Citation: Cell Death and Disease (2010) e89; doi:http://dx.doi.org/10.1038/cddis.2010.65
Web End =10.1038/cddis.2010.65
& 2010 Macmillan Publishers Limited All rights reserved 2041-4889/10 http://www.nature.com/cddis
Web End =www.nature.com/cddis
Characterization of a caspase-3-substrate kinome using an N- and C-terminally tagged protein kinase library produced by a cell-free system
D Tadokoro1, S Takahama2, K Shimizu1, S Hayashi1, Y Endo*,1,2,3 and T Sawasaki*,1,2,3
Caspase-3 (CASP3) cleaves many proteins including protein kinases (PKs). Understanding the relationship(s) between CASP3 and its PK substrates is necessary to delineate the apoptosis signaling cascades that are controlled by CASP3 activity. We report herein the characterization of a CASP3-substrate kinome using a simple cell-free system to synthesize a library that contained 304 PKs tagged at their N- and C-termini (NCtagged PKs) and a luminescence assay to report CASP3 cleavage events. Forty-three PKs, including 30 newly identied PKs, were found to be CASP3 substrates, and 28 cleavage sites in 23 PKs were determined. Interestingly, 16 out of the 23 PKs have cleavage sites within 60 residues of their N- or C-termini. Furthermore, 29 of the PKs were cleaved in apoptotic cells, including ve that were cleaved near their termini in vitro. In total, approximately 14% of the PKs tested were CASP3 substrates, suggesting that CASP3 cleavage of PKs may be a signature event in apoptotic-signaling cascades. This proteolytic assay method would identify other protease substrates.
Cell Death and Disease (2010) 1, e89; doi:http://dx.doi.org/10.1038/cddis.2010.65
Web End =10.1038/cddis.2010.65 ; published online 28 October 2010
Subject Category: Immunity
On the basis of the corresponding genetic sequences, 4500 human and mouse proteolytic enzymes have been predicted.1 This number is comparable with that found for protein kinases (PKs), which are the main signal-transduction enzymes.2,3
Proteases are involved in the maturation, localization, stabilization, and complex formation of proteins, and in many biological processes, for example, normal development,4,5
cancer,6,7 infectious diseases,8 and cell death.9 Therefore, it is important to be able to identify protease substrates using simple assays.
Apoptosis requires the action of many different proteins that participate in apoptotic cell-signaling pathways.10 Caspases and PKs are critical components of growth and apoptosis signaling pathways.2,10 Large-scale analyses of the biological networks involving PKs and caspases are vital for the elucidation of apoptosis signaling pathways. Recent whole-cell proteomic studies that used mass spectrometry attempted to identify substrates of caspases that are involved in apoptosis and have shown that the percentage of PKs found as caspase substrates during apoptosis is 36% of B300.11,12 However,
cellular protein expression levels may have biased the results.13 Furthermore, it is difcult to identify specic pairs of proteases and substrates because numerous cleavage events occur simultaneously in cells. Therefore, an in vitro approach that could identify specic proteases and their corresponding substrates would complement cell-based approaches. A diagram, derived from a comprehensive in vitro study, that illustrates the relationships between
caspases and their PK substrates would help clarify the signal-transduction events that occur during apoptosis.
A collection of recombinant proteins, that is, a protein library, is needed to screen a large number of protein substrates. In addition, to screen a protein library comprehensively two in vitro high-throughput methods one for protein synthesis and one for the detection of the targeted biochemical reaction are required. Recently, we developed an automated protein synthesis system that uses a wheat cell-free system.1416 Using this system, we were able to
synthesize many human and Arabidopsis PKs.17,18 Recent
work by others suggested that the wheat cell-free system could produce 13 364 human proteins, which, because of the large number of proteins involved, represents an in vitro-expressed proteome.19 We also recently developed a method to label monobiotin proteins that had been synthesized in the wheat cell-free system.20 These monobiotin-labeled proteins were then used directly without purication to detect protein ubiquitination21 and an autoantibody in the serum.22 As the procedures used with many commercially available detection kits depend on biotinstreptavidin interactions, our purication-free, synthesis/biotin-labeling method provides a simple and highly specic system that can be used for biochemical analyses.
Caspase-3 (CASP3) cleaves many different proteins,23,24
and its action in vivo irreversibly induces apoptosis. For the study reported herein, we delineated a CASP3-substrate kinome using a simple luminescent-based detection method
1Cell-Free Science and Technology Research Center, Ehime University, Matsuyama, Ehime, Japan; 2The Venture Business Laboratory, Ehime University, Matsuyama, Ehime, Japan and 3RIKEN Genomic Sciences Center, Tsurumi, Yokohama, Japan*Corresponding authors: T Sawasaki or Y Endo, Cell-Free Science and Technology Research Center, Ehime University, 3 Bunkyo-cho, Matsuyama, Ehime 790-8577, Japan. Tel: 81 89 927 8530; Fax: 81 89 927 9941; E-mail: mailto:[email protected]
Web End [email protected] or Tel: 81 89 927 9936; Fax: 81 89 927 9941;
E-mail: mailto:[email protected]
Web End [email protected] Keywords: caspase; protein kinases; apoptosis; cell-free protein synthesis; protein libraryAbbreviations: CASP3, caspase 3; PK, protein kinase; NCtagged, N- and C-terminally tagged; TD, terminal detection
Received 10.6.10; revised 31.8.10; accepted 15.9.10; Edited by A Finazzi-Agr
Characterization of caspase-3-substrate kinome
D Tadokoro et al
2
to screen an N- and C-terminally tagged (NCtagged) PK library produced in the wheat cell-free system. This comprehensive characterization of a CASP3-substrate kinome is a resource that can be used to understand the roles of PKs in apoptosis.
Results
Generation of an NCtagged PK library used to identify CASP3 PK substrates. To identify PKs that are substrates of CASP3, we rst made a library consisting of 248 human and 56 mouse PKs (Supplementary Table S1). The nucleotide sequences for the Flag-tag and the biotin ligation site (bls) were added upstream and downstream, respectively, of the PK open-reading frame by PCR incorporation of Gateway recombination tags. Each PCR product (attB1-Flag-PK-bls-attB2) was inserted into a pDONR221 vector using the Gateway BP Clonase II system (upper panel, Figure 1). The Flag-PK-bls nucleotide sequences from the Escherichia coli cultures were used without purication to construct, by split-primer PCR, the DNA templates for protein synthesis.14 The
NCtagged PK library (304 PKs) was produced using an automated protein synthesizer (GenDecoder 1000; CellFree Sciences Co., Ltd., Matsuyama, Japan), with biotin and biotin ligase added into the synthesis mixtures for monobiotin labeling at the bls.20,21 That the members of the protein
library were NCtagged was conrmed by immunoblotting with anti-Flag antibodies and Alexa488-labeled streptavidin.
