About the Authors:
Magdalena Ydreborg
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Johan Westin
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Karolina Rembeck
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Magnus Lindh
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Hans Norrgren
Affiliation: Department of Infectious Diseases, Skåne University Hospital, Lund, Sweden
Anna Holmberg
Affiliation: Department of Infectious Diseases, Skåne University Hospital, Lund, Sweden
Rune Wejstål
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Gunnar Norkrans
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Kristina Cardell
Affiliation: Department of Infectious Diseases, Linköping University Hospital, Linköping, Sweden
Ola Weiland
Contributed equally to this work with: Ola Weiland, Martin Lagging
Affiliation: Department of Infectious Diseases, Karolinska Institutet, Karolinska University Hospital, Karolinska, Sweden
Martin Lagging
Contributed equally to this work with: Ola Weiland, Martin Lagging
* E-mail: [email protected]
Affiliation: Department of Infectious Diseases/Virology, Institute of Biomedicine, University of Gothenburg, Gothenburg, Sweden
Introduction
Hepatitis C virus (HCV) infects 170 million people worldwide [1] and is a leading cause of chronic hepatitis, cirrhosis, and hepatocellular carcinoma [2]. Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in the 19q13 region, in close proximity to three genes (IL28A, IL28B, and IL29) encoding cytokines of the interferon-λ (i.e. type III interferon) family, predict spontaneous clearance of HCV infection [3], [4] as well as sustained virological response (SVR) following pegylated-interferon (peg-IFN) and ribavirin therapy among patients infected with HCV genotype 1 [3], [5], [6], [7].
The C allele at rs12979860 is associated with higher viral load [5], [8], [9], which otherwise is an established negative predictor of response to IFN-α and ribavirin therapy [10], [11], [12]. Additionally, these polymorphisms are strongly associated with the first phase viral decline (i.e. reduction of HCV RNA during the first days of treatment which is assumed to result from the blocking of the production or release of hepatitis C virions [13], [14]), irrespective of HCV genotype [9], [15], [16]. Among HCV genotype 1 infected patients this translates into higher frequencies of achieving both rapid virological response (RVR) and SVR among carriers of the favorable SNP alleles [9], [15], and concomitant assessment of pretreatment levels of systemic IP-10 augments the predictive value of IL28B genetic variants [17], [18].
Somewhat counterintuitive are the multiple reports that C allele carriage at rs12979860 is more common in Caucasians infected with HCV genotype 2 or 3 than with genotype 1 [9], [18]. In the setting of therapeutic intervention for HCV genotype 2 or 3, uncertainty prevails regarding the benefit of favorable IL28B allele carriage. Sarrazin et al. reported increased SVR rates following therapy among HCV genotype 2 or 3 infected Caucasian CC rs12979860 carriers as compared to carriers of the T allele [19]. In contrast Mangia et al. noted an association between IL28B genotype and SVR only among HCV genotype 2 or 3 infected patients failing to achieve RVR [20]. Yu et al. reported a significantly higher rate of achieving RVR but not SVR among Asian homozygous TT rs8099917 carriers (i.e. the favorable genotype for this SNP) infected with HCV genotype 2 [21] and Moghaddam et al. noted similar results among HCV genotype 3 infected Caucasian CC rs12979860 carriers [22] as did Scherzer et al. [23]. In contrast, Lindh et al. [16] and Stenkvist et al. [24] reported no impact of CC rs12979860 carriage on the likelihood of achieving either RVR or SVR, in spite of a steeper first phase decline in HCV RNA among Scandinavian genotype 2/3 infected patients, possibly secondary to a higher baseline viral load.
In a study of Japanese patients infected with HCV genotype 1 or 2, those homozygous for the IL28B favorable allele had significantly more severe inflammatory activity, and a higher proportion of these patients had fibrosis stage F2-4 as compared with F0-1 [25]. In contrast, among HCV genotype 1 infected American patients, CC carriers at rs12979860 reportedly was associated with a lower prevalence of steatosis [26]. Among HCV genotype 3 infected patients of Scandinavian descent, CC carriers at rs12979860 had significantly higher normalized alanine aminotransferase (ALT) levels as well as aspartate aminotransferase platelet ratio index (APRI) than T allele carriers indicating more pronounced inflammation and fibrosis [22]. Similarly when evaluating liver biopsies from HCV genotype 3 infected patients, IL28B genetic variants that otherwise are linked with more favorable therapeutic outcome were associated with more pronounced inflammation, steatosis, and fibrosis [27], [28], [29]. Among 1483 predominantly HCV genotype 1 infected patients, 276 of whom had paired liver biopsies, CC carriers at rs12979860 had greater hepatic necroinflammation, higher ALT, and worse clinical outcome, but not greater fibrosis progression, although this latter finding may have been secondary to the relatively short time that elapsed between biopsies (median 4 years) [30]. Following HCV recurrence among 54 liver transplant recipients, a non-significant trend towards milder fibrosis was noted among CC rs12979860 carriers possibly secondary to better therapeutic response [31]. Subgrouping by HCV genotype, however, was not reported in this latter study.
