OPEN
Citation: Blood Cancer Journal (2014) 4, e265; doi:http://dx.doi.org/10.1038/bcj.2014.86
Web End =10.1038/bcj.2014.86 http://www.nature.com/bcj
Web End =www.nature.com/bcj
LETTER TO THE EDITOR
A novel fusion of SQSTM1 and FGFR1 in a patient with acute myelomonocytic leukemia with t(5;8)(q35;p11) translocation
Blood Cancer Journal (2014) 4, e265; doi:http://dx.doi.org/10.1038/bcj.2014.86
Web End =10.1038/bcj.2014.86 ; published online 12 December 2014
Hematological malignancies with FGFR1 abnormality (8p11 myeloproliferative syndrome; EMS) are rare atypical stem cell disorders characterized by eosinophilia, T-cell proliferation and progression to acute myeloid leukemia.1,2 In EMS, broblast
growth factor receptor 1 (FGFR1) gene at 8p11 is disrupted by chromosomal translocation, resulting in the formation of chimeric products with various partner genes. To date, 13 FGFR1 partners have been identied: ZMYM2 (ZNF198) at 13q12; CNTR at 9q33; FGFR1OP at 6q27; BCR at 22q11; HERVK at 19p13.3; FGFR1OP2 at 12p11; TRIM24 (TIF1) at 7q34; CPSF6 at 12q15; MYO18A at 17q23; LRRFIP1 at 2q37; CUX1 at 7q34; TPR at 1q25; and RANBP2/NUP358 at 2q12.25 In all reported cases in which chimeric transcripts were cloned, N-terminal portion of the predicted fusion protein is composed of a partner gene with a dimerization domain, which may induce the constitutive activation of FGFR1 tyrosine kinase in the C-terminal portion, leading to the cellular transformation.2
Here, we report the identication of sequestosome 1 (SQSTM1) gene at 5q35 as a novel fusion partner of the FGFR1 in a patient with acute myelomonocytic leukemia presenting 8p11 chromosomal abnormality.
A 76-year-old man was referred to our hospital for anemia with hemoglobin level of 5.0 g/dl. The white blood cell count was4.1 109 cells/l with 11% blasts, 1% eosinophils, 29% neutrophils and 30% monocytes, Bone marrow (BM) was hypercellular with 43% blasts and 17% monocytes. Dysplastic changes were observed in peripheral neutrophils and BM megakaryocytes. Immunphenotyping revealed that leukemic cells were positive for CD13, CD33, CD34 and HLA-DR and negative for other myeloid and lymphoid markers. He was diagnosed as acute myelomonocytic leukemia and received blood transfusion therapy for anemia, but chemotherapy was not done because of poor performance status. He died of progressive disease 15 months after the diagnosis.
Chromosome analysis of the BM cells showed the karyotype as 46,XY,t(5;8)(q35;p11) (20/20 cells) (Figure 1a). To characterize the 8p11 translocation, Southern blot analysis of DNA from the patients peripheral leukemic cells was performed using a genomic probe containing FGFR1 exon 9 and 10, as chromosomal breaks occur within intron 8 in most cases with EMS. Abnormal bands were observed in sample with BamHI or HindIII digestion (Figure 1b), conrming that FGFR1 was rearranged by the translocation.
To determine the FGFR1 partner gene, we searched for a FGFR1 chimeric transcript by 5-rapid amplication of cDNA end (RACE)
method using 5-Full RACE core set (Takara Bio, Otsu, Japan). Total RNA was extracted from the leukemic cells and the rst cDNA strand was synthesized with phosphorylated primer in FGFR1 exon 12 (5-GCCAGATACTCCATGCCTCG-3) by reverse transcription.
After ligation, cDNA was amplied by PCR with FGFR1-10R1 (5-ACACCACCTGCCCAAAGCAGC-3) and FGFR1-10F1 (5-AGGCT
ATCGGGCTGGACAAGG-3) primers in exon 10. The PCR product was further amplied with FGFR1-10R2 (5-CAGGGGTTTGCCTAA GACCAG-3) and FGFR1-10F2 (5-CGTGTGACCAAAGTGGCTGTG-3)
primes in exon 10. An abnormal band was amplied and sequencing of the PCR product revealed that FGFR1 was fused to a 5 foreign sequence that was identied as exon 9 of SQSTM1 at chromosome 5q35, showing that SQSTM1 was juxtaposed to FGFR1 as the result of the chromosomal translocation.
To ascertain the formation of chimeric transcript, we performed reverse transcription PCR (RT-PCR) analysis, using SQSTM1-8F1 (5-CCTGAAGAACGTTGGGAGAG-3) for exon 8 and FGFR1-10R1 primers. An amplied product was obtained from the patients leukemic cells (Figure 1c). Sequencing analysis of the PCR product revealed that the SQSTM1 exon 9 was fused to FGFR1 exon 9 (Figures 1c and d).