To assess the suitability of the designed PKs to act as CASP3 substrates, we used NCtagged p21-activated kinase 2 (PAK2), which is a known CASP3 substrate,25 as
the test case. The biotinylated NCtagged-PAK2 (Flag-PAK2-blsBbiotin) was treated with CASP3 and cleavage of PAK2 was conrmed by immunoblotting with Alexa488-conjugated streptavidin (Figure 2a). In addition, the cleavage site (319DELDkS323), determined by amino-acid sequencing, was found to be the same as that reported previously.25
(The arrow indicates the hydrolytic bond.)
A luminescent assay to detect PK substrates of CASP3. A schematic of the assay used to monitor cleavage of the NCtagged PKs by CASP3 is shown in Figure 1. The PK construct is rst incubated with CASP3. If the construct contains a sequence that can be cleaved by CASP3, cleavage occurs. Acceptor and donor beads are then added. The Flag-tag binds a protein A-conjugated acceptor bead via an anti-Flag antibody, and the biotin bound to the C-terminus of the PK construct binds a streptavidinconjugated donor bead. If an acceptor bead is in close contact with the donor bead, as is the case when the construct is not a CASP3 substrate and both beads are therefore bound intramolecularly, the system luminesces. However, if CASP3 had cleaved the NCtagged PK, luminescence is suppressed because the beads are no longer in close contact. As a proof-of-concept experiment, cleavage of the test PK, NCtagged PAK2, was assessed
Flag
biotin ligation site (bls)
Split-PCR
SP6 E02
PK gene
PK gene
PK gene
pDONR-Flag-PK-bls
PCR Gateway
MGC clones (human) FANTOM (mouse)
In House Clone Library(human)
DNA template (SP6-E02-Flag-PK-bls)
Low
High
Cleavage
Non-cleavage
P K P K
PK
Biotin
Flag-PK-bls~biotin
Caspase 3
Luminescent signal
NCtagged PK library
Protein A conjugated acceptor beads
anti-Flag monoclonal antibody
Fluorescence 520 ~ 620 nm
102
Wheat cell-free Protein synthesis
PK
PK
Streptavidin-coated donor beads
Figure 1 Schematics of the DNA template construction and the CASP3-substrate-screening assay. Protein kinase (PK) genes were obtained from the human MGC and mouse FANTOM libraries, and from a library of PK genes that we had cloned. The PK genes were PCR amplied with the Flag and the biotin ligation site (bls) tags added to the upstream and downstream ends, respectively. The modied genes were each inserted into a Gateway pDONR221 vector (pDONR-Flag-PK-bls) and DNA templates (SP6-E02-Flag-PK-bls) were constructed by split-primer PCR and then expressed in the wheat cell-free protein synthesis system that included biotin ligase and D-biotin to give Flag-PK-blsBbiotin constructs. The Flag and biotin tags were bound to protein A-conjugated acceptor beads via an anti-Flag antibody and streptavidin-conjugated donor beads, respectively. An intact complex luminesced strongly, whereas after CASP3 cleavage and dissociation of the protein fragments, the luminescence was abolished or reduced
Cell Death and Disease
Characterization of caspase-3-substrate kinome
D Tadokoro et al
3
STA (C)
+
CASP3 kDa
100
0
100
Luminescent signal (%)
CASP3 +
80
60
40
20
Luminescent signal (%)
60
40
30
50
19%
NCtagged PK
Luminescent signal (%)
100
0
80
60
40
20
STK4
MNK2
MARK1
BUBR1
PRKX
PKN2
LIMK1
ROCK1
PAK2
STK3
BMPR1B
DCAMKL1
Nuak2
IRAK2
RIOK3 MAP2K6
PCTAIRE1
CSK
DYRK3
PRKC1
RIOK1
PIM2
DCAMKL2
PDK1 CaMKK1
FAK CK1g1
AKT2
RIPK3
p70s6k
MASTL
PKCt
A6
NSK1 TGFbR1
BMX
ALK2
Trb3
AMPKa1
p38g
ULK4
HSPB8
eEF2K
NCtagged PK
Figure 2 Screening of CASP3-cleaved PK substrates from the NCtagged PK library. (a) Immunoblot of NCtagged PAK2 that had been incubated in the presence ( ) or
absence ( ) of CASP3. Alexa488-labeled streptavidin (STA(C)) was used for detection. (b) Detection of CASP3-cleaved NCtagged PAK2 using the AlphaScreen system.
The luminescence for the control (no CASP3) was set to 100%. The value of 19% indicated that most of the NCtagged PAK2 was cleaved by CASP3. Each value is the mean of three independent experiments, and the uncertainty is reported as the standard deviation. (c) Luminescent signals remaining after in vitro CASP3 treatment of NCtagged PKs that had been synthesized in the wheat cell-free system. The x axis lists the NCtagged PKs in ascending order of their luminescent signals after CASP3 treatment. (d) NCtagged PKs that returned luminescent signals of o78% of the control values. The plot contains the data of (c) within the green rectangle. Red bars are for PKs that were known to be substrates of CASP3 before this report
using this system. CASP3 treatment decreased the luminescent signal to 197% that of the control (no CASP3; Figure 2b). Therefore, the system could detect CASP3 cleavage and can replace conventional immunoblotting procedures.
Screening of the CASP3-substrate kinome. Using the luminescent system, 304 NCtagged PKs were screened. The level of luminescence after CASP3 treatment is reported as the percentage of the corresponding control (no CASP3; Figure 2c and d). Thirteen of the NCtagged PKs for which luminescence was low after CASP3 treatment are known CASP3 substrates.23,24,26 The smallest and largest
luminescent values were for STK4 (1%) and BMX (73%), respectively; we therefore examined the physical states of the PKs that had been treated with CASP3 and had associated luminescence values of B80% by immuno-blotting with anti-Flag antibodies and Alexa488-streptavidin to detect the N- and C-termini of the NCtagged PKs, respectively. This terminal detection (TD) immunoblot assay identied 43 NCtagged PKs that had been cleaved (Supplementary Table S1). In addition to the 13 PKs that were known to be CASP3 substrates, 30 previously unidentied PK that were substrates of CASP3 were found (Figure 3 and Table 1). In addition, because the apparent molecular weights of the N- and C-terminal fragments could be estimated from their positions in the TD immunoblot, the
CASP3 cleavage sites could be predicted (red arrowheads, Figure 3). For MASTL, the signal on the immunoblot with Alexa488-conjugated streptavidin was not detectable, probably indicating that the efciency of biotinylation in MASTL proteins might be too low to detect for the immunoblot. Luminescent signal of this clone was also very low (see Supplementary Table S1).
