About the Authors:
Yukinori Tsukuda
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Norimasa Iwasaki
* E-mail: [email protected] (TY); [email protected] (NI)
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Naoki Seito
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Masashi Kanayama
Affiliation: Division of Molecular Immunology, Institute for Genetic Medicine, Hokkaido University, Sapporo, Japan
Naoki Fujitani
Affiliation: Laboratory of Medical and Functional Glycomics, Graduate School of Advanced Life Science, Hokkaido University, Sapporo, Japan
Yasuro Shinohara
Affiliation: Laboratory of Medical and Functional Glycomics, Graduate School of Advanced Life Science, Hokkaido University, Sapporo, Japan
Yasuhiko Kasahara
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Tomohiro Onodera
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Koji Suzuki
Affiliation: Hokkaido Orthopaedic Memorial Hospital, Sapporo, Japan
Tsuyoshi Asano
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Akio Minami
Affiliation: Department of Orthopaedic Surgery, Hokkaido University Graduate School of Medicine, Sapporo, Japan
Tadashi Yamashita
* E-mail: [email protected] (TY); [email protected] (NI)
Affiliations Faculty of Advanced Life Science, Frontier Research Center for Post-Genomic Science and Technology, Hokkaido University, Sapporo, Japan, World Class University Program, Kyungpook National University School of Medicine, Daegu, Korea
Introduction
Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic inflammation of the synovial tissues in multiple joints, leading to joint destruction [1]. The pathologic features of RA include hyperplasia of the synovial lining cell layer; infiltration of inflammatory cells in the subintima, comprising predominately lymphocytes, plasma cells, and macrophages; and deposition of fibrin on the synovial surfaces, especially in clinically active disease. The pathogenesis of RA, however, is not fully understood. CD4+ T cells, key molecules in primary inflammatory lesions, have an essential role in the initiation of subsequent inflammatory responses [2]. In particular, Th17 cells (a subset of CD4+ T cells that are distinct from Th1 and Th2) and regulatory T cells are suggested to mediate inflammation and thus have a key role in the pathogenesis of RA [3]. Furthermore, interleukin (IL)-17, secreted by Th17 cells, stimulates the production of IL-6, IL-1, tumor necrosis factor (TNF)α, IL-8, matrix metalloproteinases, and other proinflammatory factors [4]. The cytokine IL-17 enhances the inflammation associated with RA and contributes to the pathogenesis of RA by inducing monocyte migration into the inflamed synovial tissue [5], [6]. High-level production of proinflammatory cytokines, such as IL-1 and TNFα, in the synovium results from an interaction between monocytes or macrophage cells and synoviocytes [7]. The regulatory mechanism of Th17 cells in RA, however, remains unclear.
Ganglioside GM3 and its derivatives (Figure 1) are membrane-bound glycosphingolipids (GSLs) composed of an oligosaccharide head structure containing one or more sialic acid residue [8]. GSLs act to transduce signals involved in cell surface events, including the phosphorylation of transmembrane receptors [9]. GM3 is the most widely distributed ganglioside among tissues, and serves as a precursor for most of the more complex ganglioside species [10]. GM3 inhibits the function of fibroblast growth factor receptor [11], and cell growth is regulated by GM3-enriched microdomain [12]. GM3 is thought to inhibit immunologic functions, such as the proliferation and production of cytokines by T cells [13]. In contrast, higher levels of GM3 in lipid rafts promote an increase in the T cell responsiveness to stimulation in vitro [14]. Few studies, however, have assessed whether the immunoreaction related to gangliosides occurs as a positive or negative event in vivo. T cells are the predominant infiltrating lymphocytes in the synovium of RA patients [15]. Thus, we hypothesized that GM3 is involved in the T cell mechanism of RA, thereby contributing to the clinical features of RA. The aims of the present study were to determine the relation betweenGM3 and the pathogenesis or progression of RA, and to clarify the effect of GM3 on Th17 cell proliferation and IL-17 secretion from Th17 cells using a mouse collagen-induced arthritis (CIA) model.
[Figure omitted. See PDF.]
Figure 1. Lactosylceramide (LacCer) is the key branching point of sphingolipid biosynthesis.
In the synthetic pathway of sphingolipids, four alternate pathways (lacto-series, neolacto-series, globo-series, and isoglobo-series) branch-off from LacCer. GM3S−/− mice, in which the GM3 synthase gene is disrupted, produced only o-series gangliosides, including GA2 and GA1, and not a-series or b-series gangliosides.
https://doi.org/10.1371/journal.pone.0040136.g001
Results
GM3 is Increased in the Synovium of RA Patients
Infiltration of multi-stratified synoviocytes and inflammatory cells into synovial tissues is commonly observed in RA patients (Figure 2A). We used mass spectrometry to investigate the amount of GSL in the synovium. The total GSL amount was slightly decreased in RA patients (Figure 2B). The amount of GM3 in the ganglioside synthetic pathway was decreased in the synovium of RA patients compared to osteoarthritis (OA) patients (Figure 2C). The relative amount of GM3 among GSLs was also lower in RA patients than in OA patients (Figure 2C). In contrast to the amount of GM3 production in the synovium, GM3 synthase (GM3S) mRNA transcription was increased in the synovium and in the peripheral blood mononuclear cells (PBMCs) of RA patients (Figure 2D). These results suggest that GM3 may be involved in the pathogenesis of RA.
[Figure omitted. See PDF.]
Figure 2. Clinical features related to GM3 in patients with RA or OA. A.
Histology of RA and OA patients. Hematoxylin and eosin (HE) staining. Scale bars = 200 µm. B. Quantification of total GSL glycans in human synovium (n = 5 per group). C. Absolute and relative amounts of GM3 glycans in human synovium (n = 5 per group). D. Quantification of GM3S mRNA in synovium and PBMCs in RA and OA patients (n = 5 per group). Data shown are mean ± SEM. *P<0.05, compared to OA patients.
https://doi.org/10.1371/journal.pone.0040136.g002
Higher GM3 Synthase mRNA Gene Expression in CIA
To determine whether GM3 is involved in the pathogenesis of RA, we selected a CIA model. The CIA model is a well-established model suitable for extrapolation to human RA [16]. At 35 days after immunization with chick collagen type II (CII), GM3S mRNA transcription was increased in the synovial tissue and spleen of CIA wild-type (WT) mice compared with naïve WT mice (Figure 3). This finding suggests that inflammation derived from CIA leads to an increase in GM3 synthase gene expression.
[Figure omitted. See PDF.]
Figure 3. Quantification of GM3S mRNA in synovial tissues and spleens from C57BL/6 naïve and CIA mice.
Mice were anesthetized and killed on day 35 after CII-CFA stimulation and synovial tissues and spleens were removed to analyze GM3S mRNA (n = 5 per group). A. mRNA in synovial tissue. B. mRNA in spleen. Data shown are mean ± SEM. *P<0.05, compared with naïve WT mice.
https://doi.org/10.1371/journal.pone.0040136.g003
The Lack of GM3 Accelerates the Pathogenesis and Severity of CIA
To investigate the relationship between GM3 and the development of autoimmune arthritis, we used knockout mice with disruption of the GM3 synthase gene (EC 2.4.99.9; GM3S−/− mice) [8]. The incidence of arthritis and arthritis scores of the GM3S−/− mice were significantly greater than those of WT mice (Figure 4A and B). Although the genetic background of the mice influences the arthritis score (i.e., C57BL/6 is a low responder strain for the CIA model [17]), GM3S−/− mice with a C57BL/6 genetic background had a greater response. Two weeks after secondary immunization, morphologically progressive destruction, synovial invasion, and a large number of inflammatory cells were observed in the joint region in GM3S−/− mice. Based on the histological scoring, GM3S−/− mice exhibited significantly worse inflammation, synovial hypertrophy, and bone destruction compared with WT mice (Figure 4C and D). At 25 days after immunization, serum levels of IL-6 as an exacerbation factor of RA, were significantly higher in GM3S−/− mice than in WT mice (Figure 4E). CII-specific serum IgG2a levels at 35 days after immunization were significantly higher in GM3S−/− mice than in WT mice (Figure 4F). The onset was earlier in GM3S−/− mice than in WT mice (Table 1). These results confirm that GM3 deficiency leads to the development of CIA, and accelerates the pathogenesis of CIA.
[Figure omitted. See PDF.]
Figure 4. Phenotype of WT and GM3S−/− CIA mice.
CIA was induced in C57BL/6 WT and GM3S−/− mice (10–15 weeks old). Mice were immunized with chicken CII emulsified with CFA on days 0 and 21(n = 17 WT and n = 12 GM3S−/− mice). A. Cumulative incidence of arthritis. B. Arthritis score with CII-CFA. C. Photomicrographs show HE-stained paraffin sections of the right hind limbs of naïve, CIA WT, and CIA GM3S−/− mice at day 35 of the study. Scale bars = 200 µm D. Histological scores on day 35 after primary immunization with CII-CFA (n = 5 per group). E. Serum IL-6 levels in mice on day 25 after primary immunization with CII-CFA (n = 5 per group). F. Serum levels of total IgG, IgG1, IgG2a, IgG2b, and IgG3 anti-chicken CII antibodies with CII-CFA on day 35 after primary immunization (n = 5 per group). Data shown are mean ± SEM. *P<0.05, **P<0.01 compared to WT mice.
https://doi.org/10.1371/journal.pone.0040136.g004
[Figure omitted. See PDF.]
Table 1. Onset of CIA from primary immunization.
https://doi.org/10.1371/journal.pone.0040136.t001
GM3 Deficiency Promotes the Proliferation of Th17 Cells in CIA Models
These suppressive roles of GM3 in the development of CIA suggest that GM3 may be involved in CD4+ T cell behaviors because CD4+ T cells are the predominant infiltrating lymphocytes in RA synovium [15]. Therefore, we investigated the T cell proliferation in GM3S−/− CIA mice. Based on flow cytometry analysis, the numbers of CD4+/CD8+ T, B220+, and CD11b+ cells in the inguinal lymph nodes (iLNs) 1 week after CII stimulation were not significantly different (Figure 5A). The ratio of Th17 cells in CD4+ T cells, on the other hand, was significantly increased in GM3S−/− mice (Figure 5B). These findings suggest that the loss of GM3 induces the proliferation of Th17 cells as a CD4+ T cell subset under CII stimulation.
[Figure omitted. See PDF.]
Figure 5. Immune response of T cells in WT and GM3S−/− mouse CIA models. A.
CD4+, CD8+, B220+, and CD11b+ T cell contents of iLNs in WT and GM3S−/− mice on day 7 after immunization with CII-CFA (n = 3 per group). B. The Th17 cell content in CD4+ T cells in mouse iLNs (n = 3 per group). Data shown are mean ± SEM. *P<0.05, compared to WT mice.
https://doi.org/10.1371/journal.pone.0040136.g005
Deletion of GM3 Promotes High Immunologic Response of T Cells
To investigate the immunologic response of T cells by the deletion of GM3 in vivo, anti-CD3 antibody was intraperitoneally administered to mice and IL-17, IL-4, interferon (IFN) γ, IL-6, and TNFα levels in serum were measured. These cytokine levels were higher in GM3S−/− mice than in WT mice (Figure 6). These findings indicate that GM3 may act as a regulatory molecule to suppress the immunologic response in CD4+ T cells to stimulus of T cell receptor antigen, thereby the lack of GM3 may lead to high levels of cytokines, especially IL-17 secretion from Th17 cells.
[Figure omitted. See PDF.]
Figure 6. T-cell immune response following anti-CD3 antibody stimulation.
Serum levels of IL-17, IL-4, IFNγ, IL-6, and TNFα at 1.5 h after intraperitoneal administration of 20 µg anti-CD3 antibody (n = 5 per group). Data shown are mean ± SEM. *P<0.05, compared to WT mice.
https://doi.org/10.1371/journal.pone.0040136.g006
Discussion
Gangliosides containing one or more sialic acid residues are present in all mammalian cell plasma membranes and intracellular membrane structures [18]. Gangliosides have essential roles in the early development, cell differentiation, proliferation, and the immune response [19]. GM3 is the most widely distributed ganglioside among tissues, and serves as a precursor for most of the more complex ganglioside species [10]. The role of GM3 in RA, however, is not almost clear. In the present study, the total GSL amount was slightly decreased in RA patients. The amount of GM3, on the other hand, was significantly decreased in the synovium of RA patients compared to OA patients. GSLs comprise many derivatives starting from ceramide, and five distinguishable synthetic pathways from lactosylceramide have been confirmed (Figure 1). Therefore, it is reasonable that the total GSL amount was not remarkably different, despite the fact that GM3 alone was decreased in the synthetic pathways. In contrast, GM3S mRNA transcription was increased in the synovium and in the PBMCs of RA patients. Therefore, the amount of GM3 detected by mass spectrometry revealed a gap between GM3S mRNA transcription and GM3 production. RA patients likely have a mechanism to compensate for the lack of GM3.
We investigated whether GM3 has a suppressive role in the development of autoimmune arthritis in a CIA model using GM3S−/− mice. The development of CIA was significantly higher in GM3S−/− mice. Th17 cells produce various cytokines including IL-17. IL-17 has profound pro-inflammatory effects and induces tissue damage during the course of various autoimmune diseases, such as the CIA animal model [20], [21]. Th17 cells are distinct from Th1, Th2, and regulatory T cells. IL-17 causes cartilage and bone destruction in mice [22]. Mice deficient in IL-17 are resistant to the pathogenesis and progression of CIA [1]. In humans, IL-17 directly causes cartilage and bone destruction in RA patients [23]. IL-17 stimulates the production of IL-6, TNFα, and other proinflammatory factors [4]. The differentiation of Th17 cells is dependent on IL-6 [24]. IL-17 activates synovial fibroblasts and macrophages to stimulate the production of IL-6 and TNFα, which lead to joint inflammation [25], [26]. In the present study, the ratio of Th17 cells in CIA was significantly higher in the iLN of GM3S−/− mice. Furthermore, serum IL-6 levels were significantly higher in GM3S−/− mice. Our results are consistent with these previous reports and suggest that the augmentation of Th17 cells in GM3S−/− mice induces a greater increase in the serum IL-6 levels than in WT mice. Our findings that GM3S−/− mice secrete more IL-17 under CIA stimulation are also consistent with the fact that IL-17 is involved in the initiation and progression of CIA, and that inhibition of IL-17 in a mouse CIA model reduces inflammation and bone erosion [27], [28]. Based on these findings, GM3 suppresses the Th17 cell proliferation in autoimmune arthritis. These findings confirm some previous reports [13], [29]. In contrast, however, higher levels of GM3 in lipid rafts are reported to promote an increase in naïve T cell responsiveness to stimulation in in vitro culture [14]. In the in vivo Th-17 disease model, GM3S−/− mice had more severe arthritis and expressed larger quantities of cytokines. Thus, it remains unclear whether GM3 affects the disease pathogenesis. We could not find previous studies according to the relation between GM3 and RA, and diseases which GM3 decreases. At the present time, the mechanism accelerating the development of CIA by the deletion of GM3 is unknown. However, based on our results, two factors are the suspected causes. First factor is the high Th17 cell augmentation. Second factor is higher susceptibility to stimulation of T cells, especially Th17 cells, due to GM3 deficiency in a CIA model. To confirm this susceptibility, we investigated whether GM3 is involved in the reaction to the T cell receptor antigen, anti-CD3 antibody. The levels of IL-17, IL-4, IFNγ, IL-6, and TNFα in the serum were higher in GM3S−/− mice than in WT mice. These findings suggest that GM3 is involved in the T cell susceptibility to stimulation. By these reasons, it is possible that IL-17 production and secretion are increase in a GM3 deficiency CIA model.
To our knowledge, this is the first study to show a relation between GM3 and the pathogenesis and progression of RA and CIA in vivo. The present findings indicate that GM3 may become a regulatory molecule against the production and secretion of cytokines, especially IL-17 derived from Th17 cells, which contributes to the pathogenesis and progression of RA. RA synovial fibroblasts are targeted by IL-17 in the joint synovium [30]. IL-17 enhances the release of IL-6, which is a key inflammatory cytokine in the joints [31], [32]. We produced T cell-specific knockout mice with a null mutation of the glucosylceramide synthase (Ugcg). The T cells in these mice do not contain any GSL. We assessed serum IL-17 levels after administrating anti-CD3 antibody and CIA severity. Serum IL-17 levels in T cell-specific mice after administrating anti-CD3 antibody were almost the same as those in GM3S−/− mice. Interestingly, the CIA incidence and arthritis scores in GM3S−/− mice were very severe, but the severity in T cell-specific mice was milder than that in GM3S−/− mice (data not shown). Consequently, our results suggest that GM3 may be involved not only in cytokine production but also in the sensitivity of joint synovium.
In this study, there are some limitations. First, the mechanism of developing CIA in GM3 deficiency is unknown. GSLs have been implicated as inhibiting various signal transductions on cell membranes [33]. As one of the possibility, GM3 may be involved in inhibiting the signal transduction on Th17 cells in CIA. Second, The relation between GM3 and cells except T cells (macrophage, osteoclast, fibroblast, or synoviocyte and so on) in CIA is not clear. To our knowledge, there are no reports of this relation. Third, GM3S−/− mice have O-series gangliosides different from a- or b-series gangliosides, and O-series gangliosides may compensate for the complete absence of the products of GM3S in GM3S−/− mice [34]. In the results from our MS analysis, O-series gangliosides did not show the significant increase of their amounts in synovium. It is a strong possibility that another pathways (Lacto, Neolacto, Globo, and Neoglobo) through the lactosylceramides may increase their products. Due to the samples of gangliosides derived from fibroblast and synovium, any products with abnormal structures which are not normally expressed in wild type were not detected in synovium. However, to do the complete detection of their products, we should examine MS/MS analysis and more. We will investigate the relation between o-series gangliosides and CIA, because O-series gangliosides have the potential to make an effect on the pathogenesis or progression of CIA in GM3S−/− mice. Finally, we speculate that GM3 strongly participate in the pathogenesis and progression of human RA. Further studies are required to confirm our speculation.
In conclusion, our findings indicate that GM3 deletion accelerates the pathogenesis and progression of RA and mouse CIA by increasing IL-17 proliferation and secretion from Th17 cells. Based on these findings, we reasonably conclude that GM3 may act as a regulatory molecule to suppress the proliferation and secretion of IL-17 from Th17 cells, thereby preventing the pathogenesis and progression of RA and CIA. GM3 might therefore be a factor for novel and effective strategies for the treatment of RA.
Materials and Methods
Ethics Statement
Written informed consent was obtained from all the participants after being approved by the Ethics Committee of the School of Medicine, Hokkaido University (permit number: 008–0076). All experimental protocols of mice were in compliance with the rules and regulations of the Animal Care and Use Committee of Hokkaido University (permit number: 23 (26) ). All experiments were performed in Hokkaido University.
Patients
Synovium was obtained from five patients with RA and five patients with OA undergoing total knee arthroplasty, and blood was obtained from all patients during the postoperative period. The RA patients fulfilled the criteria of the American College of Rheumatology.
Mice
GM3 synthase knockout (GM3S−/−) mice were generated as described previously [8]. Male GM3S−/− mice (10–15 weeks old) were backcrossed over 15 generations to C57BL/6 mice, and age-matched male C57BL/6 wild-type (WT) mice were used as a control.
Cell Preparation
PBMCs were isolated from the heparinized blood of patients with RA or OA. The cells were collected using Ficoll-Paque (GE Healthcare) density-gradient centrifugation. Spleens and iLNs in mice were isolated and passed through cell strainers (BD Falcon) to obtain single-cell suspensions. Red blood cells isolated from the spleen were lysed by two consecutive incubations (5 and 3 minutes at 37°C) in an NH4Cl suspension (0.83% in 0.01 M Tris-HCl, pH 7.2). The remaining cells were washed. These cells were used for real-time reverse transcription-polymerase chain reaction (PCR) and flow cytometry.
RNA Isolation and Real-time Reverse Transcription-PCR
We isolated total RNA in the synovium and PBMCs from humans, and synovial tissues and splenocytes in mice using Trizol reagent and analyzed the RNA for GM3 synthase gene expression. RNA expression was determined by absorbance at wavelengths of 260 nm and 280 nm. Total RNA (1 µg) was converted to cDNA using ImPromIITM Reverse Transcriptase (Promega) according to the manufacturer’s instructions. We performed quantitative analysis of the mRNA levels using Opticon Real-time PCR (Bio-Rad Laboratories) with sequence-specific primer pairs: human GM3S; (5′-3′) GAACTCTTGCCAGAGCACGA (3′-5′) GACGTGCCTAATCTTGACCC, mouse GM3S; (5′-3′) ATGCCAAGTGAGTTCACCTCT (3′-5′) GTGCAACCAACGTAAACCTCA, human GAPDH; (5′-3′) TTCCATGGCACCGTCAA (3′-5′) ACTCATGCAGCACCTCAGGT, mouse GAPDH; (5′-3′) ACTTTGTCAAGCTCATTTCC (3′-5′) GTAGTTATTTCAAGCGACGT. The PCR was performed in triplicate on cDNA samples using SYBR Green Master Mix (Finzymes) according to the manufacturer's protocol. GM3 synthase gene expression levels were normalized to those of glyceraldehyde 3-phosphate dehydrogenase in each sample.
Mass Spectrometry
GSLs were extracted from human synovium. GSL glycans were digested by enzymatic reaction employing GSL-specific endoglycoceramidases II (EGCase II) derived from mutant strain M-750 of Rhodococcus sp. (TAKARA Bio). The solutions treated with EGCase II were subjected to glycoblotting using a protocol similar to that used for N-glycome analyses reported previously [35]. The samples were analyzed by Matrix Assisted Laser Desorption Ionization - Time of Flight (TOF) MS on an Ultraflex II TOF/TOF mass spectrometer (Bruker Daltonics) equipped with a reflector, and controlled by the FlexControl 3.0 software package (Bruker Daltonics). Peaks were detected as proton-adducted ions. Masses were annotated using the FlexAnalysis 3.0 software package (Bruker Daltonics). In addition to the TOF/TOF analyses, we used the GlycoSuiteDB (http://glycosuitedb.expasy.org/glycosuite/glycodb) and SphinGOMAP© (http://www.sphingomap.org/) databases to identify the glycan structures.
Collagen-induced Arthritis
CIA was induced in C57BL/6-background WT or GM3S−/− mice as described previously [36]. Briefly, CIA was induced using an emulsion comprising equal amounts of Complete Freund’s Adjuvant (CFA) containing 5 mg/ml heat-killed Mycobacterium tuberculosis (Chondrex) and chick type II collagen (CII) solubilized at 2 mg/ml in 0.05 M acetic acid (Chondrex). The mice were immunized with 100 µl of emulsion (100 µg chick CII) intradermally at several sites at the base of the tail. After 21 days of primary immunization, the mice received intradermal boosters with a volume of emulsion equal to that of the primary immunization near the primary injection sites.
Clinical Assessment of Arthritis
The mice were examined daily for clinical symptoms of arthritis, and a mean arthritis score was calculated as described previously [37]: score 0, normal; score 1, redness and/or swelling in one joint; score 2, redness and/or swelling in more than one joint; score 3, redness and/or swelling of the entire paw; score 4, deformity and/or ankylosis.
Histological Assessment of Arthritis
For histological examination of joints, mice were anesthetized and killed at day 35 after primary immunization. The right hind paw was dissected and placed in 10% buffered formalin and decalcified in 10% EDTA, pH 7.5, for 1 week. These tissues were then dehydrated in an ascending series of ethanol, the tissues were embedded in paraffin, sectioned, and stained with hematoxylin and eosin (HE). Sections were assessed using a separate histological score of 0 (normal), 1 (mild), 2 (moderate), or 3 (severe) for inflammation, synovial hypertrophy, cartilage damage, and bone destruction [38]. Human synovial tissues were obtained from patients with total knee arthroplasty and immediately embedded in Optimal Cutting Temperature (OCT) compound for frozen sections. Sections (5 µm thick) were cut from frozen tissue samples, fixed in acetone, air-dried and used for HE staining.
Measurement of Total and Anti-CII IgG Antibodies
Blood samples were obtained from the orbital sinus and allowed to clot at room temperature for 1 h. Individual sera were measured for total and anti-CII antibodies (IgG1, IgG2a, IgG2b, and IgG3) on day 35 after primary immunization using an enzyme-linked immunosorbent assay (ELISA) kit (Chondrex) according to the manufacturer’s instructions.
Flow Cytometric Analysis
We collected iLN from C57BL/6 mice on day 7 after immunization with CII-CFA. Cells were washed and blocked with 1 µg/ml of Fcγ blocker (BD Pharmingen). After washing, to analyze the iLN population of immune cells, the cells were incubated with the indicated fluorescein isothiocyanate (FITC)-, phycoerythrin (PE)-, and allophycocyanin-conjugated antibodies (0.5 µg for 30 min) to stain for CD3, CD4, CD8, CD11b, and B220.
For investigating the ratio of Th17 cells in CD4+ T cells, iLN cells were incubated for 5.5 h with phorbol myristate acetate (20 ng/ml), ionomycin (250 ng/ml), and brefeldin A (1 µl/ml; GolgiPlug; BD Biosciences). Cells were washed and blocked with 1 µg/ml Fcγ blocker (BD Pharmingen) before extracellular staining for CD3 and CD4. Cells were then fixed and permeabilized with BD Cytofix/Cytoperm (BD Bioscience) and stained intracellularly for IL-17 or IFNγ. Flow cytometric analysis was performed with FACS Caliber (BD, Mountain View) and Flowjo software (TREESTER). We used the following antibodies: FITC-conjugated anti-CD3 antibody (BioLegend), PE-conjugated anti-CD4 antibody (BioLegend), APC-conjugated anti-CD8a antibody (Pharmingen) PE-conjugated anti-B220 antibody (BioLegend), FITC-conjugated anti-CD11b antibody (BD Pharmingen), PE-conjugated anti-IFNγ antibody (BD Pharmingen), and allophycocyanin-conjugated anti-IL-17 antibody (BioLegend).
Response of T Cells with Anti-CD3 Antibody in vivo
Individual mice were intraperitoneally administered 20 µg anti-CD3 antibody. Serum was collected 1.5 h later and IL-17, IL-4, IFNγ, TNFα, IL-6 levels were measured using ELISA kits (R&D Systems) according to the manufacturer’s instructions.
Statistical Analysis
Data are expressed as mean ± SEM. Differences between groups were analyzed by Mann-Whitney U test, except cumulative incidence was evaluated with a χ2 test. A P value of less than 0.05 was considered statistically significant.
Acknowledgments
We thank M. Ueguchi for preparing the manuscript.
Author Contributions
Conceived and designed the experiments: YT NI TY. Performed the experiments: YT NS MK NF YS YK TO KS TA TY. Analyzed the data: YT NI AM TY. Contributed reagents/materials/analysis tools: YT NI AM TY. Wrote the paper: YT NI TY.
Citation: Tsukuda Y, Iwasaki N, Seito N, Kanayama M, Fujitani N, Shinohara Y, et al. (2012) Ganglioside GM3 Has an Essential Role in the Pathogenesis and Progression of Rheumatoid Arthritis. PLoS ONE7(6): e40136. https://doi.org/10.1371/journal.pone.0040136
1. Nakae S, Nambu A, Sudo K, Iwakura Y (2003) Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice. J Immunol 171: 6173–6177.S. NakaeA. NambuK. SudoY. Iwakura2003Suppression of immune induction of collagen-induced arthritis in IL-17-deficient mice.J Immunol17161736177
2. Okuzawa C, Kaneko Y, Murata Y, Miyake A, Saito Y, et al. (2008) Resistance to collagen-induced arthritis in SHPS-1 mutant mice. Biochem Biophys Res Commun 371: 561–566.C. OkuzawaY. KanekoY. MurataA. MiyakeY. Saito2008Resistance to collagen-induced arthritis in SHPS-1 mutant mice.Biochem Biophys Res Commun371561566
3. Rampersad RR, Tarrant TK, Vallanat CT, Quintero-Matthews T, Weeks MF, et al. (2011) Enhanced Th17-Cell Responses Render CCR2-Deficient Mice More Susceptible for Autoimmune Arthritis. PLoS One 6: e25833.RR RampersadTK TarrantCT VallanatT. Quintero-MatthewsMF Weeks2011Enhanced Th17-Cell Responses Render CCR2-Deficient Mice More Susceptible for Autoimmune Arthritis.PLoS One6e25833
4. Awasthi A, Kuchroo VK (2009) IL-17A directly inhibits TH1 cells and thereby suppresses development of intestinal inflammation. Nat Immunol 10: 568–570.A. AwasthiVK Kuchroo2009IL-17A directly inhibits TH1 cells and thereby suppresses development of intestinal inflammation.Nat Immunol10568570
5. Shahrara S, Pickens SR, Dorfleutner A, Pope RM (2009) IL-17 induces monocyte migration in rheumatoid arthritis. J Immunol 182: 3884–3891.S. ShahraraSR PickensA. DorfleutnerRM Pope2009IL-17 induces monocyte migration in rheumatoid arthritis.J Immunol18238843891
6. Shahrara S, Pickens SR, Mandelin AM, 2nd, Karpus WJ, Huang Q, et al (2010) IL-17-mediated monocyte migration occurs partially through CC chemokine ligand 2/monocyte chemoattractant protein-1 induction. J Immunol 184: 4479–4487.Shahrara S, Pickens SR, Mandelin AM, 2nd, Karpus WJ, Huang Q, et al2010IL-17-mediated monocyte migration occurs partially through CC chemokine ligand 2/monocyte chemoattractant protein-1 induction.J Immunol18444794487
7. Arend WP, Dayer JM (1990) Cytokines and cytokine inhibitors or antagonists in rheumatoid arthritis. Arthritis Rheum 33: 305–315.WP ArendJM Dayer1990Cytokines and cytokine inhibitors or antagonists in rheumatoid arthritis.Arthritis Rheum33305315
8. Yamashita T, Wu YP, Sandhoff R, Werth N, Mizukami H, et al. (2005) Interruption of ganglioside synthesis produces central nervous system degeneration and altered axon-glial interactions. Proc Natl Acad Sci U S A 102: 2725–2730.T. YamashitaYP WuR. SandhoffN. WerthH. Mizukami2005Interruption of ganglioside synthesis produces central nervous system degeneration and altered axon-glial interactions.Proc Natl Acad Sci U S A10227252730
9. Hashiramoto A, Mizukami H, Yamashita T (2006) Ganglioside GM3 promotes cell migration by regulating MAPK and c-Fos/AP-1. Oncogene 25: 3948–3955.A. HashiramotoH. MizukamiT. Yamashita2006Ganglioside GM3 promotes cell migration by regulating MAPK and c-Fos/AP-1.Oncogene2539483955
10. Kolter T, Proia RL, Sandhoff K (2002) Combinatorial ganglioside biosynthesis. J Biol Chem 277: 25859–25862.T. KolterRL ProiaK. Sandhoff2002Combinatorial ganglioside biosynthesis.J Biol Chem2772585925862
11. Toledo MS, Suzuki E, Handa K, Hakomori S (2005) Effect of ganglioside and tetraspanins in microdomains on interaction of integrins with fibroblast growth factor receptor. J Biol Chem 280: 16227–16234.MS ToledoE. SuzukiK. HandaS. Hakomori2005Effect of ganglioside and tetraspanins in microdomains on interaction of integrins with fibroblast growth factor receptor.J Biol Chem2801622716234
12. Toledo MS, Suzuki E, Handa K, Hakomori S (2004) Cell growth regulation through GM3-enriched microdomain (glycosynapse) in human lung embryonal fibroblast WI38 and its oncogenic transformant VA13. J Biol Chem 279: 34655–34664. Biol Chem 277: 25859–25862.MS ToledoE. SuzukiK. HandaS. Hakomori2004Cell growth regulation through GM3-enriched microdomain (glycosynapse) in human lung embryonal fibroblast WI38 and its oncogenic transformant VA13. J Biol Chem 279: 34655–34664.Biol Chem2772585925862
13. Ladisch S, Becker H, Ulsh L (1992) Immunosuppression by human gangliosides: I. Relationship of carbohydrate structure to the inhibition of T cell responses. Biochim Biophys Acta 1125: 180–188.S. LadischH. BeckerL. Ulsh1992Immunosuppression by human gangliosides: I. Relationship of carbohydrate structure to the inhibition of T cell responses.Biochim Biophys Acta1125180188
14. Zhu Y, Gumlaw N, Karman J, Zhao H, Zhang J, et al. (2011) Lowering glycosphingolipid levels in CD4+ T cells attenuates T cell receptor signaling, cytokine production, and differentiation to the Th17 lineage. J Biol Chem 286: 14787–14794.Y. ZhuN. GumlawJ. KarmanH. ZhaoJ. Zhang2011Lowering glycosphingolipid levels in CD4+ T cells attenuates T cell receptor signaling, cytokine production, and differentiation to the Th17 lineage.J Biol Chem2861478714794
15. Bankhurst AD, Husby G, Williams RC Jr (2008) Predominance of T cells in the lymphocytic infiltrates of synovial tissues in rheumatoid arthritis. Arthritis Rheum 58: S58–65.AD BankhurstG. HusbyRC Williams Jr2008Predominance of T cells in the lymphocytic infiltrates of synovial tissues in rheumatoid arthritis.Arthritis Rheum58S5865
16. Trentham DE, Townes AS, Kang AH (1977) Autoimmunity to type II collagen an experimental model of arthritis. J Exp Med 146: 857–868.DE TrenthamAS TownesAH Kang1977Autoimmunity to type II collagen an experimental model of arthritis.J Exp Med146857868
17. Pan M, Kang I, Craft J, Yin Z (2004) Resistance to development of collagen-induced arthritis in C57BL/6 mice is due to a defect in secondary, but not in primary, immune response. J Clin Immunol 24: 481–491.M. PanI. KangJ. CraftZ. Yin2004Resistance to development of collagen-induced arthritis in C57BL/6 mice is due to a defect in secondary, but not in primary, immune response.J Clin Immunol24481491
18. Niimi K, Nishioka C, Miyamoto T, Takahashi E, Miyoshi I, et al. (2011) Impairment of neuropsychological behaviors in ganglioside GM3-knockout mice. Biochem Biophys Res Commun 406: 524–528.K. NiimiC. NishiokaT. MiyamotoE. TakahashiI. Miyoshi2011Impairment of neuropsychological behaviors in ganglioside GM3-knockout mice.Biochem Biophys Res Commun406524528
19. Hakomori S (1981) Glycosphingolipids in cellular interaction, differentiation, and oncogenesis. Annu Rev Biochem 50: 733–764.S. Hakomori1981Glycosphingolipids in cellular interaction, differentiation, and oncogenesis.Annu Rev Biochem50733764
20. Bettelli E, Korn T, Oukka M, Kuchroo VK (2008) Induction and effector functions of T(H)17 cells. Nature 453: 1051–1057.E. BettelliT. KornM. OukkaVK Kuchroo2008Induction and effector functions of T(H)17 cells.Nature45310511057
21. Kelchtermans H, Schurgers E, Geboes L, Mitera T, Van Damme J, et al. (2009) Effector mechanisms of interleukin-17 in collagen-induced arthritis in the absence of interferon-gamma and counteraction by interferon-gamma. Arthritis Res Ther 11: R122.H. KelchtermansE. SchurgersL. GeboesT. MiteraJ. Van Damme2009Effector mechanisms of interleukin-17 in collagen-induced arthritis in the absence of interferon-gamma and counteraction by interferon-gamma.Arthritis Res Ther11R122
22. Sato K, Suematsu A, Okamoto K, Yamaguchi A, Morishita Y, et al. (2006) Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction. J Exp Med 203: 2673–2682.K. SatoA. SuematsuK. OkamotoA. YamaguchiY. Morishita2006Th17 functions as an osteoclastogenic helper T cell subset that links T cell activation and bone destruction.J Exp Med20326732682
23. Moseley TA, Haudenschild DR, Rose L, Reddi AH (2003) Interleukin-17 family and IL-17 receptors. Cytokine Growth Factor Rev 14: 155–174.TA MoseleyDR HaudenschildL. RoseAH Reddi2003Interleukin-17 family and IL-17 receptors.Cytokine Growth Factor Rev14155174
24. Drolet AM, Thivierge M, Turcotte S, Hanna D, Maynard B, et al. (2011) Platelet-activating factor induces th17 cell differentiation. Mediators Inflamm 2011: 913802.AM DroletM. ThiviergeS. TurcotteD. HannaB. Maynard2011Platelet-activating factor induces th17 cell differentiation.Mediators Inflamm2011913802
25. Katz Y, Nadiv O, Beer Y (2001) Interleukin-17 enhances tumor necrosis factor alpha-induced synthesis of interleukins 1,6, and 8 in skin and synovial fibroblasts: a possible role as a "fine-tuning cytokine" in inflammation processes. Arthritis Rheum 44: 2176–2184.Y. KatzO. NadivY. Beer2001Interleukin-17 enhances tumor necrosis factor alpha-induced synthesis of interleukins 1,6, and 8 in skin and synovial fibroblasts: a possible role as a "fine-tuning cytokine" in inflammation processes.Arthritis Rheum4421762184
26. Jovanovic DV, Di Battista JA, Martel-Pelletier J, Jolicoeur FC, He Y, et al. (1998) IL-17 stimulates the production and expression of proinflammatory cytokines, IL-beta and TNF-alpha, by human macrophages. J Immunol 160: 3513–3521.DV JovanovicJA Di BattistaJ. Martel-PelletierFC JolicoeurY. He1998IL-17 stimulates the production and expression of proinflammatory cytokines, IL-beta and TNF-alpha, by human macrophages.J Immunol16035133521
27. Lubberts E, Joosten LA, Oppers B, van den Bersselaar L, Coenen-de Roo CJ, et al. (2001) IL-1-independent role of IL-17 in synovial inflammation and joint destruction during collagen-induced arthritis. J Immunol 167: 1004–1013.E. LubbertsLA JoostenB. OppersL. van den BersselaarCJ Coenen-de Roo2001IL-1-independent role of IL-17 in synovial inflammation and joint destruction during collagen-induced arthritis.J Immunol16710041013
28. Lubberts E, Koenders MI, Oppers-Walgreen B, van den Bersselaar L, Coenen-de Roo CJ, et al. (2004) Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of collagen-induced arthritis reduces joint inflammation, cartilage destruction, and bone erosion. Arthritis Rheum 50: 650–659.E. LubbertsMI KoendersB. Oppers-WalgreenL. van den BersselaarCJ Coenen-de Roo2004Treatment with a neutralizing anti-murine interleukin-17 antibody after the onset of collagen-induced arthritis reduces joint inflammation, cartilage destruction, and bone erosion.Arthritis Rheum50650659
29. Ikeda T, Nakakuma H, Shionoya H, Kawaguchi T, Yamatsu K, et al. (1992) Ganglioside-induced inhibition of in vivo immune response in mice. Life Sci 51: 847–851.T. IkedaH. NakakumaH. ShionoyaT. KawaguchiK. Yamatsu1992Ganglioside-induced inhibition of in vivo immune response in mice.Life Sci51847851
30. van Hamburg JP, Asmawidjaja PS, Davelaar N, Mus AM, Colin EM, et al. (2011) Th17 cells, but not Th1 cells, from patients with early rheumatoid arthritis are potent inducers of matrix metalloproteinases and proinflammatory cytokines upon synovial fibroblast interaction, including autocrine interleukin-17A production. Arthritis Rheum 63: 73–83.JP van HamburgPS AsmawidjajaN. DavelaarAM MusEM Colin2011Th17 cells, but not Th1 cells, from patients with early rheumatoid arthritis are potent inducers of matrix metalloproteinases and proinflammatory cytokines upon synovial fibroblast interaction, including autocrine interleukin-17A production.Arthritis Rheum637383
31. Fossiez F, Djossou O, Chomarat P, Flores-Romo L, Ait-Yahia S, et al. (1996) T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines. J Exp Med 183: 2593–2603.F. FossiezO. DjossouP. ChomaratL. Flores-RomoS. Ait-Yahia1996T cell interleukin-17 induces stromal cells to produce proinflammatory and hematopoietic cytokines.J Exp Med18325932603
32. Tran CN, Lundy SK, White PT, Endres JL, Motyl CD, et al. (2007) Molecular interactions between T cells and fibroblast-like synoviocytes: role of membrane tumor necrosis factor-alpha on cytokine-activated T cells. Am J Pathol 171: 1588–1598.CN TranSK LundyPT WhiteJL EndresCD Motyl2007Molecular interactions between T cells and fibroblast-like synoviocytes: role of membrane tumor necrosis factor-alpha on cytokine-activated T cells.Am J Pathol17115881598
33. Shu L, Lee L, Shayman JA (2002) Regulation of phospholipase C-gamma activity by glycosphingolipids. J Biol Chem 277: 18447–18453.L. ShuL. LeeJA Shayman2002Regulation of phospholipase C-gamma activity by glycosphingolipids.J Biol Chem2771844718453
34. Shevchuk NA, Hathout Y, Epifano O, Su Y, Sutherland M, et al. (2007) Alteration of ganglioside synthesis by GM3 synthase knockout in murine embryonic fibroblasts. Biochim Biophys Acta 1771: 1226–1234.NA ShevchukY. HathoutO. EpifanoY. SuM. Sutherland2007Alteration of ganglioside synthesis by GM3 synthase knockout in murine embryonic fibroblasts.Biochim Biophys Acta177112261234
35. Ito M, Yamagata T (1989) Purification and characterization of glycosphingolipid-specific endoglycosidases (endoglycoceramidases) from a mutant strain of Rhodococcus sp. Evidence for three molecular species of endoglycoceramidase with different specificities. J Biol Chem 264: 9510–9519.M. ItoT. Yamagata1989Purification and characterization of glycosphingolipid-specific endoglycosidases (endoglycoceramidases) from a mutant strain of Rhodococcus sp. Evidence for three molecular species of endoglycoceramidase with different specificities.J Biol Chem26495109519
36. Fujikado N, Saijo S, Yonezawa T, Shimamori K, Ishii A, et al. (2008) Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells. Nat Med 14: 176–180.N. FujikadoS. SaijoT. YonezawaK. ShimamoriA. Ishii2008Dcir deficiency causes development of autoimmune diseases in mice due to excess expansion of dendritic cells.Nat Med14176180
37. Geboes L, Dumoutier L, Kelchtermans H, Schurgers E, Mitera T, et al. (2009) Proinflammatory role of the Th17 cytokine interleukin-22 in collagen-induced arthritis in C57BL/6 mice. Arthritis Rheum 60: 390–395.L. GeboesL. DumoutierH. KelchtermansE. SchurgersT. Mitera2009Proinflammatory role of the Th17 cytokine interleukin-22 in collagen-induced arthritis in C57BL/6 mice.Arthritis Rheum60390395
38. Saouaf SJ, Li B, Zhang G, Shen Y, Furuuchi N, et al. (2009) Deacetylase inhibition increases regulatory T cell function and decreases incidence and severity of collagen-induced arthritis. Exp Mol Pathol 87: 99–104.SJ SaouafB. LiG. ZhangY. ShenN. Furuuchi2009Deacetylase inhibition increases regulatory T cell function and decreases incidence and severity of collagen-induced arthritis.Exp Mol Pathol8799104
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2012 Tsukuda et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License: https://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Rheumatoid arthritis (RA), a chronic systemic inflammatory disorder that principally attacks synovial joints, afflicts over 2 million people in the United States. Interleukin (IL)-17 is considered to be a master cytokine in chronic, destructive arthritis. Levels of the ganglioside GM3, one of the most primitive glycosphingolipids containing a sialic acid in the structure, are remarkably decreased in the synovium of patients with RA. Based on the increased cytokine secretions observed in in vitro experiments, GM3 might have an immunologic role. Here, to clarify the association between RA and GM3, we established a collagen-induced arthritis mouse model using the null mutation of the ganglioside GM3 synthase gene. GM3 deficiency exacerbated inflammatory arthritis in the mouse model of RA. In addition, disrupting GM3 induced T cell activation in vivo and promoted overproduction of the cytokines involved in RA. In contrast, the amount of the GM3 synthase gene transcript in the synovium was higher in patients with RA than in those with osteoarthritis. These findings indicate a crucial role for GM3 in the pathogenesis and progression of RA. Control of glycosphingolipids such as GM3 might therefore provide a novel therapeutic strategy for RA.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