A reciprocal FGFR1-SQSTM1 fusion transcript was also detected in using forward FGFR1-7F1 (5-GTAACTCTATCGGACTCTCCC-3) for exon 7 and reverse SQSTM1-11R1 (5-CGGGGGATGCTTTGAATA CTGG-3) for exon 11 primes (Figures 1c and d).
To identify the chromosomal breakpoints, genomic DNA was amplied by the long-and-accurate PCR method using LA Taq polymerase (Takara Bio). The following primers were used: FGFR1-7F1 and FGFR1-7F2 (5-TCTGCATGGTTGACCGTTCTG-3) for exon 7 outer and inner; FGFR1-10R1 and FGFR1-10R2 for exon 10 outer and inner; SQSTM1-9F1 (5-GATATCGATGTGGAGCACGGAGGG-3),
SQSTM1-9F2 (5-CTCCAGAGAGTTCCAGCACAGAGG-3) for exon 9 outer and inner; and SQSTM1-10R1 (5-TGTGGGTACAAGGC AGCTTCC-3), SQSTM1-10R2 (5-CTTGGCCCTTCGGATTCTGGC-3) for exon 10 outer and inner, respectively. Genomic fragments corresponding to the der(5) and der(8) chromosomes were amplied by primers around the predicted breakpoints on both chromosomes (Figures 1e and f). The sequence analysis of the PCR products identied the chromosome 5 and 8 breakpoints within SQSTM1 intron 9 and FGFR1 intron 9, respectively (data not shown).
As sequence databases contain alternative transcripts for SQSTM1 coding N-terminal truncated protein (NCBI Reference Sequence: NM_001142298.1 and NM_00114299.1), we performed RT-PCR using primers located in SQSTM1 alternative exons 1, 2 or 4 and FGFR1 exon 9 and detected only a chimeric transcript from SQSTM1 exon 4 coding the full N-terminal end of SQSTM1 (data not shown).
SQSTM1 at chromosome 5q35 encodes a multifunctional protein that binds ubiquitin and regulates activation of the NF-kB signaling pathway, associating with oxidative stress and autophagy.69 Mutations in this gene were reported to cause Paget disease of bone.10 The SQSTM1-FGFR1 transcript encodes a predicted chimeric protein of 718 amino acids, containing the N-terminal protein-protein interaction domain, PB1, of SQSTM1 (ref. 11) and the tyrosine kinase domain of FGFR1 (Figure 2). SQSTM1-FGFR1 may induce the constitutive activation of tyrosine kinase by PB1-mediated dimerization, thus leading to the cellular transformation.
Recently, the generation of SQSTM1-NUP214 and SQSTM1-ALK fusion genes were reported in one case with adult T-cell acute lymphoblastic leukemia presenting t(5;9)(q35;q34) translocation and two cases with anaplastic lymphoma kinase (ALK)-positive large B-cell lymphoma, respectively.1214 SQSMT1-ALK was shown to possess transforming activity in 3T3 broblasts, probably by the constitutive activation of ALK tyrosine kinase by PB1-mediated
Letter to the Editor
2
SQSTM1 exon 9
TTGGAGTCCGAGGGGCGCCCTGAG L E S E G R P E
FGFR1 exon 8
FGFR1 exon 9
GTGTCTGCTGACTCCAGTGCATCC
SQSTM1 exon 10
GAACAGATGGAGTCGGATAACTGT
ATCCCTCTGCGCAGACAGGTAACA
I P L R R Q V T
V S A D S S A S
E Q M E S D N C
C P
C P
C P
(kb)
2.0
23
9.46.74.32.2
der(8)
8.8kb
FGFR1-SQSTM1
SQSTM1 FGFR1
-
8p11
exon 7 8 9 10
10
2.4kb
C P
FGFR1
BamHI
HindIII
exon 8
9
9 10
der(5)
SQSTM1-FGFR1
FGFR1-SQSTM1 GAPDH
C P C P
C P
exon 7 8
10
(bp)
612 495
1057
770
341
5q35
9
SQSTM1
exon 8
Figure 1. Cytogenetic and molecular analysis. (a) Partial karyotyping of patients bone marrow cells. The derivative chromosome 5 and 8 are shown by arrows. (b) Southern blot analysis, presenting rearrangement within FGFR1 gene. Arrows indicate the abnormal bands. (c) RT-PCR detection of the fusion transcripts in the patient. (d) Partial sequence of SQSTM1-FGFR1 and reciprocal FGFR1-SQSTM1 fusion cDNA. The amino-acid translations spanning the fusion are shown under the sequence. (e) Detection of der(5) and der(8) chromosomes in the patients leukemic cells. Amplied genomic DNA fragments from the patients sample are indicated by arrows. (f) Genomic organization of FGFR1 and SQSTM1, encompassing the breakpoints. Horizontal arrows indicate primers used in PCR. Lanes C and P represent normal control and the patients sample, respectively.
FGFR1
SQSTM1
SQSTM1-FGFR1
ZZ finger domain
TRAF6 binding domain
Ig-like domain
Transmembrane domain
Tyrosine kinase domain
PEST
PB1 domain
Figure 2. Schematic representation of FGFR1, SQSTM1 and the predicted SQSTM1-FGFR1 fusion protein. Relevant protein domains are shown. The breakpoints within proteins are indicated by arrows.
UBA (Ub-associated domain)
dimerization.13 To our knowledge, our case is the third instance of hematologic malignancy, in which SQSTM1 was involved in chromosomal translocation. SQSTM1 may be a recurrent target of chromosomal aberration.
Our patient, diagnosed as acute myelomonocytic leukemia, lacked typical EMS features, such as myeloproliferation,
eosinophilia or lymphadenopathy involved by T-cell proliferation. Multilinage dysplasia indicated the leukemic transformation at early myeloid precursor level, but involvement of the T-cell lineage was not determined. SQSTM1-FGFR1 and/or reciprocal FGFR1-SQSTM1 fusion gene may exert to promote proliferation of immature myelomonocytic cells preferentially. Further investigation is needed to clarify this point.
CONFLICT OF INTEREST
The authors declare no conict of interest.
Y Nakamura, Y Ito, N Wakimoto, E Kakegawa, Y Uchida and M Bessho
Department of Hematology, Saitama Medical University, Saitama, Japan E-mail: mailto:[email protected]
Web End [email protected]
REFERENCES
1 Swerdlow SH, Campo E, Harris NL, Jaffe ES, Pileri SA, Stein H et al. WHO
Classication of Tumours of Haematopoetic and Lymphoid Tissues. IARC: Lyon, 2008.2 Jackson CC, Medeiros LJ, Miranda RN. 8p11 myeloproliferative syndrome: a review. Hum Pathol 2010; 41: 461476.3 Wasag B, Lierman E, Meeus P, Cools J, Vandenberghe P. The kinase inhibitor TKI258 is active against the novel CUX-FGFR1 fusion detected in a patient with
Blood Cancer Journal
Letter to the Editor
3
T-lymphoblastic leukemia/lymphoma and t(7;8)(q22;p11). Haematologica 2011; 96: 922926.4 Li F, Zhai Y-P, Tang Y-M, Wang L-P, Wan P-J. Identication of a novel partner gene, TPR, fused to FGFR1 in 8p11 myeloproliferative syndrome. Gene Chromosome Cancer 2012; 51: 890897.5 Gervais C, Dano L, Perrusson N, Helias C, Jeandidier E, Galoisy A-C et al. A translocation t(2;8)(q12;p11) fuses FGFR1 to a novel partner gene, RANBP2/ NUP358, in a myeloproliferative/myelodysplastic neoplasm. Leukemia 2013; 27: 11861188.6 Geetha T, Wooten MW. Structure and functional properties of the ubiquitin binding protein p62. FEBS Lett 2002; 512: 1924.7 Seibenhener ML, Geetha T, Wooten MW. Sequestosome 1/p62more than a scaffold. FEBS Lett 2007; 581: 175179.8 Kirkin V, McEwan DG, Novak I, Dikic I. A role for ubiquitin in selective autophagy. Mol Cell 2009; 34: 259269.9 Komatsu M, Kurokawa H, Waguri S, Taguchi K, Kobayashi A, Ichimura Y et al. The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat Cell Biol 2010; 12: 213223.10 Laurin N, Brown JP, Morissette J, Raymond V. Recurrent mutation of the gene encoding sequestosome 1 (SQSTM1/p62) in Paget disease of bone. Am J Hum Genet 2002; 70: 15821588.
11 Wilson MI, Gill DJ, Perisic O, Quinn MT, Williams RL. PB1 domain-mediated heterodimerization in NADPH oxidase and signaling complexes of atypical protein kinase C with Par6 and p62. Mol Cell 2003; 12: 3950.
12 Gorello P, Starza RL, Giacomo DD, Messina M, Puzzolo MC, Crescenzi B et al. SQSTM1-NUP214: a new gene fusion in adult T-cell acute lymphoblastic leukemia. Haematologica 2010; 95: 21612163.
13 Takeuchi K, Soda M, Togashi Y, Ota Y, Sekiguchi Y, Hatano S et al. Identication of a novel fusion, SQSTM1-ALK, in ALK-positive large B-cell lymphoma. Haematologica 2011; 96: 464467.
14 dAmore ES, Visco C, Menin A, Famengo B, Bonvini P, Lazzari E. STAT3 pathway is activated in ALK-positive large B-cell lymphoma carrying SQSTM1-ALK rearrangement and provides a possible therapeutic target. Am J Surg Pathol 2013; 37: 780786.
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
Web End =http://creativecommons. http://creativecommons.org/licenses/by/4.0/
Web End =org/licenses/by/4.0/
Blood Cancer Journal
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright Nature Publishing Group Dec 2014