A comparison of the luminescent and immunoblot data correlated a luminescent signal of o78% with a positive immunoblot result. Forty-eight PK constructs with lumines-cent signals 478% were tested and returned negative immunoblot results (Supplementary Table S1). Therefore, a luminescent signal of B78% is the apparent divisor between
PKs that can be cleaved by CASP3 and those that cannot be cleaved.
In vivo identication of the PKs that were identied as CASP3 substrates by the luminescent assay. We investigated whether the newly identied PKs that were substrates of CASP3 were cleaved in HeLa cells that had been induced to undergo apoptosis by TNFa plus cycloheximide (TNFa)27 or anti-Fas antibody (anti-Fas).28
The genes encoding these PKs were each inserted into the transfection vector, pDEST26, using the Gateway system and expressed as (His)6-PK-Flag constructs. We were able to detect all expressed PK constructs, except DYRK3, by immunoblotting with anti-(His)6 or anti-Flag antibodies.
Cell Death and Disease
Characterization of caspase-3-substrate kinome D Tadokoro et al
4
Figure 3 In vitro cleavage of NCtagged PKs by CASP3. The NCtagged PKs that had been incubated in the presence ( ) or absence ( ) of CASP3 and their cleavage
products were detected using anti-Flag antibodies (FLAG(N)) and Alexa488-conjugated streptavidin (STA(C)), which bound to the N- and C-termini of the PK constructs, respectively. The cartoons of the proteins that are under the lanes show the locations of the conserved domains (colored boxes) and the predicted cleavage sites (red arrowheads). The conserved domains that are found in the Conserved Domains Database (http://www.ncbi.nlm.nih.gov/cdd) are: ACD, alpha-crystallin domain; activin, conserved domain for activin members; ADF, actin depolymerization factor/colin-like domain; a-kinase, conserved kinase domain for the a-kinase family; C1, phorbol esters/
diacylglycerol binding domain; DCX, doublecortin domain; death, death domain; GS, GS motif; KA1, kinase-associated domain; kinase, catalytic domain of protein kinase; PB1, Phox and Bem1p domain; PH, pleckstrin homology domain; RIO, catalytic domain of eukaryotic RIO kinase family; SH2, src homology 2 domain; SH3, src homology 3 domain; UBL, ubiquitin-like domain
Notably, they were detected as cleavage products and/or were found in smaller amounts when the cells had been induced to undergo apoptosis than when apoptosis had been inhibited by z-VAD-FMK (Figure 4a and b). Furthermore, apoptosis-induced cleavage of four endogenous PKs was found by immunoblotting with commercially available antibodies against the endogenous PKs (Figure 4c). These in vivo experiments validated the underlying concept of our in vitro cell-free system as the in vivo system found all of the PKs identied by the in vitro system.
Characterization of the CASP3 cleavage sites in the newly identied PK substrates. We characterized the CASP3 cleavage sites in the newly identied PK substrates. As the positions of the cleaved PK fragments in the TD immunoblot could be used to estimate the size of the cleaved fragments and because the antibodies could be
used to identify whether the fragments were derived from the N- or C-terminal regions of the PKs, we could predict the approximate positions of the CASP3 cleavage sites (red arrowheads, Figure 3). Each NCtagged PK that was a substrate for CASP3 was synthesized in the cell-free system and puried using Streptavidin Magnesphere Paramagnetic beads. Their C-terminal fragments that bound to the beads were recovered after CASP3 cleavage and their sequences were determined. Using this approach, the cleavage sites of ACVR1, AKT2, BMPR1B, CaMKK1, HSPB8, MAPK12, MKNK2(D58), PDPK1, PRKCI, PRKX, RIOK1, RIOK3, and RPS6KA5 were determined. We then attempted to determine the cleavage sites of the remaining PKs by other methods.
The NCtagged PKs that had low biotin-labeling efciencies and were cleaved near their C-termini were genetically modied by the addition of a glutathione-S-transferase (GST) fragment at their C-termini to facilitate recovery with
Cell Death and Disease
Characterization of caspase-3-substrate kinome
D Tadokoro et al
5
Table 1 Characteristics of the newly identied CASP3 PK substrates
Symbols Kinome names
Groups Clone origin
AAa Cleavage sequence
Cleavage sites
In vivo cleavagese
ACVR1 ALK2 TKL Hs 509 IASDkM 269 NT Yes C240 Yes AKT2 AKT2 AGC Mm 481 DAMDkY 121 NT Yes N121 Yes BMPR1B ALK6 TKL Hs 502 CSTDkG 50 NT Yes N50 Yes
DFVDkG 120 NT YesCaMKK1 CaMKK1 Other Hs 520 EEADkG 32 NT Yes N32 Yes CSK CSK TK Mm 450 DAPDkG 409 MS Yes C41 Yes CSNK1G1 CK1g1 CK1 Mm 459 VHVDkS 343 MU Yes C116 Yes eEF2K eEF2K Atypical Hs 725 EGVDkG 14 MU Yes N14 Yes
DHLDkN 430 MU YesHSPB8 H11 Atypical Hs 196 MADkG 3 NT Yes N3 Yes MAP2K6 MAP2K6 STE Mm 334 DFVDkF 289 MU Yes C45 Yes MAPK12 p38g CMGC Hs 367 SAVDkG 46 NT Yes N46 Yes MARK1 MARK1 CAMK Hs 795 SATDkE 52 MU Yes N52 Yes MKNK2 MNK2 CAMK Hs 414 DQPDkH 32 MU No N32 Yes
DIPDkA 58 NT YesPDPK1 PDK1 AGC Hs 556 SHPDkA 552 NT Yes C4 Yes PIM2 PIM2 CAMK Hs 334 TDFDkG 198 MU Yes C113 Yes PRKAA1 AMPKa1 CAMK Hs 550 TSLDkS 520 MS Yes C30 Yes PRKCI aPKCi PKC Hs 596 TQRDkS 6 NT Yes N6 Yes PRKX PRKX AGC Hs 358 ETPDkG 25 NT No N25 Yes RIOK1 RIOK1 Atypical Mm 568 EKDDkI 37 NT Yes N37 Yes RIOK3 RIOK3 Atypical Hs 516 DTRDkD 139 NT Yes N139 Yes RPS6KA5 MSK1 AGC Hs 549 DGGDkG 20 NT Yes N20 Yes
DELDkV 344 NT YesTEMDkP 356 NT YesSNARK NuaK2 CAMK Hs 628 VSEDkS 546 MU Yes C82 Yes TRIB3 TRB3 CAMK Hs 358 VVPDkG 338 NT Yes C20 Yes ULK4 ULK4 Other Hs 580 SQIDkS 473 MU Yes C107 Yes DCAMKL2 DCAMKL2 CAMK Hs 695 Yes DYRK3 DYRK3 CMGC Hs 568 ND IRAK2 IRAK2 TKL Mm 622 Yes MASTL MASTL AGC Hs 879 Yes PCTK1 PCTAIRE1 CMGC Hs 496 Yes PTK9 A6 Atypical Hs 384 Yes TGFBR1 TGFBR1 TKL Hs 426 Yes
Abbreviations: Hs, human clone; Mm, mouse clone; MS, mass spectroscopy; MU, mutation; ND, not determined; NT, N-terminal sequencing. aLength of amino acids.
bMethods for determination of cleavage site. cVery similar site conserving the Asp (D) of the hydrolytic bond was found between human and mouse PKs (Yes), whereas no similar sites was done (No). dThe smallest N (N) or C (C) fragment in the cleaved PKs. Number is the length of amino acids of the fragment. eData from Figure 4.
Methodsb Conservationc Smallest frag.d
glutathione Sepharose 4B beads after CASP3 cleavage. CASP3 cleavage of the PK-GSTs produced the same size N-terminal fragments as those of the corresponding CASP3-cleaved NCtagged PKs, indicating that the GST tags did not alter the positions of the cleavage sites. In addition, the sequences of the cleaved c-src tyrosine kinase (CSK) and AMP-activated kinase-a1 (AMPKa1) fragments were determined using MALDI/TOF-MS. Other PK constructs that were synthesized in small amounts were subjected to D-A mutagenesis to determine their cleavage sites. In total, 28 cleavage sites in 23 PKs were identied (Table 1). Identical or similar cleavage sites were found in the corresponding human and mouse PKs, except for those of PRKX (Supplementary Table S2). (Sequence analysis showed that mouse PRKX does not have the N-terminal region that is found in human PRKX.) Therefore, the CASP3-substrate kinome may be highly conserved in mammals.
We also analyzed the common sequence attributes among the 28 cleavage sites and found that CASP3 prefers the sequence, DXXDkG (Figure 5a). The consensus PK cleavage site for CASP3 in the MEROPS database is DXXDkX. In the NCtagged PK library, 208 of the 304 PKs contain a DXXDX sequence. However, only 33 PKs were
cleaved by CASP3; therefore, to be cleaved by CASP3, the DXXDX sequence and a structural element probably accessibility are required.
Characterization of the newly identied PKs that were cleaved near their N- or C-termini. Interestingly, 16 out of the 23 PKs, for which cleavage sites were characterized, have cleavage sites within 60 residues of their N- or C-termini. We investigated whether these sites were also cleaved in vivo when apoptosis was induced by TNFa.
For these experiments, CaMKK1, eEF2K, MNK2, AMPKa1, and TRIB3, which were cleaved in vitro at D32, D14, D32/ D58, D520 (30 residues away from the C-terminus), and D338 (20 residues away from the C-terminus), respectively, were used (Figure 5b and Table 1). Their genes (wild type, WT) were each reconstructed with a V5 tag added at the end opposite the cleavage site. The genes for their D-A mutants (DA), and for the sequences of their longer CASP3-cleaved fragments (C3M), were also constructed and all were expressed in control and in apoptotic cells (Figure 5c). Cleavage of the WT PKs produced long fragments corresponding to C3M in apoptotic cells, whereas z-VADFMK blocked cleavage. These cleavages near the N- and
Cell Death and Disease
Characterization of caspase-3-substrate kinome
D Tadokoro et al
6
TNF TNF
z-VAD-FMK
+ +
+
+
+
+
z-VAD-FMK
ACVR1
(ALK2)
HSPB8 (H11)
PCTAIRE1
PTK9
(A6)
RPS6KA5 (MSK1)
Anti-Fas z-VAD-FMK
TNF z-VAD-FMK
+
+ +
AKT2
CSK
PDK1
SNARK (NuaK2)
TRIB3
(Trb3)
BMPR1B (ALK6)
MASTL
PRKAA1 (AMPKa1)
RPS6KA5 (MSK1)
ULK4
PIM2
TGFbR1
CaMKK1
PRKCI (aPKCi)
RIOK3
PRKX
-Tublin
CSNK1G1 (CK1g1)
-Tublin
DCAMKL2
eEF2K
IRAK2
+
RIOK1
ULK4
+
+
AKT2
AMPK1
TGFbR1
MAP2K6
MKNK2 (MNK2)
eEF2K
MAPK12 (p38g)
TGFbR1
MARK1
-Tublin
Figure 4 In vivo caspase cleavage of the newly identied PK substrates and of endogenous PK substrates. (a) In vivo cleavage of the (His)6-PK-Flag constructs expressed in apoptotic HeLa cells. The cells were treated with DMSO (control) or with TNFa and cycloheximide (TNFa) in the presence and absence of z-VAD-FMK (a CASP3 inhibitor)
for 6 h and then lysed. The cell extracts were immunoblotted and the PK constructs were detected with anti-Flag antibodies, except for HSPB8 and MAP2K6. Anti-His tag antibody was used for the two PKs. (b) The cells were transfected with a plasmid of (His)6-PK-Flag constructs, and treated with DMSO (control), or with anti-Fas antibody (anti-Fas) in the presence and absence of z-VAD-FMK for 6 h and then lysed. Immunoblotting was carried out as (a). (c) HeLa cells were treated as in (a), but were not transfected with a (His)6-PK-Flag gene. Each endogenous PK was detected using an antibody specic for it. a-Tubulin was used as an internal marker
+ +
+
+
P10 P1 P10'
M
TNF z-VAD-FMK
WT DA C3M
+
+
CaMKK1-V5
V5-AMPKa1
D32
D14
D58
CaMKK1-V5
MNK2-V5
V5-TRB3
DA C3M
A
eEF2K-V5
-tubulin
Alpha kinase
eEF2K-V5
N
DA C3M
A
MNK2-V5
V5-TRB3
M
D32
DA C3M
A
M
D520
D338
V5
V5
V5
V5-AMPKa1
Kinase domain
V5
V5
DA C3M
A
DA C3M
A
Figure 5 The cleavage site logo and in vivo cleavage of ve PKs that are cleaved by CASP3 near their N- or C-termini. (a) The 20 residues surrounding the D of the hydrolytic bond in 28 PKs were analyzed using WebLogo, version 3.0.36 (b) Cartoons of ve PK sequences that have cleavage sites near their N- or C-termini. The corresponding PKs were used for the experiment shown in (c). The positions of the alanines in the D-A mutants (DA) are shown, as are the long fragments (C3M) produced by CASP3 cleavage. V5 tags were fused at the ends farther away from the cleavage sites. The rst M in C3M of CaMKK1, eEF2K, and MNK2 indicates a methionine as a start amino acid. (c) Immunoblots of PK-V5s and V5-PKs that had been expressed in apoptotic HeLa cells. The cells were treated with DMSO (control) or with TNFa and cycloheximide in the presence or absence of z-VAD-FMK for 6 h and then lysed. The proteins were blotted and then detected with anti-V5 antibodies. WT indicates a wild-type protein
Cell Death and Disease
Characterization of caspase-3-substrate kinome
D Tadokoro et al
7
Table 2 Characteristics of the protein kinases used in this study
Groups Totala Tested clones
Cleaved clones (newb)
C-termini of the PKs suggest that CASP3 cleavage may regulate the activity level and/or cellular localization of the PKs, rather than simply inactivate the kinases.