The aim of the present study was thus to evaluate the impact of IL28B SNP variability on liver damage evaluated by liver stiffness measurement in the context of a real-life trial for sequential patients with HCV infection undergoing routine evaluation.
Materials and Methods
Study participants
Eight hundred and two sequential Scandinavian HCV infected patients undergoing routine clinical liver stiffness measurement from 2008 to 2012 were recruited at four University Hospitals in Sweden, and genotyped for IL28B (rs12979860) (enrollment and disposition of patients detailed in Figure 1). Forty-one of the evaluated patients did not fulfill the inclusion criteria (HCV-RNA was not detectable at time of liver stiffness measurement, or unavailable samples for IL28B or HCV genotyping) and thus were excluded. One patient with genotype 6, 21 patients with genotype 4, and two patients co-infected with more than one HCV genotype were also excluded leaving a study cohort of 737 patients, of whom 614 had valid liver stiffness measurements (characteristics detailed in Table 1). No patients had detectable hepatitis B surface antigen (HBsAg) or anti-HIV antibodies. Demographic and clinical data were gathered from medical charts and anonymously registered in a joint database. Information regarding possible previous episodes of antiviral treatment was available for 708 patients (of whom 590 had an interpretable liver stiffness measurement) where 21% (n = 150) of the patients were treatment experienced, without having achieved SVR. No patient was on treatment at the time of evaluation. Data regarding alcohol consumption or race was not available, although the overwhelming majority of patients are likely to be Caucasians of Scandinavian origin.
[Figure omitted. See PDF.]
Figure 1. Study enrollment and disposition of patients.
https://doi.org/10.1371/journal.pone.0080172.g001
[Figure omitted. See PDF.]
Table 1. Baseline characteristics of patients with a valid liver stiffness measurement.
https://doi.org/10.1371/journal.pone.0080172.t001
IL28B genotyping
SNP rs12979860 was determined in plasma by allelic discrimination using Taqman MGB (minor groove binding) probes. The following primers and probes were used: rs12979860: Forward, GTGCCTGTCGTGTACTGAACCA, Reverse, AGCGCGGAGTGCAATTCA, Probe_C, FAM-CCTGGTTCGCGCCTT-MGB, Probe_T, VICCCTGGTTCACGCCT-MGB. All SNPs were in Hardy-Weinberg equilibrium. SNP rs12979860 has previously been reported to have a stronger association with both first phase decline and SVR than rs8099917 and rs12980275 among Caucasian HCV infected patients, and was thus analyzed in the present study [9].
HCV RNA quantification
Plasma was obtained using PPT-tubes and HCV RNA was determined by RT-PCR of plasma using Cobas AmpliPrep/COBAS TaqMan HCV Test (Roche Diagnostics, Branchburg, NJ), which quantifies HCV RNA with a limit of detection of ≤15 IU/mL.
Liver stiffness measurement
Liver stiffness measurement was performed using the Fibroscan® device (EchoSens, Paris, France). Details of the technical background and the examination procedure have been described previously [32]. The results were expressed as median values in kilo Pascal (kPa). Procedures with ten valid measurements and a success rate (the number of valid measurements divided by the number of all measurements) of at least 60% were considered reliable. In addition, the median value of successful measurements was considered representative for the liver stiffness in a given patient if the interquartile range (IQR) of the examinations was less than 30% of the median [33], [34].
Fibrosis index
APRI was calculated as the ratio of normalized aspartate aminotransferase, i.e. value divided by the upper limit of normal, to the platelet count as previously detailed [35].
Statistical methods
Wilcoxon-Mann-Whitney U-test, Kruskal-Wallis test, and Chi squared (χ2) tests were utilized to evaluate relationships between groups. Multivariate analysis of potential fibrosis predictors was made by General Linear Model. Logarithmic transformation was used for quantitative data with skewed distribution and subjects were stratified according to genotype. The following variables were included in the analysis: age, gender, normalized ALT and IL28B genotype with median value of Liver Stiffness Measurement as dependent variable. A model including BMI was rejected since this resulted in too few observations in non-genotype 1 patients to perform multivariate analysis. All statistical analyses were performed using IBM SPSS Statistics version 19.0 software package (IBM Corporation, Somers, NY). All reported p-values are two-sided, and p-values <0.05 were considered significant. IL28B SNPs comparisons were made by stratifying patients according to rs12979860CC and rs12979860CT/TT genotypes.
Ethical Statement
The treatment study conformed to the guidelines of the 1975 Declaration of Helsinki and was approved by the Regional Ethical Review Board in Gothenburg (Regionala etikprövningsnämnden i Göteborg). Written informed consent was obtained from each participating patient.
Results
The majority of patients were male (62%) and infected with HCV genotype 1 (69%). When comparing HCV genotype 1 and 3 infected patients, they differed significantly. The HCV genotype 1 patients were older (median age 53 vs. 47 years for genotype 1 and 3 respectively, p<0.0001), had a longer duration of infection (median 30 vs. 25 years for genotype 1 and 3 respectively, p<0,0001), had higher BMI (26 vs. 25 kg/m2 for genotype 1 and 3 respectively, p = 0.04), and were less likely to have been infected through intravenous drug use (50% vs. 64% genotype 1 and 3 respectively, p = 0.03). A strong association was noted between the distribution of HCV genotypes and IL28B SNP variants (P<0.0001; Figure 2), with CC at rs12979860 being significantly more common in treatment-naïve patients with HCV genotype 2 or 3 infection than genotype 1. Treatment-experienced patients were excluded from this latter analysis in order to avoid potential bias resulting from differing treatment response.
[Figure omitted. See PDF.]
Figure 2. Frequency distribution of IL28B variants in relation to HCV genotypes 1-3 among treatment-naïve patients.
Chi-squared (χ2)-test was used to compare differences in distribution.
https://doi.org/10.1371/journal.pone.0080172.g002
A valid liver stiffness measurement was obtained in 614 patients (83%). In general patients with invalid examinations were older than those with valid (median age 54 and 52 years, p = 0.004), and had significantly higher body-mass index (BMI) (28 and 25 kg/m2, p<0.0001). These findings were in line with a previous reported 5-year prospective study of 13,369 liver stiffness measurements, where unreliable results were noted in nearly one of five examinations, with obesity and old age being main causes [36].
Among HCV genotype 3 infected patients with CC at rs12979860, significantly higher liver stiffness values (median 8.2 vs. 6.4 kPa for CC and CT/TT respectively, P = 0.004; Figure 3) as well as APRI (median 1.0 vs. 0.6 for CC and CT/TT respectively, P = 0.02; Figure 4), were noted as compared to Trs12979860 allele carriers. Conversely, among HCV genotype 1 infected patients with CC genotype, a non-significant trend towards lower liver stiffness values and APRI were noted. There were no significant differences in age, gender, BMI or duration of infection between CC and CT/TT carriers in neither genotype 1 nor genotype 3 infected patients (Table 2). These results were unchanged when patients with unreliable liver stiffness measurements were excluded. No significant associations were observed among the 67 HCV genotype 2 infected patients, although a trend was noted towards slightly more pronounced liver pathology among CC carriers (median liver stiffness 9.2 vs. 7.0 kPa for CC and CT/TT respectively, P = 0.13), (median APRI 0.8 vs. 0.5 for CC and CT/TT respectively, P = 0.19). All of the abovementioned results remained unchanged if treatment-experienced patients were excluded from the analyses. No association was noted between alanine aminotransferase (ALT) and IL28B genetic variants.
[Figure omitted. See PDF.]
Figure 3. Tenth, 25th, 50th, 75th, and 90th percentiles of liver stiffness measurement level in relation to IL28B variants for genotypes 1, 2 and 3.
https://doi.org/10.1371/journal.pone.0080172.g003
[Figure omitted. See PDF.]
Figure 4. Tenth, 25th, 50th, 75th, and 90th percentiles of APRI score in relation to IL28B variants for genotypes 1, 2 and 3.
https://doi.org/10.1371/journal.pone.0080172.g004
[Figure omitted. See PDF.]
Table 2. Baseline characteristics according to HCV genotype and IL28 B genetic variations (rs12979860).
https://doi.org/10.1371/journal.pone.0080172.t002
The HCV genotype 1 infected homozygous CC carriers had significantly higher viral load (median 6.6 and 6.2 log10 IU/mL for CC and CT/TT respectively, P = 0.001; Figure 5) with similar non-significant trend noted among HCV genotype 2 and 3 infected patients.
[Figure omitted. See PDF.]
Figure 5. Tenth, 25th, 50th, 75th, and 90th percentiles of HCV RNA level in relation to IL28B.
https://doi.org/10.1371/journal.pone.0080172.g005
The following variables remained independently predictive in multivariate analysis of greater liver stiffness in HCV genotype 1 infected patients: older age (P<0.001), higher ALT (P<0.0001), and male gender (P = 0.011). For HCV genotype 3 infected patients, older age (P<0.0001), higher ALT (P = 0.001), CC at rs12979860 (P = 0.017), and male gender (P = 0.029) were independently predictive of more pronounced liver stiffness. HCV genotype 2 infected patients could not be evaluated in multivariate analysis due to the small sample size.
Discussion
This study confirms previous reports that CCrs12979860 carriage is associated with more pronounced liver pathology in patients chronically infected with HCV genotype 3 as compared to genotype 1. Abe et al. reported that among Japanese patients infected with HCV genotype 1 or 2, patients with homozygous carriage of the IL28B major allele had significantly more severe inflammatory activity and fibrosis, indicating that this SNP genotype may not be beneficial outside the context of therapeutic intervention [25]. Similarly Bochud et al. [37] analyzed the association between IL28B polymorphisms and liver histology among 1527 chronically HCV-infected Caucasian patients and noted that the rare IL28B Grs8099917 allele, which has been associated with poor response to therapy, entailed less hepatic inflammation and fibrosis. When stratifying for HCV genotype, important differences were noted, and the findings were statistically significant for genotype 3 only. In agreement with the findings of Bochud et al., we recently presented results from a pegylated interferon-α2a and ribavirin trial for treatment naïve HCV genotype 2/3 patients (NORDynamIC study) [38]. In this trial, which included 314 Caucasian patients who were evaluated for IL28B polymorphisms, pretreatment liver biopsies were mandatory and centrally evaluated for liver fibrosis and inflammation using the Ishak protocol as well as steatosis. The IL28B Grs8099917 allele was significantly associated with milder fibrosis among HCV genotyped 3 infected patients, with a similar non-significant trend observed for IL28B Trs12979860, but not for genotype 2 [27], [28]. Similarly, IL28B Trs12979860 carriage in HCV genotype 3 infected patients was associated with less steatosis, whereas IL28B Grs8099917 carriage in HCV genotype 2 was associated with less steatosis.
Liver pathology in the present study was evaluated by means of liver stiffness measurement rather than liver biopsy. Thus it was not possible to ascertain which histopathological components contributed to the elevated measurements among HCV genotype 3 infected CC carriers, although the concomitantly elevated APRI suggests that more pronounced fibrosis weighed in. It should be noted that elevated ALT reportedly confounds the use of transient elastography among HCV infected patients [39]. However, in the present study ALT was not associated with IL28B genetic variants, and in the multivariate analysis among HCV genotype 3 infected patients, both higher ALT and IL28B CCrs12979860 carriage were independently predictive of the elevated liver stiffness measurement. Although transient elastography has a high degree of accuracy and reproducibility in prediction of liver fibrosis in the context of HCV infection, there are conflicting reports as to the impact of steatosis on Fibroscan® measurements. Arena et al. observed no influence of steatosis on transient elastography [40], whereas Sanchez-Conde et al. [41] and Boursier et al. [42] noted significant associations. However, in the latter two studies the influence of steatosis was noted predominately among patients with high-grade steatosis.
It is unclear how CC genotype carriage, in the context of HCV genotype 3 infection, may induce more pronounced liver pathology. Rembeck et al. previously suggested that the underlying mechanism of action might be secondary to higher baseline viral loads [27], [28], [29], although in the present study no significant association was noted between viral load and liver stiffness. Elevated HCV RNA levels in HCV genotype 3 infection have previously been reported to be associated with the increased presence and severity of steatosis [43], [44], which in turn entails accelerated fibrosis progression [45], suggestive of a cytopathic effect of HCV genotype 3 virus. On a similar note, it was recently reported that the cumulative mortality of HCV genotype 3 infected US Department of Veterans Affairs (VA) patients failing to achieve SVR after therapy was higher than among non-SVR patients infected with genotypes 1 or 2 [46]. How the HCV genotype 3 virus exerts this cytopathic effect remains to be determined, though previously it has been hypothesized that the greater propensity for development of steatosis, than observed for other HCV genotypes [43], [45], may be secondary to a greater impairment of lipid export from infected hepatocytes [47], [48] possibly mediated by inhibition of microsomal triglyceride transfer protein (MTP) [49], [50] or due to increased availability of free fatty acids by reduced oxidation or by increased de novo synthesis [51], [52], [53], [54] mediated by the HCV genotype 3 core protein.
Due to the retrospective design, details regarding alcohol intake were not recorded. Similarly, according to clinical routine, information regarding ethnicity was also not recorded in medical charts at the participating centers. However, when considering the local populations of HCV-infected individuals in Sweden, it is reasonable to assume that the overwhelming majority of patients included were Caucasians of Scandinavian origin.
Our finding that homozygous CC at rs12979860 was significantly more common in the setting of treatment-naïve HCV genotype 2 or 3 infection than genotype 1 corroborates previous reports [8], [18]. Indeed, the proportion of CC at rs12979860 among HCV genotype 2 and 3 infected patients (40% and 45%, respectively) in our study is similar to the reported prevalence in HCV uninfected Caucasians (∼40%), suggesting that this SNP genotype may be less beneficial following exposure to HCV genotype 2 or 3 as compared to genotype 1.
In conclusion, the present study demonstrated an association between CC carriage at rs12979860 and more pronounced liver stiffness values and APRI among HCV genotype 3 infected patients. In this light, analysis of IL28B genotype may be beneficial among HCV genotype 3 infected patients so as to encourage homozygous CC rs12979860 carriers to initiate therapy. Additionally, the finding that IL28B variability did not significantly impact on liver stiffness measurement among HCV genotype 1 and 2 infected patients and that CC rs12979860 was more common among genotype 2/3 infected patients, implies that IL28B may differentially regulate the course of HCV infection across genotypes.
Acknowledgments
We thank Staffan Nilsson for statistical counseling and Mats Ahlqvist, Helen Christiansen, Eva-Lena Fredriksson, Lena Johansson, Pia Paghold, Anna Rosnäs and Sofie Tylö for expert technical assistance.
Author Contributions
Conceived and designed the experiments: M. Lagging JW MY KR. Analyzed the data: MY M. Lagging JW KR. Contributed reagents/materials/analysis tools: M. Lindh HN AH RW GN KC OW. Wrote the paper: M. Lagging MY JW KR.
Citation: Ydreborg M, Westin J, Rembeck K, Lindh M, Norrgren H, Holmberg A, et al. (2013) Impact of IL28B-Related Single Nucleotide Polymorphisms on Liver Transient Elastography in Chronic Hepatitis C Infection. PLoS ONE 8(11): e80172. https://doi.org/10.1371/journal.pone.0080172
1. WHO (1999) Hepatitis C- globalprevalence (update). Weekly Epidemilogical Report 74: 425–427.
2. Saito I, Miyamura T, Ohbayashi A, Harada H, Katayama T, et al. (1990) Hepatitis C virus infection is associated with the development of hepatocellular carcinoma. Proc Natl Acad Sci U S A 87: 6547–6549.
3. Rauch A, Kutalik Z, Descombes P, Cai T, Di Iulio J, et al. (2010) Genetic variation in IL28B is associated with chronic hepatitis C and treatment failure: a genome-wide association study. Gastroenterology 138: 1338–1345, 1345 e1331-1337.
4. Thomas DL, Thio CL, Martin MP, Qi Y, Ge D, et al. (2009) Genetic variation in IL28B and spontaneous clearance of hepatitis C virus. Nature 461: 798–801.
5. Ge D, Fellay J, Thompson AJ, Simon JS, Shianna KV, et al. (2009) Genetic variation in IL28B predicts hepatitis C treatment-induced viral clearance. Nature 461: 399–401.
6. Suppiah V, Moldovan M, Ahlenstiel G, Berg T, Weltman M, et al. (2009) IL28B is associated with response to chronic hepatitis C interferon-alpha and ribavirin therapy. Nat Genet 41: 1100–1104.
7. Tanaka Y, Nishida N, Sugiyama M, Kurosaki M, Matsuura K, et al. (2009) Genome-wide association of IL28B with response to pegylated interferon-alpha and ribavirin therapy for chronic hepatitis C. . Nat Genet 41: 1105–1109.
8. McCarthy JJ, Li JH, Thompson A, Suchindran S, Lao XQ, et al. (2010) Replicated association between an IL28B gene variant and a sustained response to pegylated interferon and ribavirin. Gastroenterology 138: 2307–2314.
