Several pathways control time to flowering in Arabidopsis thaliana through transcriptional and posttranscriptional gene regulation. In recent years, mRNA processing has gained interest as a critical regulator of flowering time control in plants. However, the molecular mechanisms linking RNA splicing to flowering time are not well understood. In a screen for Arabidopsis early flowering mutants we identified an allele of BRR2a. BRR2 proteins are components of the spliceosome and highly conserved in eukaryotes. Arabidopsis BRR2a is ubiquitously expressed in all analyzed tissues and involved in the processing of flowering time gene transcripts, most notably FLC. A missense mutation of threonine 895 in BRR2a caused defects in FLC splicing and greatly reduced FLC transcript levels. Reduced FLC expression increased transcription of FT and SOC1 leading to early flowering in both short and long days. Genome-wide experiments established that only a small set of introns was not correctly spliced in the brr2a mutant. Compared to control introns, retained introns were often shorter and GC-poor, had low H3K4me1 and CG methylation levels, and were often derived from genes with a high-H3K27me3-low-H3K36me3 signature. We propose that BRR2a is specifically needed for efficient splicing of a subset of introns characterized by a combination of factors including intron size, sequence and chromatin, and that FLC is most sensitive to splicing defects.
Author Summary
Timing of flowering has a great effect on reproductive success and fitness. It is controlled by many external signals and internal states involving a large set of genes. Here we report that the Arabidopsis thaliana BRR2a gene is needed for normal flowering. BRR2 proteins are components of the spliceosome and highly conserved in eukaryotes. BRR2a is needed for splicing of a subset of introns, most noticeably in the transcript of the flowering repressor FLC. Reduced FLC expression increased transcription of key floral activators, leading to early flowering in both short and long days. Genome-wide experiments established that full BRR2a activity was required only for a small group of introns. We propose that uncompromised BRR2a activity is most important for efficient splicing of a subset of introns of particular size, sequence and chromatin composition, and that FLC is most sensitive to splicing defects.
Citation: Mahrez W, Shin J, Muñoz-Viana R, Figueiredo DD, Trejo-Arellano MS, Exner V, et al. (2016) BRR2a Affects Flowering Time via FLC Splicing. PLoS Genet 12(4): e1005924. doi:10.1371/journal.pgen.1005924
Editor: Gregory P. Copenhaver, The University of North Carolina at Chapel Hill, UNITED STATES
Received: January 25, 2016; Accepted: February 16, 2016; Published: April 21, 2016
Copyright: © 2016 Mahrez et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability: Sequencing raw data are available from GEO (www.ncbi.nlm.nih.gov/geo) (accession number GSE65287).
Funding: This work was supported by grants from the Swiss National Science Foundation (PDFMP3_127358), the Swedish Research Council VR (2011-5010), the Carl-Tryggers-Foundation (CTS 11:189), the Knut-and-Alice-Wallenberg Foundation (KAW 2012.0087) and the Swedish Research Council FORMAS (230-2012-1519) to LH. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
The switch from the vegetative to the reproductive phase is an important developmental transition in flowering plants. The timing of this transition is regulated by several factors, including endogenous and environmental signals. In Arabidopsis, the photoperiod, vernalization and autonomous pathways involved in flowering time control have been investigated in much detail. More recently, additional pathways such as the age or the ambient temperature mediated pathways have been described [1-4]. Most flowering time pathways converge at the activation of a common set of genes that promote flowering and that are known as floral integrators, namely SUPPRESSOR OF OVEREXPRESSION OF CONSTANS1 (SOC1), FLOWERING LOCUS T (FT) and LEAFY (LFY), and at the repression of the major flowering repressor FLOWERING LOCUS C (FLC) [5].
The daily light duration is sensed by the photoperiod pathway. In temperate climates, Arabidopsis and many other species flower earlier in long day (LD) than short day (SD) conditions [5, 6]. In the photoperiod pathway, CONSTANS (CO) activates FT expression in leaves. FT protein is a major mobile flowering-inducing signal and moves through the phloem into the shoot apical meristem (SAM) where it changes vegetative meristem identity to flowering [5]. Normal expression of CO in long day (LD) photoperiods requires the histone-binding protein MSI1, and partial loss of MSI1 function such as in the partially complemented msi1 mutant line msi1-tap1 leads to reduced expression of CO, failure of FT and SOC1 activation and to delayed flowering [7, 8]. FT and SOC1 are repressed by FLC in LD and SD [5]. Prolonged cold (vernalisation) inactivates FLC expression thus strongly shortening the time to flowering [9]. The autonomous pathway is known to promote flowering independently of environmental signals. Mutants in the autonomous pathway are extremely late flowering due to strong upregulation of FLC. The autonomous pathway genes belong to two main subfamilies: (i) chromatin modifiers such as FLOWERING LOCUS D (FLD) [10], FVE [11, 12] and RELATIVE OF EARLY FLOWERING 6 [13] and (ii) RNA binding proteins (RBP) such as FCA [14], FPA [15], FY [14], FLOWERING LOCUS K (FLK) [16, 17] and LUMINIDEPENDENS (LD) [18]. Together, the autonomous pathway genes form a group of partially independently acting genes rather than a classical linear genetic pathway [19].
Transcripts of many plant genes including most of the flowering-related genes contain several introns. Splicing removes the non-coding introns from pre-mRNAs to form mature mRNA (for review see [20, 21]. The spliceosome is a macromolecular complex consisting of five highly conserved small nuclear ribonucleoprotein particles (snRNPs; U1, U2, U4, U5 and U6) and a large number of stabilizing proteins [22]. The splicing reaction can be functionally divided into several steps, including spliceosome assembly, activation, catalysis, and disassembly of the spliceosomal machinery. During the activation step, DExD/H-box RNA helicases are known to play key roles [23-25]. DExD/H-box RNA helicases belong to a large, highly conserved protein family. These proteins play roles in many biological processes related to RNA metabolism, using energy from ATP hydrolysis [26].
RNA processing is much less studied in plants than in animals and yeast. However, during the last decade, the functional role of transcript processing in plants has received some attention (for review see [20, 21]. Several lines of evidence support a connection between RNA processing and flowering time control [27-30]. The proteins identified in pre-mRNA processing were involved in either 3' end polyadenylation or 5' end capping. However, little is known about the possible regulatory role of key proteins of the spliceosomal complex in control of flowering.
Here we describe an early flowering allele of Arabidopsis BRR2a, which encodes a highly conserved spliceosome protein in eukaryotes. The single missense mutation of threonine at position 895 is associated with an early flowering phenotype. We demonstrate that defects in FLC splicing form the mechanism underlying the flowering phenotype. Genome-wide experiments established that full BRR2a activity was required only for a small group of introns. We propose that BRR2a is specifically needed for efficient splicing of a subset of introns characterized by a combination of risk factors in intron size, sequence and chromatin composition, and that FLC is most sensitive to splicing defects.
Results
The cäö mutant causes early flowering
To understand the molecular mechanisms underlying the control of the floral transition by MSI1 [7, 8], a mutant screen for suppressors of the late flowering phenotype of msi1-tap1 plants was performed, resulting in six mutants with a shortened vegetative phase of msi1-tap1 [31, 32]. Two suppressor mutants had been reported previously [31, 32]. Here we describe the analysis of one of the remaining uncharacterized suppressor mutants, which was initially called chrottapösche (cäö) (Swiss German for dandelion) because of its increased leaf serration.
To test whether the cäö early flowering phenotype was independent of the msi1-tap1 background, cäö was backcrossed to Columbia (Col), and flowering time was measured. Under LD and SD conditions, msi1-tap1 flowered much later than Col, confirming earlier results [7, 8], while msi1-tap1 cäö flowered at a similar time to Col (Fig 1). In the Col background, cäö flowered earlier than both Col and msi1-tap1 cäö, demonstrating that the effect of cäö does not require the msi1-tap1 background. Therefore, cäö in the Col background was used in all subsequent experiments.
Fig 1. cäö is an early flowering mutant in Arabidopsis.
Flowering time of wild type (Col), msi1-tap1, cäö and cäö msi1-tap1 in number of total rosette leaves at bolting under LD (left) and SD (right). Shown are mean ± SE (n ≥ 14). Numbers in the graph represent p-values of two-sided t-tests.
http://dx.doi.org/10.1371/journal.pgen.1005924.g001
In addition to early flowering, the cäö plants had other developmental defects (Fig 2). Leaves of cäö were small and serrated contributing to a smaller and more compact rosette (Fig 2A-2C, S1A Fig). Siliques of cäö were shorter than WT (Fig 2D), had reduced seed set and contained unfertilized ovules. In about 20% of cäö ovules female gametophyte development was delayed or completely absent (Fig 2E, S1B Fig). Defective female gametophyte development had a sporophytic origin because it was mainly observed in homozygous cäö-/- plants and only occasionally in heterozygous cäö-/+ plants (S1B Fig). Together, CÄÖ is important not only for normal flowering time but also other developmental programs including formation of female gametophytes.
Fig 2. Developmental alterations in cäö.
(A) Silhouette of the sixth rosette leaf from wild type (Col, left) and cäö (right) showing the serrated margin of the cäö leaf. Plants were grown for 4 weeks under LD conditions. (B) Rosette morphology of Col and cäö plants at time of bolting in LD; scale bar: 5 cm. (C) Leaf morphology of Col and cäö in 20 days old plants; scale bar: 1 cm. (D) Reduced silique length in cäö mutants. Scale bar: 1 mm (E) Cleared wild type (left panel) and cäö ovules with arrested (middle) or absent female gametophytes (right panel). Scale bar: 25 Mm. Cells of the egg apparatus are indicated: CC, central cell; EC, egg cell; SY, synergids.
http://dx.doi.org/10.1371/journal.pgen.1005924.g002
CÄÖ encodes an ATP-dependent RNA helicase protein
In order to isolate the causative mutation in cäö, a mapping population was established by crossing cäö in the Col background with Ler followed by next generation sequencing of F2 bulk segregants. A candidate region on the left arm of chromosome 1 (S2 Fig) contained only one mutation that was represented in all reads covering this region. The mutation was a G to A transition in the AT1G20960 gene and caused a T895I missense mutation (Fig 3). This mutation was subsequently confirmed by a specific dCAPS (derived cleaved amplified polymorphic sequences) molecular marker (S3A Fig) and Sanger sequencing (S3B Fig). AT1G20960, which was previously identified as EMBRYONIC LETHAL 1507 (EMB1507) [33], encodes an orthologue of yeast Brr2p (Bad response to refrigeration 2 protein) and is also called BRR2a [34]. Yeast Brr2p is a DEAD/DExH box ATP-dependent RNA helicase with a unique N-terminal domain and two consecutive helicase cassettes (with a DExD/H domain and helicase superfamily C-terminal domain), each followed by a Sec63 domain (Fig 3B) [35, 36]. Yeast and animal BRR2 proteins are integral components of the U5 small nuclear ribonucleoprotein (snRNP) and are essential for splicing through their contribution to the recruitment and activation of spliceosome complex components [24, 37]. Because Brr2 is the original name given to these proteins, we refer to the mutant protein as BRR2a-T895I and to cäö as brr2a-2. The mutated threonine 895 is located at the end of the first helicase domain and highly conserved in Brr2 proteins (Fig 3C), suggesting that the T895I mutation interferes with BRR2a function.