Discussion
In 1995, PITSLRE,29 PKCd,30 and DNA-PKcs31 were reported as the rst PK-type substrates of CASP3. During the next 15 years, 36 additional PKs that can be cleaved by CASP3 were found.23,24,26 Notably, these authors showed that
CASP3-cleaved PKs abrogate survival signals and accelerate apoptosis. In this study, we identied an additional 30 PKs that can be cleaved by CASP3. In addition, many of the cleavage sites were found in regulatory elements or in the regions near the N- and C-termini, rather than the kinase domain itself. Some of the newly identied CASP3-substrate PKs may be involved in apoptotic signal cascades. Sixteen PKs were shown to be cleaved in vitro near their N- or C-termini and at least ve of them were also cleaved near their N- or C-termini in apoptotic cells (Figure 5). Using standard immunoblotting, proteins that are cleaved into a large and a small fragment may be overlooked because the mobilities of the large fragment and the intact protein will be nearly identical. Most of the PKs that had been previously reported to be cleaved by CASP3 were identied because the cleaved fragments had very different molecular weights than did the intact PK and were therefore easily detected by SDS-PAGE. Consequently, cleavages near the termini may have been overlooked. Taken together, our results suggest that CASP3 cleavage of some of the members of the CASP3-substrate kinome alters the function of the PKs and thereby signals apoptosis.
For the study reported herein, 304 out of 518 known PKs, synthesized as NCtagged PKs, were subjected to the in vitro cleavage assay (Supplementary Table S1). The relative number of PKs that were cleaved was B14%. A total of 69 PKs that are CASP3 substrates are now known, which suggests that at least B13% of the PKs in the human kinome are targets of CASP3. As B200 PKs have yet be tested as
CASP3 substrates, an additional 26 PKs (13% of the 200) may be CASP3 substrates. The human genome contains 518 annotated PKs, which have been divided into 10 groups on the basis of their sequence homologies.3 Interestingly, the groups differ in terms of their susceptibilities to CASP3 cleavage (Table 2). Approximately 30% of the PKs in the AGC group are known CASP3 substrates, for example, AKT2, S6K, MSK, PKC, and PDK1. Many of the AGC-type PKs are commonly found in mammalian tissues,32 and their cleavage sites are located in their regulatory domains (Figure 4 and Table 1). Therefore, these abundant PKs may be activated when CASP3 cleaves them and then act as intracellular apoptosis signals. Conversely, CASP3 cleaved only a relatively small number (6B8%) of the PKs in the CMGC group, which includes the kinases of the CDK and CDKL families, and the tyrosine kinase groups. Therefore, most members of these groups may only act indirectly as apoptosis signals after CASP3 activation.
Such ROCK1 and MST1, certain caspase cleavage products, work as apoptosis signaling.23,24 In this study, we
found at least six new CASP3 cleavage products, derived from AKT2, CaMKK1, eEF2 K, MARK1, MNK2, and TRB3,
after 6 h from apoptosis induction (Figures 4 and 5). These cleavage products retain kinase domain, as in the case of ROCK1 and MST1. On the other hand, we could not detect any cleavage products from the other kinases in vivo. The reasons are not yet understood. However, recent proteomics approach has shown that the cleaved proteins displayed transient fragments in the apoptotic cells.12 Further analysis at multiple time points during the apoptotic cascade would be required for detection of the cleavage products from the remaining PKs.
For TRIB3, full-length TRIB3 (D338A) mutant was decreased in apoptotic condition (compared TNFa lane with TNFa plus z-VAD-FMK lane in Figure 5c). However, the mutant could not produce the CASP3 cleavage product found as the shorter form in TNFa lane of WT, indicating that the mutant was not cleaved by CASP3. The mutant was also not cleaved by CASP3 in vitro (data not shown). As TRIB3 has been known to receive proteasomal degradation,33 this
unexpected reduction of the mutant TRIB3 in the apoptotic cells may be the effects of cycloheximide and/or caspase-inhibitor treatment on TRIB3 degradation.
Proteases often modify the activities of their targeted protein substrates. Identication of the specic substrate that is cleaved by a protease is necessary if the functions of both the protease and its substrate are to be understood. Proteomic studies have used mass spectrometry to exhaustively identify cellular proteins that have been cleaved by proteases.11,12 However, it has been difcult to correlate specic proteases with their substrates because many proteases act at the same time in vivo.
Many full-length cDNAs derived from the genes of higher eukaryotes are available from many different sources. These cDNAs are potentially a great DNA template resource for in vitro syntheses of proteins. As a protein production system and for the functional analysis of proteins, the wheat cell-free system has many advantages: It can effectively use PCR-generated DNA templates.14 It is easily adapted to an automated system.15 It can be used to incorporate a single label into target proteins.20 Its synthesized proteins do not require purication before being assayed, and it has no detectable proteasome activity.21 In addition, the screening cost is very low (BUS$1/assay), which for our study translated to 10 cents to produce each NCtagged protein and
Cleaved/test clones (%)
AGC 63 33 10 (6) 30 CAMK 74 52 8 (7) 15 CK1 12 8 1 (1) 13 CMGC 61 39 3 (3) 8 Other 83 46 3 (2) 7 STE 47 25 4 (1) 16 TK 90 51 3 (1) 6 TKL 43 27 6 (4) 22 RGC 5 2 0 0 Atypicals 40 21 5 (5) 24 Total 518 304 43 (30) 14
aEach number is corresponding to human kinome. bNewly PK numbers found in this study.
Cell Death and Disease
Characterization of caspase-3-substrate kinome D Tadokoro et al
8
20 cents for the beads, CASP3, and disposable hardware used in one assay.
In summary, we showed that an NCtagged PK library synthesized in a cell-free system could be used to characterize a CASP3-substrate kinome. Analysis of the CASP3-cleavage sites indicated that CASP3 cleavage of PKs depends on both primary and tertiary structure. Almost all of the PK substrates that we identied in vitro were also identied in vivo. Systems similar to that used herein could be used to screen other protease substrates.
Materials and MethodsGeneral. The following procedures have been described:1416,2022,34 wheat
cell-free protein production; split-primer PCR synthesis of the DNA templates; parallel syntheses of mRNAs and their translated proteins; and measurements of the amounts of protein synthesized using densitometer scans of Coomassie brilliant blue-stained proteins or of radiolabeled proteins.
Construction of DNA templates for the expression of a PK protein library. The cloned genes encoding the PKs used in this study are listed in Supplementary Table S1. Their open-reading frames (without stop codons) were modied in two steps using PCR and the primers S1 (50-CCACCCACCAC
CACCAatg(n)16-30) and T1 (50-TCCAGCACTAGCTCCAGA(n)19-30) (lowercase letters indicate nucleotides of the gene) for the rst step, and the primers attB1-Flag-S1 (50-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGACTACAAG
GATGACGATGACAAGCTCCACCCACCACCACCAATG-30) and T1-bls-STOP-attB2-anti (50-GGGGACCACTTTGTACAAGAAAGCTGGGTTTATTCGTGCCACTC GATCTTCTGGGCCTCGAAGATGTCGTTCAGGCCGCTTCCAGCACTAGCTCCA GA-30) for the second step. The PCR-modied genes were each inserted into a pDONR221 vector using the Gateway BP Clonase II enzyme mix (Invitrogen, Carlsbad, CA, USA) to give pDONR-Flag-PK-bls vectors. Escherichia coli cells were transformed with these vectors and then cultured in wells of a 96-well plate that contained GYT medium (10% (v/v) glycerol, 0.125% (w/v) yeast extract, and 0.25% (w/v) tryptone) for 48 h without shaking. DNA templates for mRNA and protein expression were constructed using split-primer PCR14 in two steps. For the rst step, the pDONR221-Flag-PK-bls plasmids that had not been isolated from theE. coli cells, and the primers pDONR221-1st_4080 (50-ATCTTTTCTACGGGGT CTGA-30) and deSP6E02-Flag-S1 (50-GGTGACACTATAGAACTCACCTATCTC TCTACACAAAACATTTCCCTACATACAACTTTCAACTTCCTATTATGGACTACAA GGATGACGATGACAAGCTCCACCCACCACCACCAATG-30) were used, and for the second step, the amplied sequences of the rst step and the primers SPu (50-GGGTAGCATTTAGGTGACACT-30) and pDONR221-2nd_4035 (50-ACGTTAA
GGGATTTTGGTCA-30) were used to give SP6-E02-Flag-PK-bls DNA templates. (The E02 sequence is a translational enhancer,35 and the SP6 sequence is an SP6 RNA polymerase promoter.)
Cell-free protein synthesis. Cell-free protein synthesis used the reagents of an ENDEXT Wheat Germ Expression S Kit according to the manufacturers instructions (CellFree Sciences Co., Ltd.), the bilayer translation method,15,16,34 and
a robotic synthesizer (GenDecorder 1000; CellFree Sciences). Each DNA template was transcribed by SP6 RNA polymerase, then precipitated with ethanol, and collected by centrifugation (15 000 r.p.m. for 5 min., R10H rotor; Hitachi). Each mRNA (B3035 mg) was washed with 75% ethanol, added into a translation mixture, and translated in the bilayer mode31 with the following modications. The translation mixture (25 ml) (bottom layer) contained 60 A260/ml of ENDEXT wheat germ extract, 1 SUB-AMIX (24 mM Hepes-KOH, pH 7.8, 1.2 mM ATP, 0.25 mM GTP, 16 mM
creatine phosphate, 2.5 mM DTT, 0.4 mM spermidine, 0.3 mM each of the 20 amino acids, 2.8 mM magnesium acetate, 100 mM potassium acetate), 2 mg creatine kinase (Roche Applied Science, Indianapolis, IN, USA), 500 nM D-biotin (Nacalai Tesque,
Kyoto, Japan), and 1 ml of the wheat cell-free translational mixture that expressed BirA biotin ligase (B50 ng/ml, BirA: GenBank Accession No. NP_0312927). A 1 SUB
AMIX solution (125 ml) was placed over the translation mixture. The bilayer was incubated at 261C for 17 h to allow for protein synthesis. All steps including construction of the DNA templates were performed in the wells of a 96-well plate.
Cleavage assay. The cell-free-synthesized PKs that had luminescent signals 4500 units (in the absence of CASP3) were studied. For each PK, 10 ml of the
CASP3 cleavage buffer (20 mM Tris-HCl, pH 7.5, 0.2 mM DTT, 5 mM MgCl2, 3 mM ATP, 1 mg/ml BSA, 1 mU CASP3 (Sigma-Aldrich, St. Louis, MO, USA)) was mixed with 1 ml of the translation mixture that contained a Flag-PK-blsBbiotin construct, and the mixture was incubated at 301C for 2 h in a well of a 384-well Optiplate (Perkin Elmer, Foster City, CA, USA). Using the reagents of an AlphaScreen IgG (protein A) detection kit (Perkin Elmer) according to the manufacturers instructions, 15 ml of 20 mM Tris-HCl, pH 7.5, 0.2 mM DTT, 5 mM MgCl2, 5 mg/ml anti-FLAG M2 antibody (Sigma-Aldrich), 1 mg/ml BSA, 0.1 ml of streptavidin-coated donor beads and 0.1 ml of anti-IgG acceptor beads were added to the well. The solution was incubated at 231C for 1 h. Luminescence was analyzed using the AlphaScreen detection program (Perkin Elmer). All repetitive mechanical procedures were performed by a Biomek FX robotic workstation (Beckman Coulter, Fullerton, CA, USA). The value of a luminescent signal is reported as the mean of three independent measurements.
TD immunoblotting. A mixture of each Flag-PK-blsBbiotin construct (3 ml of a translation mixture) and 7 ml of the CASP3 cleavage solution was incubated at 301C for 1 h in a well of a 384-well Optiplate (Perkin Elmer). Then, the proteins were separated in SDS-PAGE gels and transferred to PVDF membranes (Millipore
Bedford, MA, USA). The blotted proteins were prepared for detection using the reagents of an ECL-Plus Western Blotting Detection System kit (GE Healthcare, Piscataway, NJ, USA), anti-Flag M2 antibodies (Sigma-Aldrich) for N-TD, and Alexa488-streptavidin (Invitrogen) for C-TD. The labeled proteins were visualized using a Typhoon Imager (GE Healthcare) with a 532-nm laser and a 526-nm emission lter or an ImageQuant LAS-4000 mini CCD camera system (Fujilm).
Sequencing and other purication procedures. When possible, long biotinylated C-terminal fragments produced by CASP3 cleavage were recovered attached to streptavidin beads, and then sequenced directly. When a PK construct had a low biotin-labeling efciency and was cleaved near its C-terminus, a new construct was made by fusing the GST nucleotide sequence encoded in the pEU-E01-Gateway-GST vector to the C-terminal codon of the corresponding PK open-reading frame using the Gateway system and the pEU-E01-Gateway-GST vector. For purication, synthesized PKs (1.2 ml) were puried using Streptavidin Magnesphere Paramagnetic beads (Promega Corp., Madison, WI, USA) for the Flag-PK-blsBbiotin constructs or glutathione Sepharose 4B (GE Healthcare) for the PK-GST constructs. After washing the beads with PBS, the bound PKs were incubated with CASP3 (15 ml of total volume) as described above. The samples were boiled and the proteins separated by SDS-PAGE. After blotting and visualization (ProBlott, Applied Biosystems, Foster City, CA, USA), the membrane areas that contained the cleaved fragments were cut out and the fragments were sequenced (Applied Biosystems ABI 473A). CSK kinase (Carna Biosciences Inc., Kobe, Japan) and AMPKa1 (Cell Signaling Technology, Beverly, MA, USA) were cleaved with CASP3 (10 ml of total volume), and the cleavage products subjected to
MALDI/TOF-MS (Shimazu Techno-Research Inc., Kyoto, Japan) for sequencing. D-A mutagenesis was carried out using the reagents of a PrimeSTAR Mutagenesis Basal kit (TakaraBio, Otsu, Japan) according to the manufacturers instructions. The mutated genes were sequenced using an ABI PRISM 310 DNA sequencer (Applied Biosystems).
Construction of PK expression plasmids for the cell-based assay. Expression plasmids were produced using the Gateway method. To obtain the attB1-PK-Flag-(stop codon)-attB2 for Gateway BP Clonase II recombination, the open-reading frame products of the 30 newly identied PK substrates of CASP3 that had been produced by PCR using the S1 and T1 primers as described above were PCR amplied using the primers, attB1-S1 (50-GGGGACAAGTTTGTA
CAAAAAAGCAGGCTTCCACCCACCACCACCA-30) and T1-Flag-stop-attB2 (50-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACTTGTCATCGTCATCCTTG TAGTCGCTTCCAGCACTAGCTCCAGA-30). These PCR products were each inserted into a pDEST26 vector (Invitrogen) using the Gateway system for construction of the His-PK-Flag nucleotide sequences. All sequences were conrmed by DNA sequencing as described above.
Cell-based assay. HeLa cells were cultured in Dulbeccos modied Eagles medium, 10% fetal bovine serum, penicillin (100 mg/ml), and streptomycin (50 mg/ml).
Transient transfections were carried out using Lipofectamine 2000 Transfection Reagent (Invitrogen) according to the manufacturers instructions. At 24 h after transfection, cells were harvested after apoptosis was induced. Control cells were treated with DMSO and, for apoptosis induction or inhibition, with 20 ng/ml TNFa
Cell Death and Disease
Characterization of caspase-3-substrate kinome
D Tadokoro et al
9
(Calbiochem, La Jolla, CA, USA) and 100 mM cycloheximide (Chemicon, Temecula, CA, USA) or 125 ng/ml anti-Fas antibody (Medical & Biological Laboratories Co., Ltd.,
Nagoya, Japan) in the presence (inhibition) or absence (induction) of 100 mM Z-VADFMK (Peptide Institute Inc., Osaka, Japan) for 6 h. Cells were washed with PBS and then lysed directly by adding one volume of 2 SDS-PAGE sample buffer (125 mM
Tris-HC1, pH 6.8, 20% glycerol, 4% SDS, 10% 2-mercaptoethanol, 0.001% bromphenol blue) before subjecting the cell extracts to SDS-PAGE and immunoblotting, which used anti-His antibodies (GE Healthcare) or anti-Flag M2 antibodies (Sigma-Aldrich). The following antibodies were employed to detect endogenous proteins: anti-a-tubulin (Sigma-Aldrich); anti-AKT2, anti-eEF2K, anti-
AMPKa1, and anti-TGFbR1 (Cell Signaling Technology). Chemiluminescent signals, generated by ECL-Plus reagents (GE Healthcare), or Immobilon Western HRP substrate Luminol Reagent (Millipore), were detected using an LAS-4000 mini biomolecular imager (GE Healthcare).
Conict of interest
Dr. Endo is a founder of CellFree Sciences Co., Ltd. and a member of its scientic advisory board. Other authors declare no conict of interest.
Acknowledgements. We thank Professor Akihide Ryo (Yokohama City University, Japan) for his useful comments and suggestions concerning the cell analysis, Mr. Tatsuya Akagi for technical assistance, and Dr. Morishita (CellFree Sciences) for assistance with the robotic operations. This work was partially supported by the Special Coordination Funds for Promoting Science and Technology by the Ministry of Education, Culture, Sports, Science, and Technology, Japan (Nos. 19657041 and 22310127 to TS).
1. Puente XS, Sanchez LM, Overall CM, Lopez-Otin C. Human and mouse proteases: a comparative genomic approach. Nat Rev Genet 2003; 4: 544558.
2. Hunter T. Signaling 2000 and beyond. Cell 2000; 100: 113127.3. Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam S. The protein kinase complement of the human genome. Science 2002; 298: 19121934.
4. Matrisian LM, Hogan BL. Growth factor-regulated proteases and extracellular matrix remodeling during mammalian development. Curr Top Dev Biol 1990; 24: 219259.
5. Turgeon VL, Houenou LJ. The role of thrombin-like (serine) proteases in the development, plasticity and pathology of the nervous system. Brain Res Brain Res Rev 1997; 25: 8595.
6. van Kempen LC, de Visser KE, Coussens LM. Inammation, proteases and cancer. Eur J Cancer 2006; 42: 728734.
7. Friedl P, Wolf K. Tube travel: the role of proteases in individual and collective cancer cell invasion. Cancer Res 2008; 68: 72477249.
8. Abdel-Rahman HM, Kimura T, Hidaka K, Kiso A, Nezami A, Freire E et al. Design of inhibitors against HIV, HTLV-I, and Plasmodium falciparum aspartic proteases. Biol Chem 2004; 385: 10351039.
9. Alnemri ES. Mammalian cell death proteases: a family of highly conserved aspartate specic cysteine proteases. J Cell Biochem 1997; 64: 3342.
10. Hengartner MO. The biochemistry of apoptosis. Nature 2000; 407: 770776.11. Mahrus S, Trinidad JC, Barkan DT, Sali A, Burlingame AL, Wells JA. Global sequencing of proteolytic cleavage sites in apoptosis by specic labeling of protein N termini. Cell 2008; 134: 866876.
12. Dix MM, Simon GM, Cravatt BF. Global mapping of the topography and magnitude of proteolytic events in apoptosis. Cell 2008; 134: 679691.
13. Righetti PG, Boschetti E. Sherlock Holmes and the proteome a detective story. FEBS J
2007; 274: 897905.
14. Sawasaki T, Ogasawara T, Morishita R, Endo Y. A cell-free protein synthesis system for high-throughput proteomics. Proc Natl Acad Sci USA 2002; 99: 1465214657.
15. Sawasaki T, Morishita R, Gouda MD, Endo Y. Methods for high-throughput materialization of genetic information based on wheat germ cell-free expression system. Methods Mol Biol 2007; 375: 95106.
16. Takai K, Sawasaki T, Endo Y. Practical cell-free protein synthesis system using puried wheat embryos. Nat Protoc 2010; 5: 227238.
17. Endo Y, Sawasaki T. Cell-free expression systems for eukaryotic protein production. Curr Opin Biotechnol 2006; 17: 373380.
18. Sawasaki T, Hasegawa Y, Morishita R, Seki M, Shinozaki K, Endo Y. Genome-scale, biochemical annotation method based on the wheat germ cell-free protein synthesis system. Phytochemistry 2004; 65: 15491555.
19. Goshima N, Kawamura Y, Fukumoto A, Miura A, Honma R, Satoh R et al. Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nat Methods 2008; 5: 10111017.
20. Sawasaki T, Kamura N, Matsunaga S, Saeki M, Tsuchimochi M, Morishita R et al. Arabidopsis HY5 protein functions as a DNA-binding tag for purication and functional immobilization of proteins on agarose/DNA microplate. FEBS Lett 2008; 582: 221228.
21. Takahashi H, Nozawa A, Seki M, Shinozaki K, Endo Y, Sawasaki T. A simple and high-sensitivity method for analysis of ubiquitination and polyubiquitination based on wheat cell-free protein synthesis. BMC Plant Biol 2009; 9: 39.
22. Matsuoka K, Komori H, Nose M, Endo Y, Sawasaki T. Simple screening method for autoantigen proteins using the N-terminal biotinylated protein library produced by wheat cell-free synthesis. J Proteome Res 2010; 9: 42644273.
23. Fischer U, Janicke RU, Schulze-Osthoff K. Many cuts to ruin: a comprehensive update of caspase substrates. Cell Death Differ 2003; 10: 76100.
24. Kurokawa M, Kornbluth S. Caspases and kinases in a death grip. Cell 2009; 138: 838854.25. Lee KK, Murakawa M, Nishida E, Tsubuki S, Kawashima S, Sakamaki K et al. Proteolytic activation of MST/Krs, STE20-related protein kinase, by caspase during apoptosis. Oncogene 1998; 16: 30293037.
26. Tomiyoshi G, Horita Y, Nishita M, Ohashi K, Mizuno K. Caspase-mediated cleavage and activation of LIM-kinase 1 and its role in apoptotic membrane blebbing. Genes Cells 2004; 9: 591600.
27. Tatsuta T, Shiraishi A, Mountz JD. The prodomain of caspase-1 enhances Fas-mediated apoptosis through facilitation of caspase-8 activation. J Biol Chem 2000; 275: 1424814254.
28. Packard BZ, Komoriya A, Brotz TM, Henkart PA. Caspase 8 activity in membrane blebs after anti-Fas ligation. J Immunol 2001; 167: 50615066.
29. Lahti JM, Xiang J, Heath LS, Campana D, Kidd VJ. PITSLRE protein kinase activity is associated with apoptosis. Mol Cell Biol 1995; 15: 111.
30. Emoto Y, Manome Y, Meinhardt G, Kisaki H, Kharbanda S, Robertson M et al. Proteolytic activation of protein kinase C delta by an ICE-like protease in apoptotic cells. EMBO J 1995; 14: 61486156.
31. Casciola-Rosen LA, Anhalt GJ, Rosen A. DNA-dependent protein kinase is one of a subset of autoantigens specically cleaved early during apoptosis. J Exp Med 1995; 182: 16251634.
32. Pearce LR, Komander D, Alessi DR. The nuts and bolts of AGC protein kinases. Nat Rev Mol Cell Biol 2010; 11: 922.
33. Ohoka N, Sakai S, Onozaki K, Nakanishi M, Hayashi H. Anaphase-promoting complex/ cyclosome-cdh1 mediates the ubiquitination and degradation of TRB3. Biochem Biophys Res Commun 2010; 392: 289294.
34. Sawasaki T, Hasegawa Y, Tsuchimochi M, Kamura N, Ogasawara T, Kuroita T et al. A bilayer cell-free protein synthesis system for high-throughput screening of gene products. FEBS Lett 2002; 514: 102105.
35. Kamura N, Sawasaki T, Kasahara Y, Takai K, Endo Y. Selection of 50-untranslated sequences that enhance initiation of translation in a cell-free protein synthesis system from wheat embryos. Bioorg Med Chem Lett 2005; 15: 54025406.
36. Crooks GE, Hon G, Chandonia JM, Brenner SE. WebLogo: a sequence logo generator. Genome Res 2004; 14: 11881190.
Cell Death and Disease is an open-access journal published by Nature Publishing Group. This work is licensed under the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported License. To view a copy of this license, visit http:// creativecommons.org/licenses/by-nc-sa/3.0/
Supplementary Information accompanies the paper on Cell Death and Disease website (http://www.nature.com/cddis
Web End =http://www.nature.com/cddis)
Cell Death and Disease
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright Nature Publishing Group Oct 2010
Abstract
Caspase-3 (CASP3) cleaves many proteins including protein kinases (PKs). Understanding the relationship(s) between CASP3 and its PK substrates is necessary to delineate the apoptosis signaling cascades that are controlled by CASP3 activity. We report herein the characterization of a CASP3-substrate kinome using a simple cell-free system to synthesize a library that contained 304 PKs tagged at their N- and C-termini (NCtagged PKs) and a luminescence assay to report CASP3 cleavage events. Forty-three PKs, including 30 newly identified PKs, were found to be CASP3 substrates, and 28 cleavage sites in 23 PKs were determined. Interestingly, 16 out of the 23 PKs have cleavage sites within 60 residues of their N- or C-termini. Furthermore, 29 of the PKs were cleaved in apoptotic cells, including five that were cleaved near their termini in vitro. In total, approximately 14% of the PKs tested were CASP3 substrates, suggesting that CASP3 cleavage of PKs may be a signature event in apoptotic-signaling cascades. This proteolytic assay method would identify other protease substrates.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer




