About the Authors:
Bettina Hansen
Affiliation: Department of Biomedicine, Aarhus University, Aarhus C, Denmark
Annette B. Oturai
Affiliation: Danish Multiple Sclerosis Center, Department of Neurology, Copenhagen University Hospital Rigshospitalet, Copenhagen, Denmark
Hanne F. Harbo
Affiliations Department of Neurology, Oslo University Hospital, Oslo, Norway, Institute of Clinical Medicine, University of Oslo, Oslo, Norway
Elisabeth G. Celius
Affiliation: Department of Neurology, Oslo University Hospital, Oslo, Norway
Kari K. Nissen
Affiliation: Department of Biomedicine, Aarhus University, Aarhus C, Denmark
Magdalena J. Laska
Affiliation: Department of Biomedicine, Aarhus University, Aarhus C, Denmark
Helle B. Søndergaard
Affiliation: Danish Multiple Sclerosis Center, Department of Neurology, Copenhagen University Hospital Rigshospitalet, Copenhagen, Denmark
Thor Petersen
Affiliation: Neurology, Aarhus University Hospital, Aarhus C, Denmark
Bjørn A. Nexø
* E-mail: [email protected]
Affiliation: Department of Biomedicine, Aarhus University, Aarhus C, Denmark
Introduction
Multiple sclerosis (MS) is a chronic inflammatory, demyelinating disease of the central nervous system probably caused by interaction of multiple genes and environmental factors [1]. HLA genes are the most strongly associated genes in MS [2], and low Vitamin D level in serum, Epstein Bar Virus infection and smoking are currently the best documented environmental risk factors [3], [4].
An involvement of retroviruses has also long been suspected [5]. Originally, this was based on animal models, where other demyelinating diseases could be induced by retroviruses [6], [7], [8]. However, these animal diseases are all contagious and horizontally transmitted, and MS does not seem to be transferred in this manner. Therefore, some scientists have focused their research on endogenous retroviruses that are vertically transmitted from parents to offspring as part of the chromosomes. Attempts at isolating such viruses from patients with MS have been partial successful [9], [10]. The main difficulty of the latter studies, apart from the technical challenges, is the inadequacy of Koch's postulates for dealing with ubiquitous agents. Koch's postulates are the criteria traditionally required to be fulfilled in order to establish a causal relationship between a microbe and a disease, and contain the implicit assumption that most people are free of the microbe. The postulates fail, when the microbe is universally present, which is the case with most endogenous viral loci.
Recently, we described the occurrence of MS to be associated with human endogenous retroviruses [11]. The interpretation of these findings did not involve Koch's postulates, but depended on the theories of genetics. We found association of MS with alleles of the host gene TRIM5 that restricts the replication of a broad variety of retroviruses. This suggested retroviral replication to be involved in this disease, but did not indicate which virus. Hence, we also looked for association of specific endogenous retroviruses with MS. We found an association of MS with markers in and near the endogenous retroviral locus HERV-Fc1, located on the X-chromosome [12]. The associations could be reproduced in several cohorts, encompassing a total of 1060 cases and 2080 controls [11]. The results suggested the involvement of HERV-Fc1 in MS. In addition, we have recently found that expression of HERV-Fc1 RNA is approximately 4-fold higher in plasma from MS patients with recent attacks, compared to plasma from patients in stable remission and from controls [13]. This provides a possible new biomarker and may give clues to further studies of the pathogenic process in MS.
The association of the HERV-Fc1 locus with the clinical course of MS has not been studied previously. MS patients are clinically subdivided into three categories: Remitting/Relapsing MS (RRMS), Secondary Progressive MS (SPMS), and Primary Progressive MS (PPMS). RRMS and SPMS are generally considered time-wise progressions of the same disease, altogether called Bout Onset MS (BOMS) representing the vast majority of the patients (85–90%), while PPMS is characterized by a separate disease entity with disease progression from onset (10–15%). In this paper, encompassing 1181 MS cases and 1886 controls from one new (Norwegian) and one previously examined cohort (Danish), we report that BOMS is associated with a marker near the HERV-Fc1 locus, while PPMS disease is not.
Materials and Methods
Ethical approval
Collection of blood samples from MS patients and blood donors for genetic investigations was approved by the Regional Ethics committee (Norway) and local Science Ethical Committees (Denmark). The patients gave written informed consent.
Clinical data
The sub-typing of the patients was based on clinical data using the criteria of Poser [14].
Analysis
DNAs were extracted from the blood by conventional means. The DNAs were genotyped for the rs391745 single nucleotide polymorphism (SNP) located near the X-linked viral locus HERV-Fc1 on a mass spectrometry Sequenom® facility using Gold plex reactions (Sequenom, San Diego, CA). The analysis was performed as previously described [11], using the following sequenom primers; rs391745_PCR1: ACGTTGGATGTAAAATATGTGCCCACCCTC; rs391745_PCR2: ACGTTGGATGGATTCTCAGCATGGACCATC and the rs391745 probe ggtgCAGCATGGACCATCTCTTCAG.
Statistics
The data were analyzed in IBM SPSS version 19 and Excel 2007 (Microsoft, Redmond, WA). For a minority of persons, no subtype or gender information was available, or the typing of rs391745 failed. The main statistic tests performed were χ2 tests. To combine p-values we used Fisher's method: χ2 (P, 2n) = −2Σ ln (pi), where P is the combined two-sided p-value and pi are the n one-sided p-values to be combined.
Results and Discussion
We analyzed two cohorts of MS patients: 544 cases and 1142 controls from Denmark, and 637 cases and 744 controls from Norway. The Danish cohort was also included in a previous study [11]. Information about individual subtypes of MS had been collected for most patients in both cohorts.
In the previous analysis, the best marker in or near the HERV-Fc1 locus for association with MS was rs391745. Table 1 shows the association of MS and subtypes of MS with rs391745 in the two cohorts. Both cohorts showed an association of the C-allele of the rs391745 SNP in the total MS group (p = 0.003). The overrepresentation of C-alleles among cases corresponds to what was observed previously and extends previous findings to a larger set of patients. BOMS also showed a significant association to the C-allele of this SNP (p = 0.003). In contrast, PPMS was not associated with any allele of rs391745. This lack of association was present in both cohorts and was emphasized when the cohorts were combined.
[Figure omitted. See PDF.]
Table 1. Association of rs391745 located near the HERV-FC1 locus and Multiple Sclerosis.
https://doi.org/10.1371/journal.pone.0026438.t001
To make sure gender issues did not perturb the results, we also performed a gender-stratified analysis of the combined cohorts. The conclusions were the same: BOMS was associated with HERV-Fc1, PPMS was not (Table S1). The p-values were higher, but this was to be expected as the stratified analysis does not contain any cross comparisons: male cases versus female controls and vice versa and thus has less strength.
Three arguments strengthen the tie between MS and HERV-Fc1. First, the association of MS with markers on the X-chromosomal region is limited to an approximately 20 kb region, which includes HERV-Fc1. There are no other known genes in this region [11]. Secondly, the restriction gene TRIM5, which is known to limit retroviral replication, influences the risk of getting MS [11]. Finally, we have found that expression of HERV-Fc1 RNA is four-fold increased in the plasma of MS patients with a recent history of an attack, relative to patients in stable remission and to controls [13]. We take all these data as indications that development of BOMS may be influenced by the endogenous retrovirus locus HERV-Fc1.
Another corroboration to this conclusion stems from the observation that PPMS has a gender-ratio close to one [15]. This is in contrast to the near 2∶1 ratio observed for BOMS. This difference in gender ratio was to be expected if HERV-Fc1, located on the X-chromosome, plays a role in BOMS but not in PPMS.
It seems reasonable to speculate on the importance of HERV-Fc1 for disease. If we take the epidemiological approach and assume that rs391745 is the causative variation, we arrive at an etiological fraction of 0.05 to 0.1, i.e. rs391745 is a minor risk determinant for BOMS. Alternatively, if we take the genetic view that rs391745 is a marker in linkage disequilibrium with the true causative variation, the etiological fraction of the latter variation should be higher and the virus could in principle be a primary cause of BOMS. With the latter optimistic view in mind, we are searching for markers with better association to BOMS in and around HERV-Fc1.
Recently, a large genome-wide association study (GWAS) of MS identified an excess of fifty different genes statistically associated to MS [16]. An overrepresentation was observed of genes related to the immune system. This GWAS did not identify association to the HERV-Fc1region, but this is not in conflict with the HERV-Fc1 data presented here.
In conclusion, this study suggests a molecular distinction of different disease courses in MS by involvement of HERV-Fc1. This warrants further investigations.
Supporting Information
[Figure omitted. See PDF.]
Table S1.
Gender-specific p-values and odds-ratios for rs391745 in relation to subtypes of MS.
https://doi.org/10.1371/journal.pone.0026438.s001
(DOC)
Author Contributions
Conceived and designed the experiments: BAN ABO HFH TP. Performed the experiments: BH KKN MJL. Analyzed the data: BAN. Contributed reagents/materials/analysis tools: ABO HBS HFH EGC. Wrote the paper: BAN BH ABO EGC HFH KKN.
Citation: Hansen B, Oturai AB, Harbo HF, Celius EG, Nissen KK, Laska MJ, et al. (2011) Genetic Association of Multiple Sclerosis with the Marker rs391745 near the Endogenous Retroviral Locus HERV-Fc1: Analysis of Disease Subtypes. PLoS ONE6(10): e26438. https://doi.org/10.1371/journal.pone.0026438
1. Compston A, Coles A (2002) Multiple sclerosis. Lancet 359: 1221–331.A. CompstonA. Coles2002Multiple sclerosis.Lancet3591221331
2. IMSGC (2007) Refining genetic associations in multiple sclerosis. Lancet Neurol 7: 567–9.IMSGC2007Refining genetic associations in multiple sclerosis.Lancet Neurol75679
3. Munger KL, Levin LI, Hollis BW, Howard NS, Ascherio A (2006) Serum 25-hydroxyvitamin D levels and risk of multiple sclerosis. JAMA 296: 2832–8.KL MungerLI LevinBW HollisNS HowardA. Ascherio2006Serum 25-hydroxyvitamin D levels and risk of multiple sclerosis.JAMA29628328
4. Ascherio A, Munger KL (2007) Environmental risk factors for multiple sclerosis. Part I: the role of infection. Ann Neurol 61: 288–99.A. AscherioKL Munger2007Environmental risk factors for multiple sclerosis. Part I: the role of infection.Ann Neurol6128899
5. Johnson RT (1975) The possible viral etiology of multiple sclerosis. Adv Neurol 13: 1–46.RT Johnson1975The possible viral etiology of multiple sclerosis.Adv Neurol13146
6. Gardner MB (1993) Genetic control of retroviral disease in aging wild mice. Genetica 91: 199.MB Gardner1993Genetic control of retroviral disease in aging wild mice.Genetica91199
7. Pepin M, Vitu C, Russo P, Mormes JF, Peterhans E (1998) Maedi-visna virus infection in sheep: a review. Vet Res 1998;29: 341.M. PepinC. VituP. RussoJF MormesE. Peterhans1998Maedi-visna virus infection in sheep: a review.Vet Res1998;29341
8. Zink MC, Clements JE (2002) A novel simian immunodeficiency virus model that provides insight into mechanisms of human immunodeficiency virus central nervous system disease. J Neurovirol 2002;8: Suppl 242.MC ZinkJE Clements2002A novel simian immunodeficiency virus model that provides insight into mechanisms of human immunodeficiency virus central nervous system disease.J Neurovirol2002;8Suppl 242
9. Perron H, Garson JA, Bedin F, Beseme F, Paranhos-Baccala G, et al. (1997) Molecular identification of a new retrovirus, repeatedly isolated from patients with multiple sclerosis. The collaborative research group on Multiple sclerosis. Proc Natl Acad Sci USA 94: 7583–8.H. PerronJA GarsonF. BedinF. BesemeG. Paranhos-Baccala1997Molecular identification of a new retrovirus, repeatedly isolated from patients with multiple sclerosis. The collaborative research group on Multiple sclerosis.Proc Natl Acad Sci USA9475838
10. Christensen T (2005) Association of human endogenous retroviruses with multiple sclerosis and possible interaction with herpes viruses. Rev Med Virol 2005;15: 179.T. Christensen2005Association of human endogenous retroviruses with multiple sclerosis and possible interaction with herpes viruses.Rev Med Virol2005;15179
11. Nexø BA, Christensen T, Frederiksen J, Møller-Larsen A, Oturai AB, et al. (2011) The etiology of multiple sclerosis: Genetic evidence for the involvement of the human endogenous retrovirus HERV-Fc1. PLoS ONE 6: e16652.BA NexøT. ChristensenJ. FrederiksenA. Møller-LarsenAB Oturai2011The etiology of multiple sclerosis: Genetic evidence for the involvement of the human endogenous retrovirus HERV-Fc1.PLoS ONE6e16652
12. Bénit L, Calteau A, Heidmann T (2003) Characterization of the low-copy HERV-Fc family: evidence for recent integrations in primates of elements with coding envelope genes. Virology 312: 159–168.L. BénitA. CalteauT. Heidmann2003Characterization of the low-copy HERV-Fc family: evidence for recent integrations in primates of elements with coding envelope genes.Virology312159168
13. Laska MJ, Brudek T, Nissen KK, Christensen T, Møller-Larsen A, et al. (2011) Pathogenesis of Multiple Sclerosis: Activation of HERV-Fc1; a human endogenous retrovirus. Submitted. MJ LaskaT. BrudekKK NissenT. ChristensenA. Møller-Larsen2011Pathogenesis of Multiple Sclerosis: Activation of HERV-Fc1; a human endogenous retrovirus.Submitted
14. Poser CM, Paty DW, Scheinberg L, McDonald WI, Davis FA, et al. (1983) New diagnostic criteria for multiple sclerosis: guidelines for research protocols. Ann Neurol 13: 227–31.CM PoserDW PatyL. ScheinbergWI McDonaldFA Davis1983New diagnostic criteria for multiple sclerosis: guidelines for research protocols.Ann Neurol1322731
15. Miller DH, Leary SM (2007) Primary-progressive multiple sclerosis. Lancet Neurol 6: 903–912.DH MillerSM Leary2007Primary-progressive multiple sclerosis.Lancet Neurol6903912
16. The International Multiple Sclerosis Genetics Consortium and The Wellcome Trust Case Control Consortium 2 (2011) Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis. Nature 476: 214–219.The International Multiple Sclerosis Genetics Consortium and The Wellcome Trust Case Control Consortium 22011Genetic risk and a primary role for cell-mediated immune mechanisms in multiple sclerosis.Nature476214219
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2011 Hansen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License: https://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
We have previously described the occurrence of multiple sclerosis (MS) to be associated with human endogenous retroviruses, specifically the X-linked viral locus HERV-Fc1. The aim of this study was to investigate a possible association of the HERV-Fc1 locus with subtypes of MS. MS patients are generally subdivided into three categories: Remitting/Relapsing and Secondary Progressive, which together constitute Bout Onset MS, and Primary Progressive. In this study of 1181 MS patients and 1886 controls we found that Bout Onset MS was associated with the C-allele of the marker rs391745 near the HERV-Fc1 locus (p = 0.003), while primary progressive disease was not. The ability to see genetic differences between subtypes of MS near this gene speaks for the involvement of the virus HERV-Fc1 locus in modifying the disease course of MS.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