Fig 3. CÄÖ encodes the ATP-dependent RNA helicase protein BRR2a.
(A) SNP annotations in the identified region with reduced recombination on left arm of chromosome 1. (B) Schematic representation of the protein domain structure of BRR2a. A detailed description of the protein domains can be found in the main text. (C) Threonine 895 is conserved among eukaryotic BRR2 proteins. Sequence alignment of the end of helicase domain 1 in BRR2A proteins from yeast, animals and plants. The asterisk highlights threonine 895, which is altered to an isoleucine in brr2a-2. Conserved amino acid residues are highlighted in black. Residues not identical but similar are highlighted in gray.
http://dx.doi.org/10.1371/journal.pgen.1005924.g003
To confirm that the early flowering phenotype is caused by the disruption of BRR2a, an allelism test was performed. Heterozygous emb1507-4 null mutant plants were used to pollinate homozygous brr2a-2 plants. All F1 plants with the emb1507-4 allele but none of the plants without it displayed the brr2a-2 phenotype, establishing that the mutant BRR2a protein caused the cäö mutant phenotype. Considering the recessive nature of the brr2a-2 mutant, these data suggest that brr2a-2 is a hypomorphic rather than a neomorphic allele and that the cäö phenotype is caused by reduced activity of BRR2a.
BRR2a is a highly conserved protein
BRR2 sequences from different eukaryotes including yeast, metazoa, protozoa and plants were aligned and a phylogenetic tree was constructed (S4 Fig). Arabidopsis BRR2a has two paralogues, BRR2b (At2g42270) and BRR2c (At5g61140). BRR2a and BRR2b result from a recent gene duplication and are part of a clade with members in all green plants. In contrast, BRR2c belongs to a minor clade with only one protein from the fern Selaginella and one yeast protein. Furthermore, BRR2a shares 82% identity and 91% similarity with BRR2b but only 40% identity and 59% similarity with BRR2c (S1 Table). Although BRR2a and BRR2b are conserved, the obvious phenotype of the brr2a mutant indicates that the genes do not have redundant functions.
Data in the Arabidopsis eFP Browser [38] show that BRR2 genes are expressed in most tissues at variable levels (S5 Fig), with BRR2a having the highest transcript levels. BRR2c was expressed considerably less than BRR2a, and BRR2b was expressed lowest of the three BRR2 homologues in most tissues. It is likely that the high expression of BRR2a accounts for the strong phenotypes of brr2a mutants.
FLC expression levels are altered in brr2a-2
FLC is a MADS-box DNA binding protein and a major repressor of flowering time in Arabidopsis [39, 40]. Many early flowering Arabidopsis mutants have reduced FLC expression whereas many late flowering mutants have increased FLC expression. We tested for possible changes of FLC transcript levels in 15 days old seedlings grown under SD conditions. Col plants containing an active FRIGIDA (FRI) allele, which express high levels of FLC, were included as control. As reported before, the expression levels of FLC were much higher in FRI than in Col [41]. In contrast, FLC levels were strongly (>95%) reduced in brr2a-2 (Fig 4). The MADS AFFECTING FLOWERING (MAF) genes are homologues of FLC and are often similarly regulated [42, 43]. In brr2a-2, expression levels of MAF1 and MAF4 mRNAs were about 50% reduced and MAF2, MAF3 and MAF5 mRNA levels were also lower than in WT (Fig 4B and 4C). Together, the results are consistent with the observed cäö early flowering phenotype and the effect of FLC on flowering time control [39].
Fig 4. FLC transcript levels are altered in brr2a-2.
(A) Transcript levels of the flowering repressor gene FLC in Col, brr2a-2 and FRI. (B-C) Transcript levels of the MAF1 (B) and MAF2--MAF5 (C) in Col and brr2a-2. (D-E) Transcript levels of the floral integrators FT (D) and SOC1 (E) in Col and brr2a-2. Quantitative RT-PCR in (A-E) was performed using RNA from 15 day-old seedlings grown under SD conditions, at zeitgeber time (ZT) = 7. Relative expression to PP2a is shown as mean ± SE (n = 3). (F) Genetic interaction of brr2a-2 and flc for flowering time control. Flowering time of Col, flc, brr2a-2 and flc brr2a-2 in number of total rosette leaves under SD. Shown are mean ± SE (n ≥ 14).
http://dx.doi.org/10.1371/journal.pgen.1005924.g004
FT and SOC1 expression is increased in brr2a-2
FT and SOC1 promote flowering and both are repressed by FLC. We therefore tested if early flowering of brr2a-2 was associated with increased FT and SOC1 expression. The expression of FT was nearly three times higher in brr2a-2 than in Col (Fig 4D) and SOC1 had significantly increased expression as well (Fig 4E). These results are consistent with the decreased FLC levels in brr2a-2 and indicates that early flowering is caused by increased expression of FT and SOC1 that have been released from the repression by FLC.
We tested genetically whether brr2a-2 accelerates flowering via FLC by measuring flowering time of the double brr2a-2 flc mutant (Fig 4F). Consistent with earlier reports, flc flowered earlier than Col. The brr2a-2 mutant flowered even earlier than flc, possibly because of reduced expression of other floral repressors such as the MAF genes. Importantly, the brr2a-2 flc double mutant did not show further acceleration of flowering revealing complete epistasis of BRR2a and FLC, which is fully consistent with the reduced FLC expression as the major cause of accelerated flowering in brr2a-2.
Transcript processing of FLC is altered in brr2a-2
The reduced FLC transcript levels did not correlate with altered transcript levels of major FLC activators or repressors (S6 Fig). Splicing of COOLAIR, an antisense transcript covering the FLC locus [44], contributes to repression of FLC transcription and depends on a homolog of the yeast spliceosomal PRP8 protein [30]. COOLAIR splicing is strongly disrupted in brr2a-2 (S7 Fig) and reduced levels of COOLAIR and FLC transcripts are consistent with correlated FLC and COOLAIR production [44]. In contrast to a prp8 mutant in which defective COOLAIR splicing increased FLC transcription [30], defective COOLAIR splicing in brr2a-2 did not increase FLC transcript levels. Therefore we tested whether the reduced FLC transcript levels in brr2a-2 were due to defects in FLC transcript splicing. Intron retention (IR) was tested by qPCR for randomly selected FLC introns 1, 5 and 6. For all three tested FLC introns, IR was about 8-fold higher in brr2a-2 than in Col (Fig 5A). These results suggest that the BRR2a-T895I mutation resulted in an unproductive splicing complex that caused IR and reduced accumulation of correctly spliced FLC in brr2a-2. Incorrectly spliced transcripts are subject to nonsense-mediated decay (NMD) mRNA quality control and have a much higher turnover rate than correctly spliced transcripts [45], which could explain the reduced FLC transcript levels.
Fig 5. FLC splicing efficiency is reduced in brr2a-2.
Intron retention was calculated as the ratio of unspliced to total (spliced + unspliced) transcripts for three representative FLC introns (A) and for intron 1 in MAF1 and SEP3, and intron 2 in AG (B) in both Col and brr2a-2. For FLC and MAF1, RNA was extracted from 15 day-old seedlings grown under SD conditions at ZT = 7. For SEP3 and AG, RNA was extracted from inflorescences of LD-grown plants. Results were normalized to PP2a; shown are mean ± SE (n = 3). Note the different scales used for each gene showing that that majority of MAF1, SEP3 and AG transcripts are correctly spliced even in the brr2a-2 mutant.
http://dx.doi.org/10.1371/journal.pgen.1005924.g005
BRR2a-T895I affects the splicing efficiency of a small group of introns
The splicing defects of the FLC transcript can explain the early flowering phenotype but it was possible that in brr2a-2 transcripts of other genes were affected as well. We used PCR assays to test IR in transcripts of the three MADS-box genes MAF1, AG and SEP3, which have a similar intron-exon structure as FLC. For each of these genes, retention of the intron corresponding to FLC intron 1, which showed strong retention in brr2a-2, was tested. Although IR was increased in the transcripts of all three genes (Fig 5B) it never exceeded 10% and was thus much less than for FLC of which 90% of the transcripts retained intron sequences, suggesting that not all transcripts depend to the same extent on functional BRR2a for correct processing.
To investigate other potential splicing defects in brr2a-2 we performed an RNA-seq experiment. For each of three wild-type and three mutant libraries between 23 and 40 million reads where generated of which 83-92% could be mapped to the Arabidopsis TAIR10 reference genome. About 90% of the mapped reads were from non-overlapping, annotated genes (S2 Table) and 4% of the mapped reads corresponded to intron sequences. Analysis of differentially expressed genes (DEG) identified 279 genes with increased and 103 genes with decreased transcript levels (S3 and S4 Tables). The gene with the strongest transcript reduction was FLC (6.6 fold, p = 2.1E-15) and consistent with the early flowering phenotype, SOC1 expression was significantly upregulated (3.1 fold, p = 7.7E-10). In addition, the transcript level of the BRR2a homolog BRR2b was significantly increased (2.8 fold, p = 1.6E-11). Similarly, the gene encoding the predicted splicing factor AtPRP8b, which is thought to function together with BRR2 [34], was upregulated in brr2a-2 (3.2 fold, p = 4.3E-08). Upregulation of BRR2b and AtPRP8b expression could be caused by an autoregulatory loop responding to a reduced function of the BRR2a-T895I mutant protein. It is possible that the upregulation of BRR2b and AtPRP8b distort stoichiometry in the splicosome and enhance the defects in brr2a-2. Among the upregulated DEGs, four gene ontology (GO) categories were significantly overrepresented (p<0.05, S5 Table). The GO categories "response to UV-B" and "response to salicylic acid stimulus" are consistent with earlier reports of connections between splicing and stress responsiveness [21]. Also the categories "regulation of transcription, DNA-dependent" and "response to karrikin" were enriched among the upregulated genes. Only one GO category ("proteolysis") was significantly enriched (p = 0.02) among the downregulated genes (S6 Table). Next, the transcriptome data were searched for misexpression of genes involved in leaf development. Of 103 genes from GO category GO:0009965 (leaf development) for which transcripts were detected, three were significantly stronger expressed in brr2a-2 than in wild type: TEOSINTE BRANCHED 1, CYCLOIDEA, AND PCF FAMILY 13 (TCP13), KIPRELATED PROTEIN 6 (KRP6) and KRP1 (S8A Fig). Two leaf development genes were less expressed in brr2a-2 than in wildtype: ASYMMETRIC LEAVES 1 (AS1) and TCP24. Reduced expression of both TCP24 and AS1 is consistent with earlier reports that TCP24 is an activator of AS1 [46]. Increased expression of KRP6 or KRP1 causes reduced leaf size and increased serration [47, 48] and is consistent with the leaf phenotype of brr2a-2 plants.
The ASTALAVISTA program suite [49] was used to collate alternative splicing (AS) events in the six libraries (Fig 6). Relative frequencies of AS events in WT were similar to those reported earlier [50]. In brr2a-2, almost twice as many AS events were detected than in wild type (Fig 6A). This increased AS frequency was caused mainly by IR and partly by more complex events such as double intron retention (Fig 6A-6C). Exon skipping (ES) as well as use of alternative acceptors or donors did not differ between wild type and mutant. Therefore, we focused on IR events and used DESeq2 [51] with numbers of intron-derived reads to detect differentially retained introns (DRIs). There were 914 DRIs with significantly increased but only 74 with decreased retention (S7 and S8 Tables). Thus, the BRR2a-T895I mutation causes primarily increased intron retention. The low number of retained introns (1.2% of 74'581 introns with available read counts or 0.8% of 117'458 analyzed introns) indicates that only a specific subset of introns is strongly affected in brr2a-2. RT-PCR assays using independent RNA samples confirmed increased IR in brr2a-2 for 10 out of 10 tested genes, suggesting a low false positive rate of detected DRIs (S9 Fig). Of the leaf development genes with altered expression in brr2a-2 (S8A Fig) only intron 1 of TCP13 was significantly differentially retained (p = 1.1E-02; S8B Fig). The weaker retention of the other intron of TCP13 was not significant (p>0.05). The differentially expressed leaf development genes KRP1, KRP6, TRCP24 and AS1 all contain introns but did not show signs of increased IR in brr2a-2 plants (S8B Fig). Thus, it is possible that the leaf development phenotype of brr2a-2 is related to splicing defects in the TCP13 transcription factor.
It was possible that certain genes depend critically on BRR2a for splicing of several introns. However, although the genes with DRIs contain on average six introns, for most of them only a single intron was significantly retained (Fig 6D). Thus, intron retention in brr2a-2 appears to be intron-specific rather than a gene or transcript property.
Fig 6. Intron retention in brr2a-2.
(A) Number of alternative splicing events (AS) based on three biological replicates each of Col and brr2a-2. ES, exon skipping; AA, alternative acceptor site; AD, alternative donor site; IR, intron retention; C, complex, a combination of one or several of ES, AA, AD or IR. The increased number of AS events in brr2-a is mainly due to increased intron retention. (B) Number of complex alternative splicing events. 2IR, two intron retention events in the same transcript; IRIR, either one of two different introns is retained; 3IR, three intron retention events in the same transcript; 2IRIR, either a pair of introns or a more 3' located single intron is retained; IR2IR, either a single intron or a more 3' located pair of introns is retained; 4IR, four intron retention events in the same transcript. For (A) and (B), AS events were quantified from RNA-seq data using ASTALAVISTA [49]. The complex AS events observed in brr2a-2 are mainly combinations of IR events. (C) Schematic representation of basic AS events. (D) Total intron number per transcript with detected IR (left) and number of retained introns per transcript with detected IR (right). Whereas transcripts with detected IR have on average 6 transcripts, only one or two of those are retained, suggesting that IR is mostly an intron and not a transcript property. (E) Length of introns with increased retention in brr2a-2 ("retained"), with decreased retention ("released") and with no change in retention ("equal"). Introns with increased retention are often shorter whereas introns with decreased retention are often longer than unaffected introns. (F) GC content of introns with increased retention in brr2a-2 ("retained"), with decreased retention ("released") and with no change in retention ("equal"). Introns with increased retention have often lower GC content whereas introns with decreased retention have often higher GC content than unaffected introns. P-values are from one-sided t-tests.
http://dx.doi.org/10.1371/journal.pgen.1005924.g006
It was possible that DRIs are characterized by specific sequence signatures. We used the R package motifRG to test whether DRIs contained enriched motifs using the sequences of unchanged introns as background. However, there were no sequence motifs enriched in DRIs over unchanged introns. Similarly, splice site sequences did not differ between DRIs and unchanged introns (S10 Fig). Next, we tested whether DRIs differ in length from unchanged introns. Less efficiently spliced DRIs were significantly shorter than unchanged introns (mean of 140 bp vs. 173 bp; p = 1.7E-13, one-sided t-test) (Fig 6E). Conversely, more efficiently spliced DRIs where significantly longer than unchanged introns (mean of 360 bp vs. 173 bp; p = 7.2E-6, one-sided t-test). In addition to length, DRIs differed also in GC content from unaffected introns (Fig 6F). Less efficiently spliced DRIs had a significantly lower GC content than unaffected introns (31.8% vs. 32.9%; p = 1.6E-13, one-sided t-test); and more efficiently spliced DRIs had a significantly higher GC content than unaffected introns (35% vs. 32.9%; p = 4.8E-5, one-sided t-test). We also tested an effect of intron folding using but stability of the most likely secondary structure did not differ between retained and spliced introns (see Materials and Methods for details). Thus, the BRR2a-T895I mutation appears to reduce splicing efficiency preferentially of short and GC-poor introns and shifts it to longer, GC-rich introns.
Because chromatin can affect splicing [52], we tested whether chromatin on DRIs differs from chromatin on other introns. To exclude confounding effects by transcription strength, DRIs were compared to two different control sets: (i) Non-differentially retained introns from the genes that have at least one DRI, and (ii) introns from a set of genes that do not contain DRIs and that have a similar median expression as the genes with DRIs. DRIs did not differ significantly from control introns regarding CHG methylation, CHH methylation, H3 density and H3K9me2 (S11 Fig). In contrast, DRIs had less H3K4me1 and CG methylation (mCG), and more H3K4me3 than control introns (Fig 7). H3K9ac was higher on DRIs than on the non-DRI introns in the same genes but similar to the level on introns of control genes. H3K27me3 and H3K36me3 did not differ between DRIs and non-DRI introns in the same genes but were higher and lower, respectively, on exons and introns of genes with DRIs than on control genes. In addition, exons on genes with DRIs had more H1.1, H1.2, and H3K27me3 and less H3K9ac than exons on control genes. Thus, BRR2a function is most important on genes generally rich in H3K27me3 and H1, and low in H3K36me3 and H3K9ac. It is also most important for splicing of introns with low mCG and H3K4me1, and high H3K4me3. This shows that local chromatin properties can affect the outcome of a mutation in a spliceosomal subunit.
Fig 7. Intron retention in brr2a-2 is associated with specific chromatin properties.
Box plots show averaged genome-wide bisulfite sequencing and ChIP signals for exons (blue) and introns (green). DRI, differentially retained introns in brr2a-2. DRI gene, genes containing at least one differentially retained intron. Thus, the boxes in each plot represent, from left to right, (i) exons from genes that have no DRIs, (ii) exons from genes that have at least one DRI, (iii) normally spliced introns in genes that have at least one DRI, (iv) DRIs, and (v) introns from genes that have no DRIs. Control genes without DRIs were selected to have the same median expression as the DRI genes. Significant differences are indicated; numbers are-log10 of p-values from Wilcoxon signed-rank tests.
http://dx.doi.org/10.1371/journal.pgen.1005924.g007
Discussion
Yeast and human BRR2 proteins are evolutionary highly conserved spliceosome proteins of about 200 kDa [53, 54]. They belong to the DEAD/DExH-box family of ATP-dependent RNA helicases with two putative RNA helicase domains, each with a highly conserved ATPase motif, followed by a SEC63 domain. Their ATPase and helicase activities are involved in rearrangements necessary for spliceosome activation through the unwinding of U4/U6 snRNP [24]. After the unwinding, BRR2 remains stably associated with the catalytic core of the spliceosome [55] and eventually promotes spliceosome disassembly by unwinding U2/U6 [56]. BRR2 also functions in promoting conformational rearrangements in the spliceosome during the first-to-second-step transition, which aid 3' splice site positioning and formation of the second-step catalytic center [57]. BRR2 helicase activities are highly regulated to ensure the correct timing of spliceosome activation or disassembly [58]. Regulators of BRR2 functions include Prp8 [59, 60] and the Snu114 GTPase [56].
Here, we identified a new allele of BRR2a containing a T895I mutation, which enabled us to demonstrate that Arabidopsis BRR2a functions in intron splicing. In BRR2a, threonine 895 and its neighboring amino acid sequences are highly conserved and located near the ATPase domain within the first conserved helicase I motif. A crystal structure and structural models for different yeast and human BRR2 helicase regions show a possible reorganization and pairing of these domains during the splicing process [61]. Furthermore, mutagenesis studies in the amino-terminal helicase domain revealed the role of this domain in splicing efficiency [23, 62]. Together, the T895I mutation in brr2a-2 likely results in a partial loss of BRR2a function or impairs interaction of BRR2a with other proteins in the spliceosome. Plausible interactors are PRP8 and GAMETOPHYTE FACTOR 1 (GFA-1) [34], which are Arabidopsis homologues of the Brr2p regulatory yeast proteins Prp8 and Snu114 [63], respectively. Indeed, GFA1 interacts with the carboxy-terminal domain of BRR2a and with PRP8a in yeast two-hybrid assays [34] and BRR2a and PRP8a copurify [64]. However, it is not known whether mutation of T895 in the amino-terminal domain affects this interaction. Other BRR2a candidate interactors are homologues of the serine/threonine protein kinase Prp4 and its substrates such as Prp1. These proteins interact biochemically with fission yeast Brr2p. Future experiments will establish whether the T895I mutation affects BRR2a's ability to interact with other proteins. An alternative explanation for reduced function of BRR2a-T895I could be that the T895I mutation weakens BRR2a interactions with U4/U6, U5 or pre-mRNAs. This appears plausible because in vivo UV cross-linking and RNA sequencing have established that budding yeast Brr2p binds not only to the U4/U6 and U5 snRNA but also to pre-mRNAs [57]. It is likely that the polar T895 is surface-exposed, and if a change at this residue reduces BRR2a-RNA interactions, this could also reduce the activity of BRR2a-T895I in the splicing reaction.
In Arabidopsis, the BRR2a-T895I mutation results in early flowering and altered leaf development. Splicing defects in the transcripts of the TCP13 transcription factor and altered transcript levels of TCP13, TCP24, AS1, KRP1 and KRP6 are consistent with the leaf phenotype of brr2a-2 plants. KRPs repress cell proliferation by inhibiting cyclin-dependent kinases [65] / Sablowski, 2014 #13362]. Increased expression of KRP6 or KRP1 causes reduced leaf size and increased serration [47, 48] consistent with the concomitant upregulation of these genes and altered leaf size and shape in brr2a-2. TCPs are major transcriptional regulators that control cell proliferation in leaves (for reviews see [66, 67]). TCPs related to TCP13 (CIN-like TCPs) function highly redudnantly [68]; they promote the arrest of cell division, and overactivation can strongly reduce leaf size and increase serration. Because the CIN-like TCP13 homolog TCP4 is a direct activator or KIP1 [69], it is possible that increased expression of TCP13 causes KRP upregulation, leading to premature arrest of cell proliferation and reduced leaf size in brr2a-2. Retention of TCP13 intron 1 does not alter transcript coding potential as this intron 1 is located in the 5' untranslated region; it could, however, affect translation efficiency.
FLC is a major repressor of flowering that functions by repressing FT and SOC1 [39, 40, 70, 71]. Expression and genetic data support the model that reduced FLC transcript levels in brr2a-2 allow untimely activation of FT and SOC1, which together cause accelerated flowering. No strong changes in the expression of known regulators of FLC were found in brr2a-2 but strong defects in FLC splicing efficiency were evident from intron retention. Whereas the proportion of intron-containing FLC transcripts was increased, total amounts of FLC transcripts was decreased in brr2a-2. This is similar to the pep-4 mutant [72] and possibly a consequence of RNA quality surveillance such as NMD, a co-transcriptional quality control pathway that degrades aberrant transcripts [45]. In addition to the NMD pathway, other RNA quality pathways operate in the nucleus and degrade transcripts with delayed processing independent of the presence of stop codons [73]. Although a functional correlation between transcription and transcript processing was previously reported in yeast and mammals [74], it remains unknown to what extent RNA quality pathways can feed back to repress transcription.
Complete loss of Arabidopsis BRR2a function is embryo lethal [33], and the phenotype of the cäö mutant suggests that brr2a-2 is a hypomorphic allele and that BRR2a-T895I has reduced function. The pleiotropic morphological defects of brr2a-2 plants revealed that full BRR2a function is needed in flowering control and also other developmental programs. The developmental role of BRR2a is consistent with previous reports of requirements for spliceosome components in animal and plants development [34, 75-79]. In cases of embryo lethality hypomorphic alleles such as brr2a-2 constitute unique and powerful resources to analyse gene functions during postembryonic life. The restricted phenotypic changes of brr2a-2 plants are also consistent with the result that splicing of only a group of introns was affected. Thus, introns differ in their dependency on BRR2a activity, and FLC is particularly sensitive to the BRR2a-T895I mutation. Our discovery of the cäö mutant has revealed that mutations in different spliceosome proteins can affect distinct sets of introns. We have shown that FLC splicing is greatly reduced in brr2a-2 while a recent study showed that FLC splicing was normal in a prp8 mutant [30].
Genome-wide sequencing data indicate that retained introns often came from genes with a high-H3K27me3-low-H3K36me3 signature. Retained introns differed also in their local chromatin composition and had more H3K4me3, less H3K4me1 and less mCG than control introns. In addition, splicing efficiency in brr2a-2 plants was often shifted from short, GC-poor to long, GC-rich introns. However, the case of FLC shows that even long introns can have splicing defects in brr2a-2. In addition, not all short introns were retained in brr2a-2 consistent with a combined effect of intron length, chromatin features and maybe other properties. This notion is supported by the observation that FLC, which contains a retained long intron, has the high-H3K27me3-low-H3K36me3 signature. Similar to other retained introns, intron 1 of FLC has low H3K4me1. Only 0.3%, 31.6% and 14.1% of all introns have higher H3K27me3, lower H3K36me3 or lower H3K4me1, respectively, than intron 1 of FLC. In contrast, H3K4me3 and mCG on FLC intron 1 were close to the average of all introns.
Our finding that retained introns have particular chromatin signatures is consistent with recent reports about effects of chromatin on splicing in animals (for review see [52, 80]. Although the underlying mechanisms are poorly understood, two main models have been developed: (i) In the kinetic coupling model, local chromatin affects the rate of RNA Polymerase II (Pol II) elongation. Slow elongation or pausing favors weak splice sites while fast elongation misses weak sites and favors downstream strong sites. (ii) In the recruitment coupling model, chromatin-binding adaptor proteins recruit specific splicing regulators to define splicing outcome [52, 80]. Alternative splicing of the human fibroblast growth factor receptor 2 (FGFR2), for instance, is mediated by H3K36me3-based recruitment of the polypyrimidine tract-binding protein splicing factor [81]. Notably, one of the alternative spliced states of human FGFR2 shares the high-H3K27me3-low-H3K36me3 chromatin signature of Arabidopsis genes with IR in brr2a-2 [81]. More recently, alternative splicing of FGFR2 was found to be affected by a long non-coding antisense RNA that recruits Polycomb-group proteins and the H3K36 histone demethylase KDM2 to establish a high-H3K27me3-low-H3K36me3 chromatin signature [82]. We note that also at Arabidopsis FLC, a long antisense RNA affects H3K36me3 to establish a high-H3K27me3-low-H3K36me3 chromatin signature [83]. Future work needs to address whether regulation of FLC and FGFR2 splicing share a common mechanistic basis. In addition to histone modifications, also DNA methylation is associated with splicing [84]. In mammals, introns often have lower mCG than exons, and recruitment of CCCTC-binding factor and methyl-CpG binding protein 2 to mCG can affect splicing by modulating Pol II elongation rates [84]. In maize, it has been proposed that CHG methylation at splice acceptor sites may inhibit RNA splicing [85] and loss of DNA methylation at a splice acceptor site in the oil palm DEFICIENS gene was associated with splicing defects in somaclonal variation [86]. It is not known whether mCG affects splicing in Arabidopsis but our results suggest a mechanistic link between mCG and IR.
Despite the similarities between chromatin features found related to splicing outcomes, ES is the most prevalent alternative splicing event in mammals and IR is most prevalent in plants. Therefore, more work is needed to establish whether the mechanisms that couple local chromatin properties to splicing are shared or differ between animals and plants.
In summary, our suppressor mutant screen for accelerated flowering led to the discovery of the early flowering brr2a-2 mutant. Our data suggest a model in which BRR2a functions in the spliceosome with the T895I missense mutation leading to reduced splicing efficiency for transcripts of a selected group of genes, most importantly FLC. Reduced FLC expression allows unscheduled transcription of FT and SOC1 to accelerate flowering. Together, our work establishes correct splicing as an important mechanism for flowering time control and uncovers a complex relation between chromatin features and splicing outcomes in Arabidopsis.
Materials and Methods
Plant material and growth conditions
The Arabidopsis thaliana wild-type and T-DNA insertion lines were in the Columbia-0 (Col) background. FRI in Col [87], msi1-tap1 and flc-6 [7] were described before; emb1507-4 (NASC ID: N16092) was obtained from the Nottingham Arabidopsis Seed Stock Centre. The EMS-mutated allele cäö in the msi1-tap1 background was isolated in a mutant screen that was described before [31]. For further characterization, cäö in the msi1-tap1 background was backcrossed into Col. Seeds were sown on 0.5× basal salts Murashige and Skoog (MS) medium (Duchefa, Haarlem, The Netherlands), stratified at 4°C for 2-3 day, and allowed to germinate in growth chambers at 20°C for 10 days under LD (16 h light) or SD (8 h light) photoperiods. Plantlets were planted in soil and grown in growth chambers under the same conditions.
Flower buds were emasculated at anthesis and the non-pollinated pistils were collected 2-4 days after emasculation. The samples were fixed with ethanol-acetic acid (9:1), washed for 10 min in 90% ethanol, 10 min in 70% ethanol and cleared over-night in a chloralhydrate solution (66.7% chloralhydrate (m/m), 8.3% glycerol (m/m)). Ovules were observed under differential interference contrast (DIC) optics using a Zeiss Axioplan microscope (Zeiss, Jena, Germany). Images were recorded using DFC295 Leica camera (Leica, Wetzlar, Germany).
Mapping by Illumina deep-sequencing
A mapping population was established by crossing cäö with the polymorphic ecotype Ler, and total genomic DNA was extracted from 150 F2 plants presenting the mutant phenotype using the Nucleon Phytopure genomic DNA extraction Kit (Amersham Bioscience, Uppsala, Sweden). After library preparation using standard Illumina protocols, the DNA was loaded onto an Illumina Genome sequencer GA IIx and run for 36 cycles. The obtained short reads were mapped against the TAIR10 release of the Arabidopsis genome using Bowtie 2 [88].
Genome-wide SNP positions and pileup information were then collected and filtered as recommended in the Next-generation EMS mutation mapping software [89].
dCAPS primers were designed using dCAPS Finder 2.0 [90] (S9 Table). The amplified fragments from genomic DNA of the wild type Col and mutant cäö were digested with HpaI (Fermentas, Helsingborg, Sweden) and loaded on a 2.5% agarose gel. The SNP in cäö was further validated by standard Sanger sequencing using primers LH1609: CTTGAAGGAAGATAGTGTAACTCGT and LH1324: CCGAATGTATCAGGTCAGCTCTT primers.
RNA isolation and RT-qPCR
RNA extraction and reverse transcription were performed as described previously [91] with minor modifications. The DNA-free RNA was reverse-transcribed using a RevertAid First Strand cDNA Synthesis Kit (Fermentas, Helsingborg, Sweden) according to manufacturer's recommendations. Aliquots of the generated cDNA were used as template for PCR with gene-specific primers (S9 Table). Quantitative PCR was performed using gene-specific primers (S9 Table) and SYBR green (Fermentas, Helsingborg, Sweden) on an IQ5 multicolor Real time PCR thermo cycler (BIO-RAD, PA, USA). qPCR reactions were performed in triplicate; gene expression levels were normalized to a PP2A control gene, and results were analyzed as described [92].
Measuring splicing efficiency
Splicing efficiency was measured as described [30] where a primer in an exon was combined with a primer in a neighboring intron (for the unspliced transcript) or covering the splicing junction (for the spliced transcript). For the location of primers for measuring COOLAIR splicing see Fig 3A in [30]. RT- controls were always included to confirm absence of genomic DNA contamination.
Sequence alignment and phylogenetic analysis
Protein sequences of BRR2a homologues were obtained using PSI-BLAST searches, representative organisms from the different eukaryote kingdoms were selected, and their BRR2 amino acid sequences retrieved from protein databases at NCBI. Amino acid sequences were aligned using ClustalW implemented in MEGA5 [93]. Evolutionary analyses were conducted using MEGA5, and a bootstrap Neighbor-Joining Tree was calculated for 1000 bootstrap trials.
RNA-seq and bioinformatics analysis
For RNA-seq, RNA was isolated from 15-day-old SD-grown Arabidopsis seedlings harvested at 1 h before darkness using the RNeasy Plant Mini Kit (Qiagen). RNA was treated with DNAse I using TURBO DNA-Free Kit (Ambion) and ribosomal RNA was removed using the Ribo-Zero Magnetic kit Plant leaf (cat# MRZPL116, EpiCentre) starting with 1.5Mg total RNA. Sequencing libraries were generated from the rRNA depleted RNA using the ScriptSeq v2 RNA seq library prep kit (cat# SSV21124, EpiCentre). Sequencing was performed at an Illumina HiSeq2000 in 100 bp paired-end mode using v3 sequencing chemistry. FastQC v0.10.1 [94] was used to check read quality followed by removal of 10 bp adapter sequences in all samples with trimmomatic v0.32 [95]. Alignments against the Arabidopsis TAIR10 genome were performed with tophat v2.0.10 [96] using default parameters. De novo transcriptome assembly of mapped samples was performed using cufflinks v2.1.1. [97], the resulting gtf transcriptome files were merged using cuffmerge v2.1.1. Splicing events were analyzed with ASTALAVISTA v3.0 [49]. RNAseq gene expression counts were generated with HTseq 0.6.1 [98] using the TAIR10 genome annotation. Before the analysis, samples were subjected to batch effect correction using the R package RUVseq v1.0.0 [99] with the empirical control option set to 5,000 genes. Differential gene expression analyses were performed with the R package DESeq2 v1.6.1 [51] using thresholds of p = 0.05 and fold change = 2 for DEG calling after multiple testing correction according to [100]. Intron counts for the first isoform of Arabidopsis transcripts were generated with HTseq 0.6.1. Intron counts were corrected by gene expression using fold change. Differentially retained introns were selected with the DESeq2 package in R using thresholds of p = 0.05 and fold change = 2 after multiple testing correction according to [100]. Further analysis was performed with custom scripts in R v3.1.2. Gene Ontology analysis was performed using GeneCodis [101]. The hypergeometric statistical test with Bonferroni correction was used with a filter requiring three genes as minimum category population. Data are available at GEO (accession number GSE65287).
Data for chromatin properties were taken from the literature: H1.1 and H1.2, [102]; H3K9me2, [103]; H3K4me1, [104]; H3K4me2 and H3K36me2, [105]; H3K4me3 and H3K9ac, [106]; mCG, mCHG and mCHH, [107]; H3K27me3 [108]; H3 and H3K36me3 [109] (H3K9me2, CG, CHG and CHH: seedlings; H3K4me1, H1.1 and H1.2: 3-weeks-old plants; H3K27me3, H3K9ac, H3K4me3, H3K9ac, H3 and H3K36me3: rosette leaves).
It had been reported that budding yeast Brr2p has a particular role in splicing of highly structured introns [57]. Following the method described in [57] and [110], secondary structures were predicted for intron sequences between branch site (BS) and the 3'ss using RNAfold from the Vienna package [111]. Branch sites were predicted as described in [110]. The free energies of the most stable predicted structure for each intron were compared between DRI and unchanged introns using a Wilcoxon signed-rank test. The difference was not significant (p>0.05).
Supporting Information
S1 Fig. Developmental alterations in cäö.
(A) Rosette diameter of Col and cäö plants. Shown are means ± SE (n ≥ 14). (B) Ovule development in Col, homozygous cäö-/- and heterozygous cäö+/- at 2, 3 and 4 days after emasculation (DAE). Shown are percentage of normally developing ovules (grey) and ovules that lack female gametophyte or are arrested (dark red). Numbers above bars indicate numbers of analyzed ovules.
(PDF)
S2 Fig. Genome-wide SNP frequencies in a cäö F2 mapping population.
(A) SNPs frequencies in sequencing reads were plotted along each chromosome using a bin size of 250 kb. SNPs are caused by reads from the Ler accession, which was crossed with the cäö mutant in Col. A non-recombinant region on the left arm of chromosome 1 with very few Ler reads is indicated by a brace. Chro., abbreviation for Chromosome. Histograms were generated by the Next-generation mapping tool (Austin et al., 2011 [89]). (B) SNP localization by the Next-Generation Mapping web application. Screenshot of the final stage of region selection and SNP annotation. The sharp delimited peak, at position 7307231 corresponds to the position of a mutation in AT1G20960.
(PDF)
S3 Fig. Confirmation of the gene mutation by dCAPS and by Sanger sequencing.
(A) Gel electrophoretic separation of PCR products (left undigested, right after HpaI digestion). The PCR digestion products were separated by electrophoresis on a 2.5% agarose gel. The mutation in brr2a-2 is predicted to inactivate an HpaI recognition site. (B) PCR amplified fragments from Col and brr2a-2 genomic DNA were sequenced. Sequences were aligned to Col and cäö, and the corresponding amino acids sequences are also listed.
(PDF)
S4 Fig. Phylogeny of BRR2 homologues.
BRR2 protein sequences of several organisms were aligned and a phylogenetic tree was generated. Branch lengths indicate distances. Numbers on the branch are bootstrap values of confidence in the displayed branches (n = 100). CAA94089.1, AAS78571.1 [Homo sapiens] (Hs); EAZ28547.1 [Oryza sativa] (Os); NP_001116729.1 [Danio rerio] (Dr); CAA97301.1, NP_011099.1 [Saccharomyces_cerevisiae] (Sc); NP_001185050.1 [Arabidopsia thaliana] (BRR2a), NP_181756.1 (BRR2b), NP_200922.2 (BRR2c); NP_648818.3 [Drosophila melanogaster] (Dm); NP_796188.2 [Mus musculus] (Mm); XP_001757495.1 [Physcomitrella_patens] (Pp); XP_002173505.1 [Schizosaccharomyces japonicus] (Sc j); XP_002318725.1, XP_002322252.1 [Populus trichocarpa] (Pt); XP_002581343.1 [Schistosoma mansoni] (Scm); XP_002966396.1, XP_002978166.1, XP_002981317.1 [Selaginella_moellendorffii] (Sm); XP_003546783.1, XP_003531516 [Glycine max] (Gm); XP_003571468.1 [Brachypodium distachyon] (Bd); XP_003595992.1 [Medicago truncatula] (Mt); XP_001703610.1 [Chlamydomonas reinhardtii] (Cr).
(PDF)
S5 Fig. Expression profiles of the Arabidopsis BRR2 paralogues in different organs.
The expression profile of the different BRR2 paralogues was generated from data in the Arabidopsis eFP Browser (Winter et al., 2007 [38]).
(PDF)
S6 Fig. Expression of major FLC regulators was not altered in brr2a-2.
(A) Expression of eight FLC repressors. (B) Expression of fifteen FLC activators. Quantitative RT-PCR was performed using RNA extracted from 15 day-old seedlings grown under SD conditions at ZT = 7. Relative expression to PP2a is shown as mean ± SE (n = 3).
(PDF)
S7 Fig. COOLAIR splicing is distorted in brr2a-2.
(A) Relative splicing of COOLAIR FLC antisense RNAs. The three most abundant COOLAIR transcripts, class Ii, class Iii and class IIii represent >99% of the total COOLAIR (Hornyik et al. 2010 [112]). Abundance of various COOLAIR transcripts was analyzed by quantitative RT-PCR using RNA extracted from 15 day-old seedlings grown under LD conditions. Primers were as described by Marquardt et al. 2014 [30]. Abundance relative to ACTIN2 is shown as mean ± SE (n = 3). (B) Comparison of the splicing efficiency of COOLAIR in Col and brr2a-2. COOLAIR class I was represented by class Ii, class II by class IIi and IIii. Intron retention was computed as (unspliced / (spliced + unspliced)). (C) Comparison of the splicing efficiency of COOLAIR in Col and brr2a-2 visualized as in (Marquardt et al. 2014 [30]). Splicing ratios (spliced/unspliced) are given normalized to the Col background control.
(PDF)
S8 Fig. Expression and intron retention of leaf development genes was altered in brr2a-2.
(A) Expression of TEOSINTE BRANCHED 1, CYCLOIDEA, AND PCF FAMILY 13 (TCP13), KIP-RELATED PROTEIN 6 (KRP6), KRP1, TCP24 and ASYMMETRIC LEAVES 1 (AS1) was significantly (p< = 0.05) altered in brr2a-2. Expression data are RPKM values from RNA-seq normalized to wild-type levels for each gene. Transcript levels of the remaining 98 leaf development genes (based on GO category GO:0009965) were not significantly altered. (B) Intron 1 of TCP13 was more retained in brr2a-2 than in wild type. Shown are RPKM values from RNA-seq normalized to wild-type levels for each intron. Numbers were corrected for changes in transcript amounts to reflect only differential splicing and not transcript abundance. Introns KRP1.I3, KRP6.I1, KRP6.I2 and KRP6.I3 did not generate any reads. Values in (A) and (B) are shown as mean ± SE (n = 3).
(PDF)
S9 Fig. Confirmation of differentially retained introns.
Splicing of 10 genes with increased intron retention in brr2a-2 according to the RNA-seq data was analyzed by splicing assays based on quantitative RT-PCR. RNA was extracted from 15 days old Col and brr2a-2 seedling grown in LD conditions. Intron retention was analyzed with primers designed to amplify unspliced and spliced transcript, respectively. RNA-seq and qPCR data are compared in a log-log plot. Shown are logarithms of intron retention fold changes (IR FC) between Col and brr2a-2. Data points are means of triplicates.
(PDF)
S10 Fig. Differentially retained introns in brr2a-2 have consensus splice site sequences.
The frequency of bases (green, A; blue, C; orange, G; red, T) surrounding the splice sites were calculated and plotted for all (A) and differentially retained introns (B). Sequence logos were created using the SeqLogo R package.
(PDF)
S11 Fig. Chromatin properties that do not differ between control introns and introns retained in brr2a-2.
Box plots show averaged genome-wide bisulfite sequencing and ChIP signals for exons (blue) and introns (green). DRI, differentially retained introns in brr2a-2. DRI gene, genes containing at least one differentially retained intron. Thus, the boxes in each plot represent, from left to right, (i) exons from genes that have no DRIs, (ii) exons from genes that have at least one DRI, (iii) normally spliced introns in genes that have at least one DRI, (iv) DRIs, and (v) introns from genes that have no DRIs. Control genes without DRIs were selected to have the same median expression as the DRI genes. No difference is significant (p>0.01) in Wilcoxon signed-rank tests.
(PDF)
S1 Table. Amino acid identity (first number) and similarity (second number) between yeast Brr2p and Arabidopsis BRR2 paralogues.
(PDF)
S2 Table. Sequencing and read mapping details for the RNA-seq experiment.
(PDF)
S3 Table. Genes with increased transcript levels in brr2a-2.
(XLSX)
S4 Table. Genes with decreased transcript levels in brr2a-2.
(XLSX)
S5 Table. GO categories enriched among genes with decreased transcript levels in brr2a-2.
(XLSX)
S6 Table. GO categories enriched among genes with increased transcript levels in brr2a-2.
(XLSX)
S7 Table. Introns with increased retention in brr2a-2.
(XLSX)
S8 Table. Introns with decreased retention in brr2a-2.
(XLSX)
S9 Table. Lists of primers used.
(PDF)
Acknowledgments
We thank Christian Beisel at the ETH Department of Biosystems Science and Engineering for Illumina sequencing and Cecilia Wärdig for technical help.
Author Contributions
Conceived and designed the experiments: LH CK WM. Performed the experiments: WM JS DDF VE. Analyzed the data: RMV AS MSTA. Wrote the paper: WM WG CK LH.
Song YH, Ito S, Imaizumi T. Flowering time regulation: photoperiod- and temperature-sensing in leaves. Trends Plant Sci 2013; 18:575-83. doi: 10.1016/j.tplants.2013.05.003. pmid:23790253
Romera-Branchat M, Andres F, Coupland G. Flowering responses to seasonal cues: what's new? Curr Opin Plant Biol 2014; 21:120-27. doi: 10.1016/j.pbi.2014.07.006. pmid:25072635
Wang JW. Regulation of flowering time by the miR156-mediated age pathway. J Exp Bot 2014; 65:4723-30. doi: 10.1093/jxb/eru246. pmid:24958896
Verhage L, Angenent GC, Immink RG. Research on floral timing by ambient temperature comes into blossom. Trends Plant Sci 2014; 19:583-91. doi: 10.1016/j.tplants.2014.03.009. pmid:24780095
Andres F, Coupland G. The genetic basis of flowering responses to seasonal cues. Nat Rev Genet 2012; 13:627-39. doi: 10.1038/nrg3291. pmid:22898651
Johansson M, Staiger D. Time to flower: interplay between photoperiod and the circadian clock. J Exp Bot 2015; 66:719-30. doi: 10.1093/jxb/eru441. pmid:25371508
Bouveret R, Schönrock N, Gruissem W, Hennig L. Regulation of flowering time by Arabidopsis MSI1. Development 2006; 133:1693-702. pmid:16554362 doi: 10.1242/dev.02340
Steinbach Y, Hennig L. Arabidopsis MSI1 functions in photoperiodic flowering time control. Front Plant Sci 2014; 5:77. doi: 10.3389/fpls.2014.00077. pmid:24639681
Zografos BR, Sung S. Vernalization-mediated chromatin changes. J Exp Bot 2012; 63:4343-48. doi: 10.1093/jxb/ers157. pmid:22685309
He Y, Michaels SD, Amasino RM. Regulation of flowering time by histone acetylation in Arabidopsis. Science 2003; 302:1751-54. pmid:14593187 doi: 10.1126/science.1091109
Ausin I, Alonso-Blanco C, Jarillo JA, Ruiz-Garcia L, Martinez-Zapater JM. Regulation of flowering time by FVE, a Retinoblastoma-associated protein. Nat Genet 2004; 36:162-66. pmid:14745447 doi: 10.1038/ng1295
Kim HJ, Hyun Y, Park JY, Park MJ, Park MK, Kim MD, et al. A genetic link between cold responses and flowering time through FVE in Arabidopsis thaliana. Nat Genet 2004; 36:167-71. pmid:14745450 doi: 10.1038/ng1298
Noh B, Lee SH, Kim HJ, Yi G, Shin EA, Lee M, et al. Divergent roles of a pair of homologous jumonji/zinc-finger-class transcription factor proteins in the regulation of Arabidopsis flowering time. Plant Cell 2004; 16:2601-13. pmid:15377760 doi: 10.1105/tpc.104.025353
Simpson GG, Dijkwel PP, Quesada V, Henderson I, Dean C. Fy is an RNA 3' end-processing factor that interacts with fca to control the Arabidopsis floral transition. Cell 2003; 113:777-87. pmid:12809608 doi: 10.1016/s0092-8674(03)00425-2
Schomburg FM, Patton DA, Meinke DW, Amasino RM. FPA, a gene involved in floral induction in Arabidopsis, encodes a protein containing RNA-recognition motifs. Plant Cell 2001; 13:1427-36. pmid:11402170 doi: 10.2307/3871305
Lim MH, Kim J, Kim YS, Chung KS, Seo YH, Lee I, et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell 2004; 16:731-40. pmid:14973162 doi: 10.1105/tpc.019331
Mockler TC, Yu X, Shalitin D, Parikh D, Michael TP, Liou J, et al. Regulation of flowering time in Arabidopsis by K homology domain proteins. Proc Natl Acad Sci U S A 2004; 101:12759-64. pmid:15310842 doi: 10.1073/pnas.0404552101
Lee I, Aukerman MJ, Gore SL, Lohman KN, Michaels SD, Weaver LM, et al. Isolation of LUMINIDEPENDENS: a gene involved in the control of flowering time in Arabidopsis. Plant Cell 1994; 6:75-83. pmid:7907507 doi: 10.2307/3869676
Quesada V, Dean C, Simpson GG. Regulated RNA processing in the control of Arabidopsis flowering. Int J Dev Biol 2005; 49:773-80. pmid:16096981 doi: 10.1387/ijdb.051995vq
Reddy AS, Marquez Y, Kalyna M, Barta A. Complexity of the alternative splicing landscape in plants. Plant Cell 2013; 25:3657-83. doi: 10.1105/tpc.113.117523. pmid:24179125
Staiger D, Brown JW. Alternative splicing at the intersection of biological timing, development, and stress responses. Plant Cell 2013; 25:3640-56. doi: 10.1105/tpc.113.113803. pmid:24179132
Matera AG, Wang Z. A day in the life of the spliceosome. Nat Rev Mol Cell Biol 2014; 15:108-21. doi: 10.1038/nrm3742. pmid:24452469
Staley JP, Guthrie C. An RNA switch at the 5' splice site requires ATP and the DEAD box protein Prp28p. Mol Cell 1999; 3:55-64. pmid:10024879 doi: 10.1016/s1097-2765(00)80174-4
Raghunathan PL, Guthrie C. RNA unwinding in U4/U6 snRNPs requires ATP hydrolysis and the DEIH-box splicing factor Brr2. Curr Biol 1998; 8:847-55. pmid:9705931 doi: 10.1016/s0960-9822(07)00345-4
Kuhn AN, Reichl EM, Brow DA. Distinct domains of splicing factor Prp8 mediate different aspects of spliceosome activation. Proc Natl Acad Sci U S A 2002; 99:9145-49. pmid:12087126 doi: 10.1073/pnas.102304299
Silverman E, Edwalds-Gilbert G, Lin RJ. DExD/H-box proteins and their partners: helping RNA helicases unwind. Gene 2003; 312:1-16. pmid:12909336 doi: 10.1016/s0378-1119(03)00626-7
Macknight R, Duroux M, Laurie R, Dijkwel P, Simpson G, Dean C. Functional significance of the alternative transcript processing of the Arabidopsis floral promoter FCA. Plant Cell 2002; 14:877-88. pmid:11971142 doi: 10.1105/tpc.010456
Herr AJ, Molnar A, Jones A, Baulcombe DC. Defective RNA processing enhances RNA silencing and influences flowering of Arabidopsis. Proc Natl Acad Sci U S A 2006; 103:14994-5001. pmid:17008405 doi: 10.1073/pnas.0606536103
Sonmez C, Baurle I, Magusin A, Dreos R, Laubinger S, Weigel D, et al. RNA 3' processing functions of Arabidopsis FCA and FPA limit intergenic transcription. Proc Natl Acad Sci U S A 2011; 108:8508-13. doi: 10.1073/pnas.1105334108. pmid:21536901
Marquardt S, Raitskin O, Wu Z, Liu F, Sun Q, Dean C. Functional consequences of splicing of the antisense transcript COOLAIR on FLC transcription. Mol Cell 2014; 54:156-65. doi: 10.1016/j.molcel.2014.03.026. pmid:24725596
Exner V, Aichinger E, Shu H, Wildhaber T, Alfarano P, Caflisch A, et al. The chromodomain of LIKE HETEROCHROMATIN PROTEIN 1 is essential for H3K27me3 binding and function during Arabidopsis development. PLoS ONE 2009; 4:e5335. doi: 10.1371/journal.pone.0005335. pmid:19399177
Exner V, Alexandre C, Rosenfeldt G, Alfarano P, Nater M, Caflisch A, et al. A gain-of-function mutation of Arabidopsis cryptochrome1 promotes flowering. Plant Physiol 2010; 154:1633-45. doi: 10.1104/pp.110.160895. pmid:20926618
Tzafrir I, Pena-Muralla R, Dickerman A, Berg M, Rogers R, Hutchens S, et al. Identification of genes required for embryo development in Arabidopsis. Plant Physiol 2004; 135:1206-20. pmid:15266054 doi: 10.1104/pp.104.045179
Liu M, Yuan L, Liu NY, Shi DQ, Liu J, Yang WC. GAMETOPHYTIC FACTOR 1, involved in pre-mRNA splicing, is essential for megagametogenesis and embryogenesis in Arabidopsis. J Integr Plant Biol 2009; 51:261-71. doi: 10.1111/j.1744-7909.2008.00783.x. pmid:19261069
Zhang L, Xu T, Maeder C, Bud LO, Shanks J, Nix J, et al. Structural evidence for consecutive Hel308-like modules in the spliceosomal ATPase Brr2. Nat Struct Mol Biol 2009; 16:731-39. doi: 10.1038/nsmb.1625. pmid:19525970
Pena V, Jovin SM, Fabrizio P, Orlowski J, Bujnicki JM, Luhrmann R, et al. Common design principles in the spliceosomal RNA helicase Brr2 and in the Hel308 DNA helicase. Mol Cell 2009; 35:454-66. doi: 10.1016/j.molcel.2009.08.006. pmid:19716790
Koncz C, Dejong F, Villacorta N, Szakonyi D, Koncz Z. The spliceosome-activating complex: molecular mechanisms underlying the function of a pleiotropic regulator. Front Plant Sci 2012; 3:9. doi: 10.3389/fpls.2012.00009. pmid:22639636
Winter D, Vinegar B, Nahal H, Ammar R, Wilson GV, Provart NJ. An "Electronic Fluorescent Pictograph" browser for exploring and analyzing large-scale biological data sets. PLoS One 2007; 2:e718. pmid:17684564 doi: 10.1371/journal.pone.0000718
Michaels SD, Amasino RM. FLOWERING LOCUS C encodes a novel MADS domain protein that acts as a repressor of flowering. Plant Cell 1999; 11:949-56. pmid:10330478 doi: 10.2307/3870827
Sheldon CC, Burn JE, Perez PP, Metzger J, Edwards JA, Peacock WJ, et al. The FLF MADS box gene: a repressor of flowering in Arabidopsis regulated by vernalization and methylation. Plant Cell 1999; 11:445-58. pmid:10072403 doi: 10.2307/3870872
Michaels SD, Amasino RM. Loss of FLOWERING LOCUS C activity eliminates the late-flowering phenotype of FRIGIDA and autonomous pathway mutations but not responsiveness to vernalization. Plant Cell 2001; 13:935-41. pmid:11283346 doi: 10.2307/3871350
Ratcliffe OJ, Nadzan GC, Reuber TL, Riechmann JL. Regulation of flowering in Arabidopsis by an FLC homologue. Plant Physiol 2001; 126:122-32. pmid:11351076 doi: 10.1104/pp.126.1.122
Ratcliffe OJ, Kumimoto RW, Wong BJ, Riechmann JL. Analysis of the Arabidopsis MADS AFFECTING FLOWEING gene family: MAF2 prevents vernalization by short periods of cold. Plant Cell 2003; 15:1159-69. pmid:12724541 doi: 10.1105/tpc.009506
Swiezewski S, Liu F, Magusin A, Dean C. Cold-induced silencing by long antisense transcripts of an Arabidopsis Polycomb target. Nature 2009; 462:799-802. doi: 10.1038/nature08618. pmid:20010688
Brogna S, Wen J. Nonsense-mediated mRNA decay (NMD) mechanisms. Nat Struct Mol Biol 2009; 16:107-13. doi: 10.1038/nsmb.1550. pmid:19190664
Koyama T, Mitsuda N, Seki M, Shinozaki K, Ohme-Takagi M. TCP transcription factors regulate the activities of ASYMMETRIC LEAVES1 and miR164, as well as the auxin response, during differentiation of leaves in Arabidopsis. Plant Cell 2010; 22:3574-88. doi: 10.1105/tpc.110.075598. pmid:21119060
Wang H, Zhou Y, Gilmer S, Whitwill S, Fowke LC. Expression of the plant cyclin-dependent kinase inhibitor ICK1 affects cell division, plant growth and morphology. Plant J 2000; 24:613-23. pmid:11123800 doi: 10.1046/j.1365-313x.2000.00899.x
Han W, Rhee HI, Cho JW, Ku MS, Song PS, Wang MH. Overexpression of Arabidopsis ACK1 alters leaf morphology and retards growth and development. Biochem Biophys Res Commun 2005; 330:887-90. pmid:15809079 doi: 10.1016/j.bbrc.2005.03.056
Foissac S, Sammeth M. ASTALAVISTA: dynamic and flexible analysis of alternative splicing events in custom gene datasets. Nucleic Acids Res 2007; 35:W297-99. pmid:17485470 doi: 10.1093/nar/gkm311
Marquez Y, Brown JW, Simpson C, Barta A, Kalyna M. Transcriptome survey reveals increased complexity of the alternative splicing landscape in Arabidopsis. Genome Res 2012; 22:1184-95. doi: 10.1101/gr.134106.111. pmid:22391557
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol 2014; 15:550. pmid:25516281 doi: 10.1186/s13059-014-0550-8
Nieto Moreno N, Giono LE, Cambindo Botto AE, Munoz MJ, Kornblihtt AR. Chromatin, DNA structure and alternative splicing. FEBS Lett 2015; 589:3370-78. doi: 10.1016/j.febslet.2015.08.002. pmid:26296319
Noble SM, Guthrie C. Identification of novel genes required for yeast pre-mRNA splicing by means of cold-sensitive mutations. Genetics 1996; 143:67-80. pmid:8722763
Laggerbauer B, Achsel T, Luhrmann R. The human U5-200kD DEXH-box protein unwinds U4/U6 RNA duplices in vitro. Proc Natl Acad Sci U S A 1998; 95:4188-92. pmid:9539711 doi: 10.1073/pnas.95.8.4188
Bessonov S, Anokhina M, Will CL, Urlaub H, Luhrmann R. Isolation of an active step I spliceosome and composition of its RNP core. Nature 2008; 452:846-50. doi: 10.1038/nature06842. pmid:18322460
Small EC, Leggett SR, Winans AA, Staley JP. The EF-G-like GTPase Snu114p regulates spliceosome dynamics mediated by Brr2p, a DExD/H box ATPase. Mol Cell 2006; 23:389-99. pmid:16885028 doi: 10.1016/j.molcel.2006.05.043
Hahn D, Kudla G, Tollervey D, Beggs JD. Brr2p-mediated conformational rearrangements in the spliceosome during activation and substrate repositioning. Genes Dev 2012; 26:2408-21. doi: 10.1101/gad.199307.112. pmid:23124065
Bottner CA, Schmidt H, Vogel S, Michele M, Kaufer NF. Multiple genetic and biochemical interactions of Brr2, Prp8, Prp31, Prp1 and Prp4 kinase suggest a function in the control of the activation of spliceosomes in Schizosaccharomyces pombe. Curr Genet 2005; 48:151-61. pmid:16133344 doi: 10.1007/s00294-005-0013-6
Bellare P, Kutach AK, Rines AK, Guthrie C, Sontheimer EJ. Ubiquitin binding by a variant Jab1/MPN domain in the essential pre-mRNA splicing factor Prp8p. RNA 2006; 12:292-302. pmid:16428608 doi: 10.1261/rna.2152306
Mozaffari-Jovin S, Wandersleben T, Santos KF, Will CL, Luhrmann R, Wahl MC. Inhibition of RNA helicase Brr2 by the C-terminal tail of the spliceosomal protein Prp8. Science 2013; 341:80-84. doi: 10.1126/science.1237515. pmid:23704370
Santos KF, Jovin SM, Weber G, Pena V, Luhrmann R, Wahl MC. Structural basis for functional cooperation between tandem helicase cassettes in Brr2-mediated remodeling of the spliceosome. Proc Natl Acad Sci U S A 2012; 109:17418-23. doi: 10.1073/pnas.1208098109. pmid:23045696
Brenner TJ, Guthrie C. Genetic analysis reveals a role for the C terminus of the Saccharomyces cerevisiae GTPase Snu114 during spliceosome activation. Genetics 2005; 170:1063-80. pmid:15911574 doi: 10.1534/genetics.105.042044
Maeder C, Kutach AK, Guthrie C. ATP-dependent unwinding of U4/U6 snRNAs by the Brr2 helicase requires the C terminus of Prp8. Nat Struct Mol Biol 2009; 16:42-48. doi: 10.1038/nsmb.1535. pmid:19098916
Monaghan J, Xu F, Gao M, Zhao Q, Palma K, Long C, et al. Two Prp19-like U-box proteins in the MOS4-associated complex play redundant roles in plant innate immunity. PLoS Pathog 2009; 5:e1000526. doi: 10.1371/journal.ppat.1000526. pmid:19629177
Kalve S, De Vos D, Beemster GT. Leaf development: a cellular perspective. Front Plant Sci 2014; 5:362. doi: 10.3389/fpls.2014.00362. pmid:25132838
Martin-Trillo M, Cubas P. TCP genes: a family snapshot ten years later. Trends Plant Sci 2010; 15:31-39. doi: 10.1016/j.tplants.2009.11.003. pmid:19963426
Lopez JA, Sun Y, Blair PB, Mukhtar MS. TCP three-way handshake: linking developmental processes with plant immunity. Trends Plant Sci 2015; 20:238-45. doi: 10.1016/j.tplants.2015.01.005. pmid:25655280
Danisman S, van Dijk AD, Bimbo A, van der Wa F, Hennig L, de Folter S, et al. Analysis of functional redundancies within the Arabidopsis TCP transcription factor family. J Exp Bot 2013; 64:5673-85. doi: 10.1093/jxb/ert337. pmid:24129704
Schommer C, Debernardi JM, Bresso EG, Rodriguez RE, Palatnik JF. Repression of cell proliferation by miR319-regulated TCP4. Mol Plant 2014; 7:1533-44. doi: 10.1093/mp/ssu084. pmid:25053833
Searle I, He Y, Turck F, Vincent C, Fornara F, Krober S, et al. The transcription factor FLC confers a flowering response to vernalization by repressing meristem competence and systemic signaling in Arabidopsis. Genes Dev 2006; 20:898-912. pmid:16600915 doi: 10.1101/gad.373506
Helliwell CA, Wood CC, Robertson M, James Peacock W, Dennis ES. The Arabidopsis FLC protein interacts directly in vivo with SOC1 and FT chromatin and is part of a high-molecular-weight protein complex. Plant J 2006; 46:183-92. pmid:16623882 doi: 10.1111/j.1365-313x.2006.02686.x
Ripoll JJ, Rodriguez-Cazorla E, Gonzalez-Reig S, Andujar A, Alonso-Cantabrana H, Perez-Amador MA, et al. Antagonistic interactions between Arabidopsis K-homology domain genes uncover PEPPER as a positive regulator of the central floral repressor FLOWERING LOCUS C. Dev Biol 2009; 333:251-62. doi: 10.1016/j.ydbio.2009.06.035. pmid:19576878
Porrua O, Libri D. RNA quality control in the nucleus: the Angels' share of RNA. Biochim Biophys Acta 2013; 1829:604-11. doi: 10.1016/j.bbagrm.2013.02.012. pmid:23474120
Alexander RD, Innocente SA, Barrass JD, Beggs JD. Splicing-dependent RNA polymerase pausing in yeast. Mol Cell 2010; 40:582-93. doi: 10.1016/j.molcel.2010.11.005. pmid:21095588
Konig H, Matter N, Bader R, Thiele W, Muller F. Splicing segregation: the minor spliceosome acts outside the nucleus and controls cell proliferation. Cell 2007; 131:718-29. pmid:18022366 doi: 10.1016/j.cell.2007.09.043
Otake LR, Scamborova P, Hashimoto C, Steitz JA. The divergent U12-type spliceosome is required for pre-mRNA splicing and is essential for development in Drosophila. Mol Cell 2002; 9:439-46. pmid:11864616 doi: 10.1016/s1097-2765(02)00441-0
Kim WY, Jung HJ, Kwak KJ, Kim MK, Oh SH, Han YS, et al. The Arabidopsis U12-type spliceosomal protein U11/U12-31K is involved in U12 intron splicing via RNA chaperone activity and affects plant development. Plant Cell 2010; 22:3951-62. doi: 10.1105/tpc.110.079103. pmid:21148817
Gross-Hardt R, Kagi C, Baumann N, Moore JM, Baskar R, Gagliano WB, et al. LACHESIS restricts gametic cell fate in the female gametophyte of Arabidopsis. PLoS Biol 2007; 5:e47. pmid:17326723 doi: 10.1371/journal.pbio.0050047
Volz R, von Lyncker L, Baumann N, Dresselhaus T, Sprunck S, Gross-Hardt R. LACHESIS-dependent egg-cell signaling regulates the development of female gametophytic cells. Development 2012; 139:498-502. doi: 10.1242/dev.075234. pmid:22190635
Naftelberg S, Schor IE, Ast G, Kornblihtt AR. Regulation of alternative splicing through coupling with transcription and chromatin structure. Annu Rev Biochem 2015; 84:165-98. doi: 10.1146/annurev-biochem-060614-034242. pmid:26034889
Luco RF, Pan Q, Tominaga K, Blencowe BJ, Pereira-Smith OM, Misteli T. Regulation of alternative splicing by histone modifications. Science 2010; 327:996-1000. doi: 10.1126/science.1184208. pmid:20133523
Gonzalez I, Munita R, Agirre E, Dittmer TA, Gysling K, Misteli T, et al. A lncRNA regulates alternative splicing via establishment of a splicing-specific chromatin signature. Nat Struct Mol Biol 2015; 22:370-76. doi: 10.1038/nsmb.3005. pmid:25849144
Csorba T, Questa JI, Sun Q, Dean C. Antisense COOLAIR mediates the coordinated switching of chromatin states at FLC during vernalization. Proc Natl Acad Sci U S A 2014; 111:16160-65. doi: 10.1073/pnas.1419030111. pmid:25349421
Lev Maor G, Yearim A, Ast G. The alternative role of DNA methylation in splicing regulation. Trends Genet 2015; 31:274-80. doi: 10.1016/j.tig.2015.03.002. pmid:25837375
Regulski M, Lu Z, Kendall J, Donoghue MT, Reinders J, Llaca V, et al. The maize methylome influences mRNA splice sites and reveals widespread paramutation-like switches guided by small RNA. Genome Res 2013; 23:1651-62. doi: 10.1101/gr.153510.112. pmid:23739895
Ong-Abdullah M, Ordway JM, Jiang N, Ooi SE, Kok SY, Sarpan N, et al. Loss of Karma transposon methylation underlies the mantled somaclonal variant of oil palm. Nature 2015; 525:533-37. doi: 10.1038/nature15365. pmid:26352475
Johanson U, West J, Lister C, Michaels S, Amasino R, Dean C. Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis flowering time. Science 2000; 290:344-47. pmid:11030654 doi: 10.1126/science.290.5490.344
Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol 2009; 10:R25. doi: 10.1186/gb-2009-10-3-r25. pmid:19261174
Austin RS, Vidaurre D, Stamatiou G, Breit R, Provart NJ, Bonetta D, et al. Next-generation mapping of Arabidopsis genes. Plant J 2011; 67:715-25. doi: 10.1111/j.1365-313X.2011.04619.x. pmid:21518053
Neff MM, Turk E, Kalishman M. Web-based primer design for single nucleotide polymorphism analysis. Trends Genet 2002; 18:613-15. pmid:12446140 doi: 10.1016/s0168-9525(02)02820-2
Alexandre C, Möller-Steinbach Y, Schönrock N, Gruissem W, Hennig L. Arabidopsis MSI1 is required for negative regulation of the response to drought stress. Mol Plant 2009; 2:675-87. doi: 10.1093/mp/ssp012. pmid:19825648
Simon P. Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics 2003; 19:1439-40. pmid:12874059 doi: 10.1093/bioinformatics/btg157
Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011; 28:2731-39. doi: 10.1093/molbev/msr121. pmid:21546353
Andrews S. FastQC--A quality control tool for high throughput sequence data 2012. Available from URL: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 2014; 30:2114-20. doi: 10.1093/bioinformatics/btu170. pmid:24695404
Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol 2013; 14:R36. doi: 10.1186/gb-2013-14-4-r36. pmid:23618408
Roberts A, Pimentel H, Trapnell C, Pachter L. Identification of novel transcripts in annotated genomes using RNA-Seq. Bioinformatics 2011; 27:2325-29. doi: 10.1093/bioinformatics/btr355. pmid:21697122
Anders S, Pyl PT, Huber W. HTSeq-a Python framework to work with high-throughput sequencing data. Bioinformatics 2015; 31:166-69. doi: 10.1093/bioinformatics/btu638. pmid:25260700
Risso D, Ngai J, Speed TP, Dudoit S. Normalization of RNA-seq data using factor analysis of control genes or samples. Nat Biotechnol 2014; 32:896-902. doi: 10.1038/nbt.2931. pmid:25150836
Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. J Royal Stat Soc Ser B 1995; 57:289-300
Tabas-Madrid D, Nogales-Cadenas R, Pascual-Montano A. GeneCodis3: a non-redundant and modular enrichment analysis tool for functional genomics. Nucleic Acids Res 2012; 40:W478-83. doi: 10.1093/nar/gks402. pmid:22573175
Rutowicz K, Puzio M, Halibart-Puzio J, Lirski M, Kotlinski M, Kroten MA, et al. A Specialized Histone H1 Variant Is Required for Adaptive Responses to Complex Abiotic Stress and Related DNA Methylation in Arabidopsis. Plant Physiol 2015; 169:2080-101. doi: 10.1104/pp.15.00493. pmid:26351307
Rehrauer H, Aquino C, Gruissem W, Henz SR, Hilson P, Laubinger S, et al. AGRONOMICS1: A new resource for Arabidopsis transcriptome profiling. Plant Physiol 2010; 152:487-99. doi: 10.1104/pp.109.150185. pmid:20032078
Zhang X, Bernatavichute YV, Cokus S, Pellegrini M, Jacobsen SE. Genome-wide analysis of mono-, di- and trimethylation of histone H3 lysine 4 in Arabidopsis thaliana. Genome Biol 2009; 10:R62. doi: 10.1186/gb-2009-10-6-r62. pmid:19508735
Luo C, Sidote DJ, Zhang Y, Kerstetter RA, Michael TP, Lam E. Integrative analysis of chromatin states in Arabidopsis identified potential regulatory mechanisms for natural antisense transcript production. Plant J 2013; 73:77-90. doi: 10.1111/tpj.12017. pmid:22962860
Brusslan JA, Bonora G, Rus-Canterbury AM, Tariq F, Jaroszewicz A, Pellegrini M. A Genome-Wide Chronological Study of Gene Expression and Two Histone Modifications, H3K4me3 and H3K9ac, during Developmental Leaf Senescence. Plant Physiol 2015; 168:1246-61. doi: 10.1104/pp.114.252999. pmid:25802367
Zemach A, McDaniel IE, Silva P, Zilberman D. Genome-wide evolutionary analysis of eukaryotic DNA methylation. Science 2010; 328:916-19. doi: 10.1126/science.1186366. pmid:20395474
Lafos M, Kroll P, Hohenstatt ML, Thorpe FL, Clarenz O, Schubert D. Dynamic regulation of H3K27 trimethylation during Arabidopsis differentiation. PLoS Genet. 2011; 7: e1002040. doi: 10.1371/journal.pgen.1002040. pmid:21490956
Mahrez W, Trejo Arellano MS, Moreno-Romero J, Nakamura M, Shu H, Nanni P, Köhler C, Gruissem W, Hennig L. H3K36ac is an evolutionary conserved plant histone modification that marks active genes. Plant Physiol. 2016. (in press)
Meyer M, Plass M, Perez-Valle J, Eyras E, Vilardell J. Deciphering 3'ss selection in the yeast genome reveals an RNA thermosensor that mediates alternative splicing. Mol Cell 2011; 43:1033-39. doi: 10.1016/j.molcel.2011.07.030. pmid:21925391
Hofacker IL. RNA secondary structure analysis using the Vienna RNA package. Curr Protoc Bioinformatics 2009; Chapter 12. doi: 10.1002/0471250953.bi1202s26
Hornyik C., Terzi L.C. and Simpson G.G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell 2010; 18: 203-213. doi: 10.1016/j.devcel.2009.12.009. pmid:20079695
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2016 Public Library of Science. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited: Splicing. PLoS Genet 12(4): e1005924. doi:10.1371/journal.pgen.1005924
Abstract
Several pathways control time to flowering in Arabidopsis thaliana through transcriptional and posttranscriptional gene regulation. In recent years, mRNA processing has gained interest as a critical regulator of flowering time control in plants. However, the molecular mechanisms linking RNA splicing to flowering time are not well understood. In a screen for Arabidopsis early flowering mutants we identified an allele of BRR2a. BRR2 proteins are components of the spliceosome and highly conserved in eukaryotes. Arabidopsis BRR2a is ubiquitously expressed in all analyzed tissues and involved in the processing of flowering time gene transcripts, most notably FLC. A missense mutation of threonine 895 in BRR2a caused defects in FLC splicing and greatly reduced FLC transcript levels. Reduced FLC expression increased transcription of FT and SOC1 leading to early flowering in both short and long days. Genome-wide experiments established that only a small set of introns was not correctly spliced in the brr2a mutant. Compared to control introns, retained introns were often shorter and GC-poor, had low H3K4me1 and CG methylation levels, and were often derived from genes with a high-H3K27me3-low-H3K36me3 signature. We propose that BRR2a is specifically needed for efficient splicing of a subset of introns characterized by a combination of factors including intron size, sequence and chromatin, and that FLC is most sensitive to splicing defects.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer





