetical protein is found downstream of the TPT gene, and the E. cuniculi sex-related locus also contains a second novel gene with limited identity to HMG genes (weak HMG protein gene) (Figure 2). Interestingly, the sex-related locus of the recently sequenced Nosema ceranae genome is similar to that of Antonospora locustae in that the RNA helicase gene is not linked to the HMG gene in either genome (Figure 2). Molecular phylogenetic analysis consistently shows Encephalitozoon is more closely related to Nosema than either are to Enterocytozoon, so this pattern suggests the locus was present in the ancestor of Nosema. Moreover, in N. ceranae a hypothetical protein that is found elsewhere in the genomes of all other microsporidia investigated is found in place of the hypothetical protein linked to the HMG gene. Overall, the greater diversity of this locus now apparent suggests that gene conversion and translocation may have occurred frequently around/within the sex-related locus in microsporidia. This variation is also found in the sex locus of three zygomycetes, where the orientation of the TPT and SexP/M genes differs and there is a repetitive element or additional ORF found in the P. blakesleeanus and R. oryzae sex locus, respectively [17], [23], [40].

[Figure omitted. See PDF.]

Figure 2. sex-related locus of microsporidia.

Encephalitozoon cuniculi, E. intestinalis, and E. hellem share the same sex-related locus architecture containing the TPT, HMG, weak HMG, and RNA helicase genes. The weak HMG is not conserved outside Encephalitozoon species examined including E. bieneusi, A. locustae, and N. ceranae. In two insect pathogenic microsporidia, A. locustae and N. ceranae, the RNA helicase gene is unlinked to the HMG genes. The N. ceranae sex-related locus contains an additional predicted ORF between the TPT and HMG genes. A hypothetical protein is also linked in the sex-related locus across the microsporidia analyzed. Gene sizes are not to scale.

https://doi.org/10.1371/journal.pone.0010539.g002

Variation in the putative sex-related locus of microsporidia

If this region is a sex locus in microsporidia, we might expect to find variation corresponding to distinct sex alleles. To test for the presence of such variation, we compared the sequences of sex-related locus genes for the presence of multiple paralogs, and also characterized the putative sex-related locus from three distinct species and multiple strains in the genus Encephalitozoon.

Characterization of the sex-related loci of E. intestinalis and E. hellem revealed an overall architecture identical to that of E. cuniculi: TPT, HP, HMG, weak HMG, and RNA helicase gene (Figure 2). The overall sequence conservation between homologous genes in these three species was also very high (for example see Figure 3). All Encephalitozoon isolates were found to be highly conserved (i.e., not an opposite mating type. See below) and the HMG proteins in all Encephalitozoon species as well as A. locustae have two HMG domains in the HMG protein (Figure 3) [17], whereas in the HMG proteins in N. ceranae and E. bieneusi only one HMG domain was found (data not shown) [17]. The HMG proteins have ∼90% identity between the three Encephalitozoon species, whereas the weak HMG domain proteins have relatively lower alignment scores (∼45% identity between E. cuniculi vs. E. intestinalis, ∼46% identity between E. intestinalis vs. E. hellem, and ∼51% identity between E. cuniculi vs. E. hellem). Comparison of the hypothetical proteins showed >78% identity between each species (data not shown). Thus, only the weak HMG domain protein was shown to be more diverged than the other proteins encoded by the sex-related locus between the three species. However the similarity is much higher than between SexP and SexM in zygomycetes. Given that the SexP and SexM proteins share only 14% and 20% similarity in M. circinelloides and P. blakesleeanus, respectively, the level of variation in microsporidian HMGs does not support the presence of idiomorphic HMG/weak HMG genes in the Encephalitozoon species complex.

[Figure omitted. See PDF.]

Figure 3. Alignments for HMG and weak HMG proteins in Encephalitozoon species.

Alignment for the HMG proteins shows the HMG gene is highly conserved in eleven E. cuniculi, three E. intestinalis, and one E. hellem isolates suggesting divergent HMG genes are absent in this sample collection in contrast to the zygomycete sex locus which has sexP and sexM alleles. Tandem HMG domains are observed across the three species (highlighted boxes). Alignment for the weak HMG proteins also displays a relatively high level of conservation across the three species.

https://doi.org/10.1371/journal.pone.0010539.g003

To examine the level of variation within species for possible allelic heterogeneity, the sex-related locus was characterized from eleven genetically distinct E. cuniculi isolates and three strains of E. intestinalis from different host environments. The sex-related locus of the three E. intestinalis isolates was also very similar (>99% identity), as were all eleven isolates of E. cuniculi.

Given the level of sampling at least for E. cuniculi, it seems unlikely that multiple distinct sex type alleles exist with equal frequency at this locus, so if E. cuniculi sexual development occurs, is the sex-related locus involved and if so how? One possibility is that an opposite mating type allele/idiomorph is infrequent or rare, as is in case in the human pathogenic basidiomycete Cryptococcus neoformans [41]. A second possibility is that E. cuniculi is homothallic (self-fertile) [42] and sex might involve unisexual reproduction, similar to C. neoformans [43], [44], [45] or Candida albicans [46], [47]. The E. cuniculi HMG protein contains two HMG domains whereas zygomycete SexP and SexM have only one HMG domain (Figure 3) [17]. The two HMG domains may function separately and play the equivalent roles of SexP and SexM. This does not, however, explain the single HMG-domain containing proteins of N. ceranae and Enterocytozoon bieneusi. Alternatively, the weak HMG protein in the Encephalitozoon sex-related locus [17] (Figure 2) could play functions equivalent to SexP and SexM, but once again this protein was not observed in the other microsporidia.

Linking the sex-related locus to sexual development in microsporidia

As of yet, there is no direct evidence linking the sex-related locus to sex determination or sexual reproduction in the microsporidia. The types of evidence that would be necessary to assign such a functional role could include a demonstration of opposite alleles or idiomorphs present in different isolates. We have sequenced the sex-related locus in eleven different E. cuniculi isolates, however, and found them to be highly conserved with the exception of a few point mutations, which tellingly are restricted to the flanking genes and are not found in the HMG or weak HMG genes (Figures 3 and 4).

[Figure omitted. See PDF.]

Figure 4. sex-related locus comparison between E. cuniculi isolates.

The sex-related locus of EC1 and the reference isolate share 100% sequence identity, whereas the EC2 and EC3 sex-related locus has four synonomous (black asterisks) and three nonsynonomous (red asterisks) base substitutions (I38V in the hypothetical protein and C109S and I197M in the RNA helicase). These limited base changes do not support assignment as idiomorphs.

https://doi.org/10.1371/journal.pone.0010539.g004

Of course the zygomycete sex locus is just one strategy of many used in fungi. Given the independent data favoring a zygomycete origin of microsporidia, both from genome structure and some molecular phylogeny, it is the most reasonable system to search for initially, but others should also be considered if the sex-related locus proves not to be related to sex after all. For example, basidiomycetes utilize homeodomain (HD) transcription factors to orchestrate and regulate sexual development, such as the Ustilago maydis b alleles that encode two divergently transcribed HD1 and HD2 class proteins (reviewed in [48]), or the Coprinopsis cinerea A locus that also encodes two divergently transcribed homeodomain proteins [49]. In Cryptococcus, the α and a mating type locus encodes different classes of HD proteins, in which the MATa allele encodes only an HD2 factor (Sxi2a) while the MATα allele encodes only an HD1 factor (Sxi1α), in contrast to other basidiomycete MAT loci [50]. It would be worthwhile to investigate whether microsporidia have a pair of HD genes that are idiomorphic between isolates, as in U. maydis, or two functionally different HD in the same locus, as in different isolates as in Cryptococcus. We investigated three homeodomain gene clusters described previously (six HD genes: ECU03_0600, ECU03_0610, ECU04_0970, ECU04_1030, ECU10_1470, and ECU10_1480) [17], [51] in three E. cuniculi isolates that were previously proposed to represent candidate mating type loci [52]. Once again, however, no evidence for distinct alleles or idiomorphs was apparent from sequence analysis across the three homeodomain gene clusters (GenBank accession at HM049491 to HM049502) (Figure S4).

Although there is some morphological data that has been interpreted to suggest that some microsporidian species may undergo sexual reproduction [31], [32], this is not known for any of the six species in the current analysis. The type of evidence that would be necessary to show this definitively includes a demonstration of marker exchange (recombination) following co-infection of distinct isolates, or the finding that ploidy changes occur in the population (such as the finding of diploid or dikaryon isolates, or isolates heterozygous for genomic markers). Finally, to provide evidence linking the sex-related locus to sexual reproduction will require, for example, documentation that the genes therein are expressed at an appropriate time in the life cycle, or to show a candidate protein binds physically to the promoters for meiotic gene homologs by chromatin immunoprecipitation studies. These and other studies are ongoing to test whether sexual reproduction occurs in E. cuniculi, and whether the sex-related locus participates in this process.

Oblique ortholog assignment between the sex-related/sex locus genes of microsporidia and zygomycetes

The sex-related locus in the E. cuniculi genome was originally identified using Blast searches with the sexP gene from the functionally-defined sex locus from Phycomyces blakesleeanus [23]. This revealed the homologous E. cuniculi HMG gene that is unique in the genome, and the region around this gene was then subjected to manual annotation and inspection, revealing the presence of a flanking triose phosphate transporter (TPT) gene and an RNA helicase gene homologs, strikingly similar to the organization of the sex locus in P. blakesleeanus, and also in Mucor circinelloides and Rhizopus oryzae. Here we address whether the genes flanking and within the sex and sex-related loci are orthologs or paralogs.

With respect to the HMG gene contained in the sex-related locus, while Blast searches with P. blakesleeanus SexP identify the E. cuniculi gene as homologous, reciprocal Blast searches with the E. cuniculi gene against other fungi return a variety of related HMG proteins in the R. oryzae genome. Construction of phylogenetic trees based on either the isolated HMG domains or the full-length proteins suggests that the high rate of divergence makes identifying orthologs problematic. Indeed, no microsporidian genes that are clear candidates to be orthologous with either SexP/M were found, although one domain of the E. cuniculi sex-related locus gene did branch with the M. circinelloides SexM with no bootstrap support. Further, there was low bootstrap support for virtually all nodes in the tree (Figure 4A). In fact, the zygomycete sex genes do not form a clade even though there is no question that the sexM and sexP genes are paralogous given the level of sequence identity and functional analysis (Figure 5A). Similarly, the microsporidian HMG domains (also including both domains from the dual-HMG genes) do not form a clade either, even though they are found in nearly identical genomic contexts and the orthology of the microsporidian TPT and RNA helicase genes is not in question (see below). In reciprocal Blast searches, there is a second HMG domain gene in the P. blakesleeanus genome that does share a modestly higher level of identity with the microsporidian HMG domain gene in the sex-related locus (jgi|Phybl1|79113|estExt_ fgeneshPB_pg.C_220136). The HMG domain gene family is very divergent and subject to accelerated rates of change in the case of the sex locus. In addition the evolutionary trajectory for an HMG domain determinant in the zygomycetes, which are heterothallic and have two opposite mating type genes (sexM and sexP), may be very different in a hypothesized homothallic species that may have a single sex determinant. It may simply be the case that this is an example of syntenic orthologs that do not share the highest level of identity with the syntenic partner, a problem for which there are precedents in other fungi.

[Figure omitted. See PDF.]

Figure 5. Phylogenetic analyses of the HMG, TPT, and RNA helicases.

(A) One of the E. cuniculi HMG domains (HMG2) is aligned with SexM of the zygomycetes. The other HMG domain (HMG1) is aligned with HMG domains of zygomycetes other than SexP or SexM. The HMG domains of E. bieneusi and A. locustae are also aligned with HMG domains other than SexP or SexM. Note the low bootstrap values on each node of the tree. (B) The microsporidian TPTs are aligned to other TPTs rather than the one in the sex locus. This result suggests that the TPTs in the sex-related/sex loci are paralogs (for further discussion, see the text). (C) The microsporidian RNA helicases are also paralogs to the zygomycotan sex locus RNA helicases. Scale indicates an amino acid alteration per position (see the text for further discussion).

https://doi.org/10.1371/journal.pone.0010539.g005

We also performed phylogenetic analysis of the microsporidian TPT, which identified another gene in the zygomycete genomes that is more closely related compared to the sex locus linked TPT gene (Figure 5B). In maximum likelihood analysis, the zygomycotan sex-linked TPT genes were also closely related, so we find it hard to conclude with much certainty which of these genes are orthologous.

There are multiple paralogs of the RNA helicase present in microsporidian genomes, and again phylogenetic analysis reveals that the RNA helicase genes linked to the sex locus and the sex-related locus are also either paralogs or highly derived orthologs (Figure 5C). The microsporidian RNA helicases of the sex-related locus group in a clade that is distinct from the zygomycotan RNA helicases of the sex locus. However, within that clade, the support for the position of the proposed orthologs is extremely low. In fact, the entire clade is unsupported, so there is no evidence that the microsporidian helicases of the sex-related locus are more closely related to the ones proposed in Figure 5C than to any zygomycete helicase in this family. Overall, therefore, both the TPT and RNA helicase genes flanking the sex or sex-related locus are either highly derived orthologs or paralogs.

It is interesting to ask, if the RNA helicase and TPT genes are not orthologous to those in the zygomycete sex locus, why are the microsporidian, especially E. cuniculi/intestinalis/hellem and E. bieneusi, HMG genes also surrounded by a TPT and RNA helicase gene? The functional and genomic architecture of the microsporidian sex-related locus is highly similar to the zygomycotan sex locus, even though the sequences of the genes are highly derived. Moreover, this architecture (TPT/HMG/RNA helicase or TPT/HMG gene cluster) is conserved only between these two groups and is not shared with other fungal phyla or representative outgroups, including the choanoflagellate Monosiga brevicollis and the filasterea Capsaspora owczarzaki (see also reference [17]).

The question, therefore, is whether there is a functional relationship between these three genes in the microsporidian sex-related locus and those in the zygomycete sex locus? There are several possible interpretations of these findings. First, the three genes may represent positional orthologs that are rapidly diverging as a result of gene duplication and conversion (Figure 6) and therefore appear less closely related. Gene duplications tend to occur locally, leading to linked paralogs. Gene loss can then result in paralog-ortholog syntenic gene pairs compared to ortholog-ortholog gene pairs. There are clear examples of this throughout the Ascomycota in which positional information has been necessary to correctly assign orthologous relationships [53]. Given the nature of the mating type locus and genes resident therein as rapidly evolving [54], [55], [56], [57], it is likely that similar criteria will be necessary here as well. There are also clear cases in hemiascomycetous fungi in which true orthologs can be defined by synteny, though they are not always the gene pair that shares the highest level of identity in pairwise comparisons of the two genomes. One striking example involves the six kinesin genes in Saccharomyces cerevisiae compared to Ashbya gossypii. There is another important example for this in the microsporidia. A cellular hallmark of all microsporidia is the presence of a polar tube. The proteins that compose the tube (PTP1, 2 and 3) are extremely divergent between members of the group, to the point that synteny is actually the only available way (outside antibody precipitation) to identify and annotate these proteins in newly sequenced genomes [58]. In N. ceranae, two of the PTP proteins only share 16.7% and 19.6% percent identity, respectively, when aligned with their putative E. cuniculi orthologs. Thus, it is simply not possible to assign the correct orthologous relationships by Blast searches, but syntenic position information can reveal which are orthologs based on conservation in the flanking genes [53]. Another striking example of difficulty in assigning orthologs based on sequence similarity is the case of the BAR1 gene in Candida albicans and S. cerevisiae. The Bar1 protein encoded by BAR1 is an aspartyl protease that degrades the alpha factor pheromone in S. cerevisiae [59]. In studies by Schaefer et al., Blast searches of the C. albicans genome with S. cerevisiae Bar1 revealed 14 homologous proteins, and the 12th protein, based on the sequence comparison % similarity, was found to be the bona fide Bar1 ortholog based on functional studies. The 11 paralogs that share greater similarity than the bona fide ortholog are members of the SAP protease family [46], [60].

[Figure omitted. See PDF.]

Figure 6. Hypothesis for the paralogous relationship between syntenic genes in zygomycetes and microsporidia.

In the model presented, gene duplication, gene conversion, and chromosome translocation within the syntenic regions resulted in the formation of a syntenic locus with paralogous rather than orthologous genes.

https://doi.org/10.1371/journal.pone.0010539.g006

Second, the HMG genes may be orthologs and one or both of the flanking genes may share a paralogous relationship (see Figure 7). The promoter of the TPT gene is part of the M. circinelloides sex locus, indicating that these genes lie at the junction spanning both the common and diverged regions of the genome at the border of the sex locus. From detailed analyses of the mating type locus of Cryptococcus, it is clear that genes can be evicted from this locus, and genes which are quite divergent and clearly part of MAT are fixed as one of the two paralogs (IKS1, NMC1, BSP3) in other closely related lineages [61], [62]. Moreover, gene duplication and conversion events can occur within MAT which change the phylogenetic relationship of the resident genes (Figure 6). Thus, one possible scenario is that the TPT, HMG, and helicase genes were all part of an ancestral locus, and that one or the other paralog for the TPT and helicase gene was fixed and linked to the HMG gene in two descendent lineages. Sequence analysis of other basal fungi will allow this model to be tested in further detail. This notion has some interesting implications developed in more detail below (see Figure 7).

[Figure omitted. See PDF.]

Figure 7. Evolutionary trajectory of the sex locus within zygomycetes and microsporidia.

An ancestral sex locus might have spanned the TPT and RNA helicase genes. Thus, two divergent TPT, HMG, and RNA helicase genes were present in the two sex-alleles. In the microsporidian lineage, only one allele was retained. In the zygomycetes, local recombination might have fixed the TPT and RNA helicase genes resulting in one allele for these genes, whereas two alleles of the HMG genes remain in the two opposite mating types.

https://doi.org/10.1371/journal.pone.0010539.g007

Third, the three genes of the sex-related locus identified in the microsporidia may each be paralogous with the genes in the sex locus of zygomycetes. This model is the most straightforward in terms of the available sequence data, but it invokes the convergent evolution of two similar gene clusters including a TPT transporter, an HMG domain protein, and an RNA helicase. Remembering that genome structure and some phylogenetic analysis both support a close relationship between microsporidia and zygomycetes [12], it seems unlikely that a gene cluster with such functional significance in zygomycetes would also assemble by chance independently in their sisters, the microsporidia (see supplementary discussion File S1).

A model for the evolution of mating type loci by gene capture and eviction

A P. blakesleeanus TPT gene unlinked to the sex locus is present in the genome that may be more closely related to the TPT gene linked to the sex-related locus of microsporidia. Again this may simply be a case in which the gene is rapidly evolving and sequence similarity is not sufficient to correctly assign the orthologous relationship. However if we assume that the TPT genes linked to the sex and the sex-related locus are paralogous, it leads to an interesting model for the evolution of the mating type locus (Figure 7). The assignment of the sex locus in P. blakesleeanus and M. circinelloides has been definitively established based on functional approaches that show the sex genes control sexual identity and orchestrate sexual reproduction [23] (Lee, Gryganskyi, Li, Vilgalys, and Heitman, unpublished data). One interesting feature involves the border of the sex locus and the TPT gene [17]. While the TPT gene and its promoter flank the sex locus in P. blakesleeanus, the ORF of the TPT gene lies in the region flanking the sex locus in M. circinelloides, and the promoter lies within the sex locus, and is thus sexually dimorphic. Thus, the TPT gene straddles the border of the sex locus, similar to the amelogenin gene at the border between the pseudoautosomal and sex-specific regions of the mammalian sex chromosomes [63].

This raises the possibility that in a last common ancestor, and possibly also in some extant species, the TPT gene promoter including the ORF was a bona fide component of the sex locus (Figure 7). There are clear examples throughout the fungal kingdom of genes that have been captured into the mating type locus, lost from the mating type locus, or evicted from the mating type locus [64], [65], [66], [67], [68], [69]. A striking example of this last process is found in the detailed comparisons of the mating type locus in the Cryptococcus neoformans and Cryptococcus gattii lineages (serotypes A, D, and B that have diverged over ∼40 million years of evolution) [61], [62]. In serotypes A and B, three genes (IKS1, NCM1, and BSP3) are clearly part of the mating type locus, present in both the a and α alleles, and sex-specific. In contrast, in the serotype D C. neoformans var. neoformans lineage, these three genes have been evicted from MAT by a gene conversion event, and fixed as the α allele in the 3′ flanking region of the MAT locus. Thus, these three genes were within MAT in the last common ancestor, and remain within MAT in two extant lineages, but are no longer within MAT in a related diverged lineage.

Based on this analogy, it is possible that the TPT gene was part of an ancestral sex locus, but then evicted by similar gene conversion events (Figure 7). If one TPT allele was fixed in the zygomycete lineage as part of the sex locus and the other allele was fixed in the microsporidian lineage but evicted from MAT, then the observed situation would arise. To test this model additional genome or sex and sex-related loci must be characterized from zygomycete and microsporidian lineages, and these studies are in progress.

Based on this model, at one point there may have been that an ancestral sex locus that contained two HMG domain genes, similar to heterothallic to homothallic transitions that occur commonly in other fungi. One or the other was lost or transposed elsewhere in the genome in a transition to heterothallism. As of yet it is unknown how the two HMG domains in the microsporidia arose, but each of the two domains appears to be more closely related to SexP than to SexM of the zygomycetes. Thus, this might have resulted from a SexP-SexP gene fusion that subsequently underwent accelerated evolution, and its orthologous relationship to the ancestral gene is now less clear based solely on percent identity comparisons for genes in this large, divergent family of transcriptional regulators.

Currently these comparisons are restricted to speculation by the paucity of genomic information from basal fungal lineages, currently limited to three Mucorales and two chytrid species, and from microsporidia, currently limited to three genomes (E. cuniculi/intestinalis/hellem, the last two of which are in progress to be released) and genome survey/draft genomes (A. locustae, N. ceranae, and Octosporea bayeri) [39], [70], [71], [72]. As additional whole genome analyses are reported these hypotheses can be tested more directly, and it is also possible that species with currently unsampled genomes may emerge as even more closely related to the microsporidia than are the Mucorales.

Materials and Methods

E. cuniculi cultures and genomic DNA extraction

Three E. cuniculi strains, EC1, EC2, and EC3 (Table 1), were kindly provided by Dr. Louis Weiss. These strains were isolated from the kidney of an infected rabbit, mouse, and dog, respectively and represent three genotypes of E. cuniculi [73], [74]. The strains were maintained in RK13 (rabbit kidney) cells. RK13 cells were grown in MEM media containing 7% FBS supplemented with penicillin-streptomycin (Invitrogen, Co.) as described previously [75]. Monolayers of RK13 cells were subject to E. cuniculi infection. The MEM media was changed twice a week and spent media was collected to accumulate spores. Genomic DNA from EC1, EC2, and EC3 was extracted as described [75]. Encephalitozoon intestinalis and Encephalitozoon hellem (Table 1) previously harvested from humans were maintained in RK13 cells [74], [76], [77]. Spores were isolated by sequential washing with dH2O, TBS-Tween 20 (0.3%), and TBS, followed by Percoll™ centrifugation, a final wash with TBS-SDS (0.1%), and genomic DNA was extracted using established protocols [78].

[Figure omitted. See PDF.]

Table 1. Strains used in this study.

https://doi.org/10.1371/journal.pone.0010539.t001

Identification and sequencing of the sex-related locus

The sex-related locus from the EC1, EC2, and EC3 isolates was amplified with high fidelity Taq polymerase (Roche) using primers, JOHE20578- CCGGTGTTCATCCTTCTGTT and JOHE20579-GCACGTCTCACAGTTGACCA. The amplicons were sequenced with primers JOHE20578, JOHE20579, JOHE20720- CAGTAAAAAGGCGCAAGGAC, and JOHE20721-CTAGAATGCGCCCCATACAT. Three independent PCR reactions were performed and analyzed. The sex-related locus of E. intestinalis and E. hellem was identified through in-depth genome surveys. This locus was samples in all isolates analyzed here using the following “forward” primer sets: TPTF1-TGTGCAGAGTTTACGCTCGTT; TPTF2-TGAACTATGTTGGGCTGACCATAA; TPTF3-CTGACCATAAGCATTGCAGGAAT in combination with the following reverse primers: HelicaseR1-GGCTTGACATTCCGTATCTCGAC and HelicaseR2-TACGACCTATGTGACGAGAGAACAT

The sex-related locus of N. ceranae and RPL21-RPS9 synteny were identified by Blast with the E. cuniculi TPT, HMG, and RNA helicase genes using Formatdb against a local copy of the NCBI nr database.

Annotation and phylogenetic analyses

Sequences were annotated by using FGENESH or ORFfinder (NCBI). For phylogenic analyses for the sex-related locus components, deduced amino sequences were aligned with ClustalW and the alignment results were manually inspected and corrected if needed. Maximum likelihood trees (bootstrap number  = 100) were generated by using the PhyML 3.0 software [79].

Blast search for the RPS9-RPL21 gene synteny, glutamyl-prolyl tRNA synthetase gene, and ubiquitin-ribosomal subunit S30 gene

Blast search with glutamyl-prolyl tRNA sythetase and ubiquitin-ribosomal S30 genes against Mucor circinelloides (http://genome.jgi-psf.org/Mucci1/Mucci1.home.html), Phycomyces blakesleeanus (http://genome.jgi-psf.org/Phybl1/Phybl1.home.html), Rhizopus oryzae (http://www.broadinstitute.org/annotation/genome/rhizopus_oryzae/MultiHome.html), Batrachochytrium dendrobatidis (http://www.broadinstitute.org/annotation/genome/batrachochytrium_dendrobatidis/MultiHome.html), Allomyces macrogynus (the Origin of Multicellularity Project at the Broad Institute), Encephalitozoon cuniculi (NCBI), Enterocytozoon bieneusi (NCBI), Nosema ceranae (NCBI), and Antonospora locustae (http://gmod.mbl.edu/antonospora) genomes was conducted to identify homologs in the basal fungal lineages. The flanking areas were manually annotated to test whether fused amino-acyl synthetases were conserved in these fungi. A synteny search for RPS9-RPL21 was conducted against the genomes of Capsaspora owczarzaki, Proterospongia sp, and Spizellomyces punctatus presented in the database for the Origin of Multicellularity Project at the Broad Institute. For other eukaryotic lineages, Giardia lamblia (Excavata) (NCBI), Phytophthora infestans (Chromista) (Broad Institute), Arabidopsis thalina (Planta) (NCBI), and three amoebozoans (NCBI) including the Entamoeba histolytica, E. dispar, and Dictyostelium discoideum genomes were analyzed. Four archiascomycete genomes for Schizosaccharomyces pombe, S. japonicus, S. octosporus, and S. cryophobus (http://www.broadinstitute.org/annotation/genome/schizosaccharomyces_group/MultiHome.html) were analyzed for RPS9-RPL21 gene synteny.

Supporting Information

[Figure omitted. See PDF.]

File S1.

Calculation of the probability of convergence to similar gene clusters.

https://doi.org/10.1371/journal.pone.0010539.s001

(0.04 MB DOC)

Figure S1.

Fungal specific RPL21-RPS9 gene cluster in newly sequenced microsporidians and fungi.

https://doi.org/10.1371/journal.pone.0010539.s002

(0.34 MB TIF)

Figure S2.

A fusion gene for ubiquitin and ribosome small subunit S30 found within non-fungal lineages in opisthokonts.

https://doi.org/10.1371/journal.pone.0010539.s003

(0.36 MB TIF)

Figure S3.

A fusion gene for two tRNA synthetases found within non-fungal lineages in opisthokonts.

https://doi.org/10.1371/journal.pone.0010539.s004

(0.38 MB TIF)

Figure S4.

Sequence comparison for homeodomain gene clusters in four E. cuniculi isolates.

https://doi.org/10.1371/journal.pone.0010539.s005

(0.07 MB TIF)

Acknowledgments

We thank Tim James, Jason Stajich, Cecelia Shertz, Ingo Ebersberger, Paul Fox, and John Taylor for critical discussions. We are indebted to Louis Weiss and Elizabeth Didier for providing E. cuniculi, E. hellem, and E. intestinalis isolates and instructions and advice for culture. We are grateful to the Broad Institute and the DOE Joint Genome Institute for making genome sequences available.

Author Contributions

Conceived and designed the experiments: PJK JH. Performed the experiments: SCL NC SD FSD. Analyzed the data: SCL NC FSD PJK JH. Contributed reagents/materials/analysis tools: PJK JH. Wrote the paper: SCL NC PJK JH.

Citation: Lee SC, Corradi N, Doan S, Dietrich FS, Keeling PJ, Heitman J (2010) Evolution of the sex-Related Locus and Genomic Features Shared in Microsporidia and Fungi. PLoS ONE 5(5): e10539. https://doi.org/10.1371/journal.pone.0010539

References

1. Troemel ER, lix M-A, Whiteman NK, Barriere A, Ausubel FM (2008) Microsporidia are natural intracellular parasites of the nematode Caenorhabditis elegans. PLoS Biol 6: e309.ER TroemelM-A lixNK WhitemanA. BarriereFM Ausubel2008Microsporidia are natural intracellular parasites of the nematode Caenorhabditis elegans.PLoS Biol6e309

2. Keeling PJ, Fast NM (2002) Microsporidia: biology and evolution of highly reduced intracellular parasites. Annu Rev Microbiol 56: 93–116.PJ KeelingNM Fast2002Microsporidia: biology and evolution of highly reduced intracellular parasites.Annu Rev Microbiol5693116

3. Wittner M, Weiss LM (1999) The microsporidia and microsporidiosis. Washington D.C.: ASM Press. M. WittnerLM Weiss1999The microsporidia and microsporidiosis.Washington D.C.ASM Press

4. Didier ES, Maddry JA, Brindley PJ, Stovall ME, Didier PJ (2005) Therapeutic strategies for human microsporidia infections. Expert Rev of Anti infec Ther 3: 419–434.ES DidierJA MaddryPJ BrindleyME StovallPJ Didier2005Therapeutic strategies for human microsporidia infections.Expert Rev of Anti infec Ther3419434

5. Xu Y, Weiss LM (2005) The microsporidian polar tube: a highly specialised invasion organelle. Int J Parasitol 35: 941–953.Y. XuLM Weiss2005The microsporidian polar tube: a highly specialised invasion organelle.Int J Parasitol35941953

6. Corradi N, Keeling PJ (2009) Microsporidia: a journey through radical taxonomical revisions. Fungal Biol Rev 23: 1–8.N. CorradiPJ Keeling2009Microsporidia: a journey through radical taxonomical revisions.Fungal Biol Rev2318

7. Keeling P (2009) Five questions about microsporidia. PLoS Pathog 5: e1000489.P. Keeling2009Five questions about microsporidia.PLoS Pathog5e1000489

8. Vossbrinck CR, Maddox JV, Friedman S, Debrunner-Vossbrinck BA, Woese CR (1987) Ribosomal-RNA sequence suggests microsporidia are extremely ancient eukaryotes. Nature 326: 411–414.CR VossbrinckJV MaddoxS. FriedmanBA Debrunner-VossbrinckCR Woese1987Ribosomal-RNA sequence suggests microsporidia are extremely ancient eukaryotes.Nature326411414

9. Cavalier-Smith T (1986) The kingdoms of organisms. Nature 324: 416–417.T. Cavalier-Smith1986The kingdoms of organisms.Nature324416417

10. Peyretaillade E, Biderre C, Peyret P, Duffieux F, Metenier G, et al. (1998) Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core. Nucleic Acids Res 26: 3513–3520.E. PeyretailladeC. BiderreP. PeyretF. DuffieuxG. Metenier1998Microsporidian Encephalitozoon cuniculi, a unicellular eukaryote with an unusual chromosomal dispersion of ribosomal genes and a LSU rRNA reduced to the universal core.Nucleic Acids Res2635133520

11. Hirt RP, Logsdon JM, Healy B, Dorey MW, Doolittle WF, et al. (1999) Microsporidia are related to fungi: evidence from the largest subunit of RNA polymerase II and other proteins. Proc Natl Acad Sci U S A 96: 580–585.RP HirtJM LogsdonB. HealyMW DoreyWF Doolittle1999Microsporidia are related to fungi: evidence from the largest subunit of RNA polymerase II and other proteins.Proc Natl Acad Sci U S A96580585

12. Weiss LM, Edlind TD, Vossbrinck CF, Hashimoto T (1999) Microsporidian molecular phylogeny: the fungal connection. J Eukaryot Microbiol 46: 17S–18S.LM WeissTD EdlindCF VossbrinckT. Hashimoto1999Microsporidian molecular phylogeny: the fungal connection.J Eukaryot Microbiol4617S18S

13. Edlind TD, Li J, Visvesvara GS, Vodkin MH, McLaughlin GL, et al. (1996) Phylogenetic analysis of beta-tubulin sequences from amitochondrial protozoa. Mol Phylogenet Evol 5: 359–367.TD EdlindJ. LiGS VisvesvaraMH VodkinGL McLaughlin1996Phylogenetic analysis of beta-tubulin sequences from amitochondrial protozoa.Mol Phylogenet Evol5359367

14. Keeling PJ, Doolittle WF (1996) Alpha-tubulin from early-diverging eukaryotic lineages and the evolution of the tubulin family. Mol Biol Evol 13: 1297–1305.PJ KeelingWF Doolittle1996Alpha-tubulin from early-diverging eukaryotic lineages and the evolution of the tubulin family.Mol Biol Evol1312971305

15. James TY, Kauff F, Schoch CL, Matheny PB, Hofstetter V, et al. (2006) Reconstructing the early evolution of fungi using a six-gene phylogeny. Nature 443: 818–822.TY JamesF. KauffCL SchochPB MathenyV. Hofstetter2006Reconstructing the early evolution of fungi using a six-gene phylogeny.Nature443818822

16. Williams BAP, Hirt RP, Lucocq JM, Embley TM (2002) A mitochondrial remnant in the microsporidian Trachipleistophora hominis. Nature 418: 865–869.BAP WilliamsRP HirtJM LucocqTM Embley2002A mitochondrial remnant in the microsporidian Trachipleistophora hominis.Nature418865869

17. Lee SC, Corradi N, Byrnes EJ, Torres-Martinez S, Dietrich FS, et al. (2008) Microsporidia evolved from ancestral sexual fungi. Curr Biol 18: 1675–1679.SC LeeN. CorradiEJ ByrnesS. Torres-MartinezFS Dietrich2008Microsporidia evolved from ancestral sexual fungi.Curr Biol1816751679

18. Lee SC, Weiss LM, Heitman J (2009) Generation of genetic diversity in microsporidia via sexual reproduction and horizontal gene transfer. Commun Integr Biol 2: 1–5.SC LeeLM WeissJ. Heitman2009Generation of genetic diversity in microsporidia via sexual reproduction and horizontal gene transfer.Commun Integr Biol215

19. Thomarat F, Vivarès CP, Gouy M (2004) Phylogenetic analysis of the complete genome sequence of Encephalitozoon cuniculi supports the fungal origin of microsporidia and reveals a high frequency of fast-evolving genes. J Mol Evol 59: 780–791.F. ThomaratCP VivarèsM. Gouy2004Phylogenetic analysis of the complete genome sequence of Encephalitozoon cuniculi supports the fungal origin of microsporidia and reveals a high frequency of fast-evolving genes.J Mol Evol59780791

20. Gill EE, Fast NM (2006) Assessing the microsporidia-fungi relationship: combined phylogenetic analysis of eight genes. Gene 375: 103–109.EE GillNM Fast2006Assessing the microsporidia-fungi relationship: combined phylogenetic analysis of eight genes.Gene375103109

21. Keeling P (2003) Congruent evidence from alpha-tubulin and beta-tubulin gene phylogenies for a zygomycete origin of microsporidia. Fungal Genet Biol 38: 298–309.P. Keeling2003Congruent evidence from alpha-tubulin and beta-tubulin gene phylogenies for a zygomycete origin of microsporidia.Fungal Genet Biol38298309

22. Keeling PJ, Luker MA, Palmer JD (2000) Evidence from beta-tubulin phylogeny that microsporidia evolved from within the fungi. Mol Biol Evol 17: 23–31.PJ KeelingMA LukerJD Palmer2000Evidence from beta-tubulin phylogeny that microsporidia evolved from within the fungi.Mol Biol Evol172331

23. Idnurm A, Walton FJ, Floyd A, Heitman J (2008) Identification of the sex genes in an early diverged fungus. Nature 451: 193–196.A. IdnurmFJ WaltonA. FloydJ. Heitman2008Identification of the sex genes in an early diverged fungus.Nature451193196

24. Daniels KJ, Srikantha T, Lockhart SR, Pujol C, Soll DR (2006) Opaque cells signal white cells to form biofilms in Candida albicans. EMBO J 25: 2240–2252.KJ DanielsT. SrikanthaSR LockhartC. PujolDR Soll2006Opaque cells signal white cells to form biofilms in Candida albicans.EMBO J2522402252

25. Dyer PS (2008) Evolutionary biology: genomic clues to original sex in fungi. Curr Biol 18: R207–R209.PS Dyer2008Evolutionary biology: genomic clues to original sex in fungi.Curr Biol18R207R209

26. Dyer PS (2008) Evolutionary biology: microsporidia sex–a missing link to fungi. Curr Biol 18: R1012–1014.PS Dyer2008Evolutionary biology: microsporidia sex–a missing link to fungi.Curr Biol18R10121014

27. Casselton LA (2008) Fungal sex genes-searching for the ancestors. BioEssays 30: 711–714.LA Casselton2008Fungal sex genes-searching for the ancestors.BioEssays30711714

28. Malik S-B, Pightling AW, Stefaniak LM, Schurko AM, Logsdon JM Jr (2008) An expanded inventory of conserved meiotic genes provides evidence for sex in Trichomonas vaginalis. PLoS ONE 3: e2879.S-B MalikAW PightlingLM StefaniakAM SchurkoJM Logsdon Jr2008An expanded inventory of conserved meiotic genes provides evidence for sex in Trichomonas vaginalis.PLoS ONE3e2879

29. Schurko AM, Logsdon JMJ (2008) Using a meiosis detection toolkit to investigate ancient asexual “scandals” and the evolution of sex. BioEssays 30: 579–589.AM SchurkoJMJ Logsdon2008Using a meiosis detection toolkit to investigate ancient asexual “scandals” and the evolution of sex.BioEssays30579589

30. Schurko AM, Neiman M, Logsdon JM Jr (2009) Signs of sex: what we know and how we know it. Trends Ecol Evol 24: 208–217.AM SchurkoM. NeimanJM Logsdon Jr2009Signs of sex: what we know and how we know it.Trends Ecol Evol24208217

31. Hazard EI, Brookbank JW (1984) Karyogamy and meiosis in an Amblyospora Sp (Microspora) in the mosquito Culex salinarius. J Invertebr Pathol 44: 3–11.EI HazardJW Brookbank1984Karyogamy and meiosis in an Amblyospora Sp (Microspora) in the mosquito Culex salinarius.J Invertebr Pathol44311

32. Sweeney AW, Graham MF, Hazard EI (1988) Life cycle of Amblyospora dyxenoides sp. nov. in the mosquito Culex annulirostris and the copepod Mesocyclops albians. J Invertebr Pathol 51: 46–57.AW SweeneyMF GrahamEI Hazard1988Life cycle of Amblyospora dyxenoides sp. nov. in the mosquito Culex annulirostris and the copepod Mesocyclops albians.J Invertebr Pathol514657

33. Liu Y, Steenkamp E, Brinkmann H, Forget L, Philippe H, et al. (2009) Phylogenomic analyses predict sistergroup relationship of nucleariids and Fungi and paraphyly of zygomycetes with significant support. BMC Evol Biol 9: 272.Y. LiuE. SteenkampH. BrinkmannL. ForgetH. Philippe2009Phylogenomic analyses predict sistergroup relationship of nucleariids and Fungi and paraphyly of zygomycetes with significant support.BMC Evol Biol9272

34. Stajich JE, Berbee ML, Blackwell M, Hibbett DS, James TY, et al. (2009) The fungi. Curr Biol 19: R840–R845.JE StajichML BerbeeM. BlackwellDS HibbettTY James2009The fungi.Curr Biol19R840R845

35. Shalchian-Tabrizi K, Minge MA, Espelund M, Orr R, Ruden T, et al. (2008) Multigene phylogeny of Choanozoa and the origin of animals. PLoS ONE 3: e2098.K. Shalchian-TabriziMA MingeM. EspelundR. OrrT. Ruden2008Multigene phylogeny of Choanozoa and the origin of animals.PLoS ONE3e2098

36. Berthonneau E, Mirande M (2000) A gene fusion event in the evolution of aminoacyl-tRNA synthetases. FEBS Lett 470: 300–304.E. BerthonneauM. Mirande2000A gene fusion event in the evolution of aminoacyl-tRNA synthetases.FEBS Lett470300304

37. Mukhopadhyay R, Jia J, Arif A, Ray PS, Fox PL (2009) The GAIT system: a gatekeeper of inflammatory gene expression. Trends Biochem Sci 34: 324–331.R. MukhopadhyayJ. JiaA. ArifPS RayPL Fox2009The GAIT system: a gatekeeper of inflammatory gene expression.Trends Biochem Sci34324331

38. Jia J, Arif A, Ray PS, Fox PL (2008) WHEP domains direct noncanonical function of glutamyl-prolyl tRNA synthetase in translational control of gene expression. Mol Cell 29: 679–690.J. JiaA. ArifPS RayPL Fox2008WHEP domains direct noncanonical function of glutamyl-prolyl tRNA synthetase in translational control of gene expression.Mol Cell29679690

39. Katinka MD, Duprat S, Cornillot E, Metenier G, Thomarat F, et al. (2001) Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi. Nature 414: 450–453.MD KatinkaS. DupratE. CornillotG. MetenierF. Thomarat2001Genome sequence and gene compaction of the eukaryote parasite Encephalitozoon cuniculi.Nature414450453

40. Lee SC, Ni M, Li W, Shertz C, Heitman J (2010) The evolution of sex: a perspective from the fungal kingdom. Microbiol Mol Biol Rev: In press. SC LeeM. NiW. LiC. ShertzJ. Heitman2010The evolution of sex: a perspective from the fungal kingdom.Microbiol Mol Biol Rev: In press

41. Lengeler KB, Wang P, Cox GM, Perfect JR, Heitman J (2000) Identification of the MATa mating-type locus of Cryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct. Proc Natl Acad Sci U S A 97: 14455–14460.KB LengelerP. WangGM CoxJR PerfectJ. Heitman2000Identification of the MATa mating-type locus of Cryptococcus neoformans reveals a serotype A MATa strain thought to have been extinct.Proc Natl Acad Sci U S A971445514460

42. Lin X, Heitman J (2007) Mechanisms of homothallism in fungi and transitions between heterothalism and homothalism. In: Heitman J, Kronstad JW, Taylor JW, Casselton LA, editors. Sex in fungi. Washington, DC: ASM Press. X. LinJ. Heitman2007Mechanisms of homothallism in fungi and transitions between heterothalism and homothalism.J. HeitmanJW KronstadJW TaylorLA CasseltonSex in fungiWashington, DCASM Press

43. Lin X, Hull CM, Heitman J (2005) Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature 434: 1017–1021.X. LinCM HullJ. Heitman2005Sexual reproduction between partners of the same mating type in Cryptococcus neoformans.Nature43410171021

44. Lin X, Litvintseva AP, Nielsen K, Patel S, Floyd A, et al. (2007) αADα hybrids of Cryptococcus neoformans: evidence of same-sex mating in nature and hybrid fitness. PLoS Genet 3: e186.X. LinAP LitvintsevaK. NielsenS. PatelA. Floyd2007αADα hybrids of Cryptococcus neoformans: evidence of same-sex mating in nature and hybrid fitness.PLoS Genet3e186

45. Lin X, Patel S, Litvintseva AP, Floyd A, Mitchell TG, et al. (2009) Diploids in the Cryptococcus neoformans serotype A population homozygous for the α mating type originate via unisexual mating. PLoS Pathog 5: e1000283.X. LinS. PatelAP LitvintsevaA. FloydTG Mitchell2009Diploids in the Cryptococcus neoformans serotype A population homozygous for the α mating type originate via unisexual mating.PLoS Pathog5e1000283

46. Alby K, Schaefer D, Bennett RJ (2009) Homothallic and heterothallic mating in the opportunistic pathogen Candida albicans. Nature 460: 890–893.K. AlbyD. SchaeferRJ Bennett2009Homothallic and heterothallic mating in the opportunistic pathogen Candida albicans.Nature460890893

47. Heitman J (2009) Microbial genetics: love the one you're with. Nature 460: 807–808.J. Heitman2009Microbial genetics: love the one you're with.Nature460807808

48. Kahmann R, Schirawski J (2007) Mating in the smut fungi: from a to b to the downstream cascades. In: Heitman J, Kronstad JW, Taylor JW, Casselton LA, editors. Sex in fungi. Washington, DC: ASM Press. R. KahmannJ. Schirawski2007Mating in the smut fungi: from a to b to the downstream cascades.J. HeitmanJW KronstadJW TaylorLA CasseltonSex in fungiWashington, DCASM Press

49. Morrow CA, Fraser JA (2009) Sexual reproduction and dimorphism in the pathogenic basidiomycetes. FEMS Yeast Res 9: 161–177.CA MorrowJA Fraser2009Sexual reproduction and dimorphism in the pathogenic basidiomycetes.FEMS Yeast Res9161177

50. Hull CM, Boily MJ, Heitman J (2005) Sex-specific homeodomain proteins Sxi1α and Sxi2a coordinately regulate sexual development in Cryptococcus neoformans. Eukaryot Cell 4: 526–535.CM HullMJ BoilyJ. Heitman2005Sex-specific homeodomain proteins Sxi1α and Sxi2a coordinately regulate sexual development in Cryptococcus neoformans.Eukaryot Cell4526535

51. Ironside J (2007) Multiple losses of sex within a single genus of microsporidia. BMC Evol Biol 7: 48.J. Ironside2007Multiple losses of sex within a single genus of microsporidia.BMC Evol Biol748

52. Bürglin TR (2003) The homeobox genes of Encephalitozoon cuniculi (Microsporidia) reveal a putative mating-type locus. Dev Genes Evol 213: 50–52.TR Bürglin2003The homeobox genes of Encephalitozoon cuniculi (Microsporidia) reveal a putative mating-type locus.Dev Genes Evol2135052

53. Dietrich FS, Voegeli S, Brachat S, Lerch A, Gates K, et al. (2004) The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome. Science 304: 304–307.FS DietrichS. VoegeliS. BrachatA. LerchK. Gates2004The Ashbya gossypii genome as a tool for mapping the ancient Saccharomyces cerevisiae genome.Science304304307

54. Badrane H, May G (1999) The divergence-homogenization duality in the evolution of the b1 mating type gene of Coprinus cinereus. Mol Biol Evol 16: 975–986.H. BadraneG. May1999The divergence-homogenization duality in the evolution of the b1 mating type gene of Coprinus cinereus.Mol Biol Evol16975986

55. May G, Shaw F, Badrane H, Vekemans X (1999) The signature of balancing selection: Fungal mating compatibility gene evolution. Proc Natl Acad Sci U S A 96: 9172–9177.G. MayF. ShawH. BadraneX. Vekemans1999The signature of balancing selection: Fungal mating compatibility gene evolution.Proc Natl Acad Sci U S A9691729177

56. Swanson WJ, Vacquier VD (2002) The rapid evolution of reproductive proteins. Nat Rev Genet 3: 137–144.WJ SwansonVD Vacquier2002The rapid evolution of reproductive proteins.Nat Rev Genet3137144

57. Wu J, Saupe SJ, Glass NL (1998) Evidence for balancing selection operating at the het-c heterokaryon incompatibility locus in a group of filamentous fungi. Proc Natl Acad Sci U S A 95: 12398–12403.J. WuSJ SaupeNL Glass1998Evidence for balancing selection operating at the het-c heterokaryon incompatibility locus in a group of filamentous fungi.Proc Natl Acad Sci U S A951239812403

58. Polonais V, Prensier G, Metenier G, Vivares CP, Delbac F (2005) Microsporidian polar tube proteins: highly divergent but closely linked genes encode PTP1 and PTP2 in members of the evolutionarily distant Antonospora and Encephalitozoon groups. Fungal Genet Biol 42: 791–803.V. PolonaisG. PrensierG. MetenierCP VivaresF. Delbac2005Microsporidian polar tube proteins: highly divergent but closely linked genes encode PTP1 and PTP2 in members of the evolutionarily distant Antonospora and Encephalitozoon groups.Fungal Genet Biol42791803

59. MacKay VL, Welch SK, Insley MY, Manney TR, Holly J, et al. (1988) The Saccharomyces cerevisiae BAR1 gene encodes an exported protein with homology to pepsin. Proc Natl Acad Sci U S A 85: 55–59.VL MacKaySK WelchMY InsleyTR ManneyJ. Holly1988The Saccharomyces cerevisiae BAR1 gene encodes an exported protein with homology to pepsin.Proc Natl Acad Sci U S A855559

60. Schaefer D, Cote P, Whiteway M, Bennett RJ (2007) Barrier activity in Candida albicans mediates pheromone degradation and promotes mating. Eukaryot Cell 6: 907–918.D. SchaeferP. CoteM. WhitewayRJ Bennett2007Barrier activity in Candida albicans mediates pheromone degradation and promotes mating.Eukaryot Cell6907918

61. Fraser JA, Diezmann S, Subaran RL, Allen A, Lengeler KB, et al. (2004) Convergent evolution of chromosomal sex-determining regions in the animal and fungal kingdoms. PLoS Biol 2: e384.JA FraserS. DiezmannRL SubaranA. AllenKB Lengeler2004Convergent evolution of chromosomal sex-determining regions in the animal and fungal kingdoms.PLoS Biol2e384

62. Lengeler KB, Fox DS, Fraser JA, Allen A, Forrester K, et al. (2002) Mating-type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes. Eukaryot Cell 1: 704–718.KB LengelerDS FoxJA FraserA. AllenK. Forrester2002Mating-type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes.Eukaryot Cell1704718

63. Iwase M, Satta Y, Hirai Y, Hirai H, Imai H, et al. (2003) The amelogenin loci span an ancient pseudoautosomal boundary in diverse mammalian species. Proc Natl Acad Sci U S A 100: 5258–5263.M. IwaseY. SattaY. HiraiH. HiraiH. Imai2003The amelogenin loci span an ancient pseudoautosomal boundary in diverse mammalian species.Proc Natl Acad Sci U S A10052585263

64. Butler G, Kenny C, Fagan A, Kurischko C, Gaillardin C, et al. (2004) Evolution of the MAT locus and its Ho endonuclease in yeast species. Proc Natl Acad Sci U S A 101: 1632–1637.G. ButlerC. KennyA. FaganC. KurischkoC. Gaillardin2004Evolution of the MAT locus and its Ho endonuclease in yeast species.Proc Natl Acad Sci U S A10116321637

65. Fraser JA, Hsueh Y-P, Findley K, Heitman J (2007) Evolution of the mating-type locus: the basidiomycetes. In: Heitman J, Kronstad JW, Taylor JW, Casselton LA, editors. Sex in fungi. Washington, DC: ASM Press. JA FraserY-P HsuehK. FindleyJ. Heitman2007Evolution of the mating-type locus: the basidiomycetes.J. HeitmanJW KronstadJW TaylorLA CasseltonSex in fungiWashington, DCASM Press

66. Reedy JL, Floyd AM, Heitman J (2009) Mechanistic plasticity of sexual reproduction and meiosis in the Candida pathogenic species complex. Curr Biol 19: 891–899.JL ReedyAM FloydJ. Heitman2009Mechanistic plasticity of sexual reproduction and meiosis in the Candida pathogenic species complex.Curr Biol19891899

67. Butler G, Rasmussen MD, Lin MF, Santos MAS, Sakthikumar S, et al. (2009) Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657–662.G. ButlerMD RasmussenMF LinMAS SantosS. Sakthikumar2009Evolution of pathogenicity and sexual reproduction in eight Candida genomes.Nature459657662

68. Butler G (2010) Fungal sex and pathogenesis. Clin Microbiol Rev 23: 140–159.G. Butler2010Fungal sex and pathogenesis.Clin Microbiol Rev23140159

69. Fraser JA, Stajich JE, Tarcha EJ, Cole GT, Inglis DO, et al. (2007) Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens Histoplasma capsulatum, Coccidioides immitis, and Coccidioides posadasii. Eukaryot Cell 6: 622–629.JA FraserJE StajichEJ TarchaGT ColeDO Inglis2007Evolution of the mating type locus: insights gained from the dimorphic primary fungal pathogens Histoplasma capsulatum, Coccidioides immitis, and Coccidioides posadasii.Eukaryot Cell6622629

70. Akiyoshi DE, Morrison HG, Lei S, Feng X, Zhang Q, et al. (2009) Genomic survey of the non-cultivatable opportunistic human pathogen, Enterocytozoon bieneusi. PLoS Pathog 5: e1000261.DE AkiyoshiHG MorrisonS. LeiX. FengQ. Zhang2009Genomic survey of the non-cultivatable opportunistic human pathogen, Enterocytozoon bieneusi.PLoS Pathog5e1000261

71. Cornman RS, Chen YP, Schatz MC, Street C, Zhao Y, et al. (2009) Genomic analyses of the microsporidian Nosema ceranae, an emergent pathogen of honey bees. PLoS Pathog 5: e1000466.RS CornmanYP ChenMC SchatzC. StreetY. Zhao2009Genomic analyses of the microsporidian Nosema ceranae, an emergent pathogen of honey bees.PLoS Pathog5e1000466

72. Corradi N, Haag K, Pombert J-F, Ebert D, Keeling P (2009) Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions. Genome Biol 10: R106.N. CorradiK. HaagJ-F PombertD. EbertP. Keeling2009Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions.Genome Biol10R106

73. Xiao L, Li L, Visvesvara GS, Moura H, Didier ES, et al. (2001) Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive sequences. J Clin Microbiol 39: 2248–2253.L. XiaoL. LiGS VisvesvaraH. MouraES Didier2001Genotyping Encephalitozoon cuniculi by multilocus analyses of genes with repetitive sequences.J Clin Microbiol3922482253

74. Didier ES, Vossbrinck CR, Baker MD, Rogers LB, Bertucci DC, et al. (1995) Identification and characterization of three Encephalitozoon cuniculi strains. Parasitology 111: 411–421.ES DidierCR VossbrinckMD BakerLB RogersDC Bertucci1995Identification and characterization of three Encephalitozoon cuniculi strains.Parasitology111411421

75. Xu Y, Takvorian P, Cali A, Wang F, Zhang H, et al. (2006) Identification of a new spore wall protein from Encephalitozoon cuniculi. Infect Immun 74: 239–247.Y. XuP. TakvorianA. CaliF. WangH. Zhang2006Identification of a new spore wall protein from Encephalitozoon cuniculi.Infect Immun74239247

76. Didier ES, Roger LB, Orenstein JM, Baker MD, Vossbrinck CR, et al. (1996) Characterization of Encephalitozoon (Septata) intestinalis isolates cultured from nasal mucosa and bronchoalveolar lavage fluids of two AIDS patients. J Eukaryot Microbiol 43: 34–43.ES DidierLB RogerJM OrensteinMD BakerCR Vossbrinck1996Characterization of Encephalitozoon (Septata) intestinalis isolates cultured from nasal mucosa and bronchoalveolar lavage fluids of two AIDS patients.J Eukaryot Microbiol433443

77. Didier PJ, Didier ES, Orenstein JM, Shadduck JA (1991) Fine structure of a new human microsporidian, Encephalitozoon hellem, in culture. J Protozool 38: 502–507.PJ DidierES DidierJM OrensteinJA Shadduck1991Fine structure of a new human microsporidian, Encephalitozoon hellem, in culture.J Protozool38502507

78. Green LC, Didier PJ, Didier ES (1999) Fractionation of sporogonial stages of the microsporidian Encephalitozoon cuniculi by Percoll gradients. J Eukaryot Microbiol 46: 434–438.LC GreenPJ DidierES Didier1999Fractionation of sporogonial stages of the microsporidian Encephalitozoon cuniculi by Percoll gradients.J Eukaryot Microbiol46434438

79. Guindon S, OG (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704.S, OG Guindon2003A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.Syst Biol52696704