9. Bochud PY, Bibert S, Negro F, Haagmans B, Soulier A, et al. (2011) IL28B polymorphisms predict reduction of HCV RNA from the first day of therapy in chronic hepatitis C. J Hepatol 55: 980–8.
10. Fried MW, Shiffman ML, Reddy KR, Smith C, Marinos G, et al. (2002) Peginterferon alfa-2a plus ribavirin for chronic hepatitis C virus infection. N Engl J Med 347: 975–982.
11. Hadziyannis SJ, Sette H Jr, Morgan TR, Balan V, Diago M, et al. (2004) Peginterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose. Ann Intern Med 140: 346–355.
12. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, et al. (2001) Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet 358: 958–965.
13. Dahari H, Ribeiro RM, Perelson AS (2007) Triphasic decline of hepatitis C virus RNA during antiviral therapy. Hepatology 46: 16–21.
14. Neumann AU, Lam NP, Dahari H, Gretch DR, Wiley TE, et al. (1998) Hepatitis C viral dynamics in vivo and the antiviral efficacy of interferon-alpha therapy. Science 282: 103–107.
15. Lindh M, Lagging M, Arnholm B, Eilard A, Nilsson S, et al. (2011) IL28B polymorphisms determine early viral kinetics and treatment outcome in patients receiving peginterferon/ribavirin for chronic hepatitis C genotype 1. J Viral Hepat 18: e325–331.
16. Lindh M, Lagging M, Farkkila M, Langeland N, Morch K, et al. (2011) Interleukin 28B Gene Variation at rs12979860 Determines Early Viral Kinetics During Treatment in Patients Carrying Genotypes 2 or 3 of Hepatitis C Virus. J Infect Dis 203: 1748–1752.
17. Darling JM, Aerssens J, Fanning G, McHutchison JG, Goldstein DB, et al. (2011) Quantitation of pretreatment serum interferon-gamma-inducible protein-10 improves the predictive value of an IL28B gene polymorphism for hepatitis C treatment response. Hepatology 53: 14–22.
18. Lagging M, Askarieh G, Negro F, Bibert S, Soderholm J, et al. (2011) Response Prediction in Chronic Hepatitis C by Assessment of IP-10 and IL28B-Related Single Nucleotide Polymorphisms. PLoS One 6: e17232.
19. Sarrazin C, Susser S, Doehring A, Lange CM, Muller T, et al. (2011) Importance of IL28B gene polymorphisms in hepatitis C virus genotype 2 and 3 infected patients. J Hepatol 54: 415–421.
20. Mangia A, Thompson AJ, Santoro R, Piazzolla V, Tillmann HL, et al.. (2010) An IL28B polymorphism determines treatment response of hepatitis C virus genotype 2 or 3 patients who do not achieve a rapid virologic response. Gastroenterology 139: : 821-827, 827 e821.
21. Yu ML, Huang CF, Huang JF, Chang NC, Yang JF, et al. (2011) Role of interleukin-28B polymorphisms in the treatment of hepatitis C virus genotype 2 infection in Asian patients. Hepatology 53: 7–13.
22. Moghaddam A, Melum E, Reinton N, Ring-Larsen H, Verbaan H, et al. (2011) IL28B genetic variation and treatment response in patients with hepatitis C virus genotype 3 infection. Hepatology 53: 746–754.
23. Scherzer TM, Hofer H, Staettermayer AF, Rutter K, Beinhardt S, et al. (2011) Early virologic response and IL28B polymorphisms in patients with chronic hepatitis C genotype 3 treated with peginterferon alfa-2a and ribavirin. J Hepatol 54: 866–871.
24. Stenkvist J, Sonnerborg A, Weiland O (2013) HCV RNA decline in chronic HCV genotype 2 and 3 during standard of care treatment according to IL28B polymorphism. Journal of Viral Hepatitis 20: 193–199.
25. Abe H, Ochi H, Maekawa T, Hayes CN, Tsuge M, et al. (2010) Common variation of IL28 affects gamma-GTP levels and inflammation of the liver in chronically infected hepatitis C virus patients. J Hepatol 53: 439–443.
26. Tillmann HL, Patel K, Muir AJ, Guy CD, Li JH, et al. (2011) Beneficial IL28B genotype associated with lower frequency of hepatic steatosis in patients with chronic hepatitis C. Journal of hepatology 55: 1195–1200.
27. Rembeck K, Westin J, Lindh M, Hellstrand K, Norkrans G, et al. (2012) Association between IL28B-related genetic variants and liver histopathology differs between hcv genotypes. Hepatology 56: 394.
28. Rembeck K, Alsio A, Christensen PB, Farkkila M, Langeland N, et al. (2012) Impact of IL28B-Related Single Nucleotide Polymorphisms on Liver Histopathology in Chronic Hepatitis C Genotype 2 and 3. PLoS One 7: e29370.
29. Bochud PY, Bibert S, Kutalik Z, Patin E, Guergnon J, et al. (2012) IL28B alleles associated with poor hepatitis C virus (HCV) clearance protect against inflammation and fibrosis in patients infected with non-1 HCV genotypes. Hepatology 55: 384–394.
30. Noureddin M, Wright EC, Alter H, Clark S, Thomas E, et al.. (2013) Association of IL28B genotype with fibrosis progression and clinical outcomes in patients with chronic hepatitis C: A longitudinal analysis. In press in Hepatology.
31. Ackefors M, Nyström J, Wernerson A, Gjertsen H, Sönnerborg A, et al.. (2013) Evolution of fibrosis during HCV recurrence ater liver transplantation - influence of IL-28B SNP and response to peg-IFN and ribavirin treatment. In press in Journal of Viral Hepatitis.
32. Sandrin L, Fourquet B, Hasquenoph JM, Yon S, Fournier C, et al. (2003) Transient elastography: a new noninvasive method for assessment of hepatic fibrosis. Ultrasound Med Biol 29: 1705–1713.
33. Fraquelli M, Rigamonti C, Casazza G, Conte D, Donato MF, et al. (2007) Reproducibility of transient elastography in the evaluation of liver fibrosis in patients with chronic liver disease. Gut 56: 968–973.
34. Castera L, Forns X, Alberti A (2008) Non-invasive evaluation of liver fibrosis using transient elastography. J Hepatol 48: 835–847.
35. Wai CT, Greenson JK, Fontana RJ, Kalbfleisch JD, Marrero JA, et al. (2003) A simple noninvasive index can predict both significant fibrosis and cirrhosis in patients with chronic hepatitis C. . Hepatology 38: 518–526.
36. Castera L, Foucher J, Bernard PH, Carvalho F, Allaix D, et al. (2010) Pitfalls of liver stiffness measurement: a 5-year prospective study of 13,369 examinations. Hepatology 51: 828–835.
37. Bochud PY, Bibert S, Kutalik Z, Patin E, Guergnon J, et al. (2012) IL28B alleles associated with poor HCV clearance protect against inflammation and fibrosis in patients infected with non-1 HCV genotypes. Hepatology 55: 384–94.
38. Lagging M, Langeland N, Pedersen C, Farkkila M, Buhl MR, et al. (2008) Randomized comparison of 12 or 24 weeks of peginterferon alpha-2a and ribavirin in chronic hepatitis C virus genotype 2/3 infection. Hepatology 47: 1837–1845.
39. Tapper EB, Cohen EB, Patel K, Bacon B, Gordon S, et al.. (2012) Levels of alanine aminotransferase confound use of transient elastography to diagnose fibrosis in patients with chronic hepatitis C virus infection. Clinical gastroenterology and hepatology: the official clinical practice journal of the American Gastroenterological Association 10: : 932-937 e931.
40. Arena U, Vizzutti F, Abraldes JG, Corti G, Stasi C, et al. (2008) Reliability of transient elastography for the diagnosis of advanced fibrosis in chronic hepatitis C. Gut 57: 1288–1293.
41. Sanchez-Conde M, Montes Ramirez ML, Bellon Cano JM, Caminoa A, Alvarez Rodriguez F, et al. (2011) Impact of liver steatosis on the correlation between liver stiffness and fibrosis measured by transient elastography in patients coinfected with human immunodeficiency virus and hepatitis C virus. Journal of viral hepatitis 18: e278–283.
42. Boursier J, de Ledinghen V, Sturm N, Amrani L, Bacq Y, et al.. (2013) Precise evaluation of liver histology by computerized morphometry shows that steatosis influences liver stiffness measured by transient elastography in chronic hepatitis C. Journal of gastroenterology.
43. Adinolfi LE, Gambardella M, Andreana A, Tripodi MF, Utili R, et al. (2001) Steatosis accelerates the progression of liver damage of chronic hepatitis C patients and correlates with specific HCV genotype and visceral obesity. Hepatology 33: 1358–1364.
44. Westin J, Lagging M, Dhillon AP, Norkrans G, Romero AI, et al. (2007) Impact of hepatic steatosis on viral kinetics and treatment outcome during antiviral treatment of chronic HCV infection. J Viral Hepat 14: 29–35.
45. Westin J, Nordlinder H, Lagging M, Norkrans G, Wejstal R (2002) Steatosis accelerates fibrosis development over time in hepatitis C virus genotype 3 infected patients. J Hepatol 37: 837–842.
46. Backus LI, Boothroyd DB, Phillips BR, Belperio P, Halloran J, et al. (2011) A Sustained Virologic Response Reduces Risk of All-Cause Mortality in Patients With Hepatitis C. Clin Gastroenterol Hepatol 9: 509–516.
47. Rubbia-Brandt L, Quadri R, Abid K, Giostra E, Male PJ, et al. (2000) Hepatocyte steatosis is a cytopathic effect of hepatitis C virus genotype 3. J Hepatol 33: 106–115.
48. Hofer H, Bankl HC, Wrba F, Steindl-Munda P, Peck-Radosavljevic M, et al. (2002) Hepatocellular fat accumulation and low serum cholesterol in patients infected with HCV-3a. Am J Gastroenterol 97: 2880–2885.
49. Abid K, Pazienza V, de Gottardi A, Rubbia-Brandt L, Conne B, et al. (2005) An in vitro model of hepatitis C virus genotype 3a-associated triglycerides accumulation. J Hepatol 42: 744–751.
50. Mirandola S, Realdon S, Iqbal J, Gerotto M, Dal Pero F, et al. (2006) Liver microsomal triglyceride transfer protein is involved in hepatitis C liver steatosis. Gastroenterology 130: 1661–1669.
51. Jackel-Cram C, Babiuk LA, Liu Q (2007) Up-regulation of fatty acid synthase promoter by hepatitis C virus core protein: genotype-3a core has a stronger effect than genotype-1b core. J Hepatol 46: 999–1008.
52. Kawaguchi T, Yoshida T, Harada M, Hisamoto T, Nagao Y, et al. (2004) Hepatitis C virus down-regulates insulin receptor substrates 1 and 2 through up-regulation of suppressor of cytokine signaling 3. Am J Pathol 165: 1499–1508.
53. Pazienza V, Clement S, Pugnale P, Conzelman S, Foti M, et al. (2007) The hepatitis C virus core protein of genotypes 3a and 1b downregulates insulin receptor substrate 1 through genotype-specific mechanisms. Hepatology 45: 1164–1171.
54. Waris G, Felmlee DJ, Negro F, Siddiqui A (2007) Hepatitis C virus induces proteolytic cleavage of sterol regulatory element binding proteins and stimulates their phosphorylation via oxidative stress. J Virol 81: 8122–8130.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2013 Ydreborg et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License: http://creativecommons.org/licenses/by/3.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background and Aims
Recently, several genome-wide association studies have revealed that single nucleotide polymorphisms (SNPs) in proximity to IL28B predict spontaneous clearance of hepatitis C virus (HCV) infection as well as outcome following pegylated interferon and ribavirin therapy among genotype 1 infected patients. Additionally the presence of the otherwise favorable IL28B genetic variants in the context of HCV genotype 3 infection reportedly entail more pronounced liver fibrosis and steatosis. The present study aimed to evaluate the impact of IL28B SNP variability on liver stiffness as accessed by transient elastography.
Methods
Seven hundred and seventy-one Swedish HCV infected patients sequentially undergoing liver stiffness measurement by means of Fibroscan® in the context of a real-life trial had samples available for IL28B genotyping (rs12979860) and HCV genotyping.
Results
CCrs12979860 was more common among HCV genotype 2 or 3 infected treatment-naïve patients than among those infected with genotype 1 (P<0.0001). Additionally CCrs12979860 among HCV genotype 3 infected patients was associated with higher liver stiffness values (P = 0.004), and higher AST to platelet ratio index (APRI; p = 0.02) as compared to carriers of the T allele. Among HCV genotype 1 infected patients, CCrs12979860 was significantly associated with higher viral load (P = 0.001), with a similar non-significant trend noted among HCV genotype 3 infected patients.
Conclusion
This study confirms previous reports that the CCrs12979860 SNP is associated with more pronounced liver pathology in patients chronically infected with HCV genotype 3 as compared to genotype 1, suggesting that IL28B genetic variants differently regulates the course of HCV infection across HCV genotypes.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer