Content area
Full Text
Wolcott-Rallison syndrome (OMIM 226980) is a rare autosomal recessive disorder characterised by permanent insulin requiring diabetes developing in the newborn period or early infancy, an early tendency to skeletal fractures, and spondyloepiphyseal dysplasia. 1- 8 The syndrome results from mutations in the gene encoding the eukaryotic translation initiation factor 2-α kinase 3 ( EIF2AK3 , also called PERK or PEK ). 9 This enzyme phosphorylates EIF2A at Ser51 to regulate the synthesis of unfolded proteins in the endoplasmic reticulum. 10 Targeted disruption of the Eif2ak3 gene in mice also causes diabetes because of the accumulation of unfolded proteins triggering β cell apoptosis. 11 12 Although these murine models have provided significant insight into the pathogenesis of Wolcott-Rallison syndrome, only three human cases have been characterised genetically. 8 9 Here, we report genetic analysis of two further cases, and demonstrate new features of the expression pattern of human EIF2AK3 that offer possible explanations for important clinical features of the syndrome that are not apparent in the transgenic mouse models.
METHODS
Primers were designed to amplify all EIF2AK3 exons and splice site sequences from genomic DNA (table 1). Sequences were amplified by 35 cycles of polymerase chain reaction (PCR) using a proof-reading DNA polymerase in 50 [micro]l reactions and purified (Qiaquick, Qiagen, Crawley, Sussex, UK). Products were sequenced using the BigDye terminator cycle sequencing kit according to the manufacturer's instructions (Perkin-Elmer, Foster City, California, USA) and an ABI 377 sequencer (Applied Biosystems, city, county, UK). Sequences were compared to the published EIF2AK3 gene by BLAST analysis ( http://www.ncbi.nlm.nih.gov/BLAST/ ). For potential mutations, the PCR and sequencing was repeated to confirm the result. Restriction digest analysis was also used to confirm the mutation in case 2, where the G->A substitution destroyed an Hph I site.
Table 1 Primers used to amplify the EIF2AK3 gene
Exon | Forward primer | Reverse primer | Product size (bp) | Annealing temperature (°C) |
1 | Gagaggcaggcgtcagtg | cgcgcgtaaacaagttgc | 403 | 58.9 |
2 | Tgagcatgtgggataagtgc | tgccctaaagggacacaaac | 333 | 60 |
3 | Tcaggatcaagactccagctc | tgacaacctcaggggaaaat | 448 | 59.7 |
4 | Ggagttggtaatctaactgatgc | ccaacagcaacattatctgaa | 328 | 62.5 |
5 | Gccctcttgtggcataaatc | ctgggagaggaagaaccgta | 449 | 58 |
6 | Tacttggggctctcagcttg | ggcactcctgaagtaggaagg | 374 | 58 |
7 | Ccctccctgtttttgttgaa | gggcaaagacagtcaggatt | 389 | 60 |
8 | Ctgggccatttgtttaactt | tgaaattgtctcccaagatg | 384 | 55.6 |
9 | Tagttaaagacgggcctatt | caagagtagctttggtggag | 396 | 56 |
10 | Aagactggagggatagcagt | agatcttaggtcatttcttctttg |