The role of inflammatory cytokines and ERK1/2 signaling in chronic prostatitis/chronic pelvic pain syndrome with related mental health disorders

Abstract

Mental health disorders(MHD) in chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) have been widely studied. However, the underlying role of inflammatory cytokines and their associated signaling pathways have not been investigated. Here, we report the potential role of cytokines and associated signaling pathways in CP/CPPS patients with MHD and in a CP/CPPS animal model. CP/CPPS patients (n = 810) and control subjects (n = 992) were enrolled in this case-control multicenter study, and serum cytokine levels were measured. Male Sprague-Dawley rats received multiple intracutaneous injections of an immuno-agent along with a pertussis-diphtheria-tetanus triple vaccine for autoimmune CP/CPPS development. The results revealed that, in CP/CPPS patients with significant MHD, elevated IL-1α, IL-1β, IL-4, IL-13, and TNF-α serum levels were observed. The above five cytokines in CP/CPPS rats were significantly elevated in prostate tissue (p < 0.05), and IL-1β levels were elevated in serum and cerebrospinal fluid. In behavioral tests, CP/CPPS rats showed anxiety- and depression-like symptoms, and impaired spatial and associative memory performance (p < 0.05). In the CP/CPPS group, ERK1/2 phosphorylation levels were increased in the amygdala and nucleus accumbens, and decreased in the hippocampus, but not caudate nucleus. Thus, prostate-derived cytokines, especially IL-1β, cross the blood brain barrier and may lead to enhanced ERK1/2 signaling in several brain areas, possibly underlying induction of CP/CPPS-related MHD.

R A

P

Hu, Z Chen Li , Cui Zhu Lin

= =

, p< p<

Chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) is a commonly observed distress in male patients which is characterized by chronic pelvic discomfort, with voiding symptoms, sexual dysfunction, and associated mental health disorders (MHD)1. Though current antibiotic, alpha-blocker, and electro-magnetic therapy seems promising, the efficient treatment of CP/CPPS remains rare24. Therefore, there remains a high burden of MHD in CP/CPPS patients5,6. Among these MHD, depression has been identied in 78% of patients with CP/CPPS and 60% of them fall in the major depressive disorder category7. Male patients with CP/CPPS display higher stress levels and 62% of them show anxiety symptoms8,9. Hypothalamic-pituitary-adrenal axis dysfunction, pain, and personality changes have been suggested to be closely associated with the psychological proles of CP/CPPS patients6,8,10. Farmer et al. reported specic pattern of functional brain activation and brain anatomical reorganization in CP/CPPS during neuroimaging studies, which hinted the potential correlation between peripheral dysfunction and central mechanism11. However, the investigation of inammatory cytokines and their potential interactions with specic brain areas in CP/CPPS with MHD has rarely been reported. Increasing evidence

P. R. China. State China. Liver Cancer Institute, Zhongshan Hospital, Fudan University & Key Laboratory of Carcinogenesis and Cancer Department of Urology, University of California,

SCIENTIFIC REPORTS

1

www.nature.com/scientificreports/

Controls CP/CPPS

No. of subjects 992 810

Age (yrs.) 30.78.40 32.29.52BMI (kg/m2) 23.13.07 23.63.41NIH-CPSI 3.25.03* 24.76.39*Anxiety (%) 17 (1.71%)** 247(30.50%)**SAS 27.34.98* 37.67.51*Depression (%) 99 (9.97%)** 351 (43.33%)**SDS 32.15.67* 40.47.81*

Table 1. Clinical and mental parameters of control subjects and CP/CPPS patients. CP/CPPS: chronic prostatitis/chronic pelvic pain syndrome; BMI: body mass index; NIH-CPSI: National Institutes of Health Chronic Prostatitis Symptom Index; SAS: self anxiety scale; SDS: self depression scale; Mean valuesSD are reported for all parameters. *p< 0.0001 (Students t-test). **p< 0.05 (chi-square test).

Concentration (pg/ml) Correlation coefficient (r)

Controls CP/CPPS NIH-CPSI SAS SDS IL-1 4.2920.435 8.6171.105* 0.144 0.020 0.094 IL-1 4.6850.727 7.8401.244* 0.232 0.438** 0.373** IL-4 0.9000.119 3.2870.879* 0.020 0.005 0.013 IL-6 4.8670.302 5.9070.733 0.009 0.142** 0.176** IL-8 6.6800.79 8.0150.857 2.586 1.958 2.366**

IL-10 0.8660.035 0.9700.057 0.016** 0.003 0.005

IL-13 0.2530.017 0.5790.074* 0.005 0.002 0.002 MCP-1 175.15.873 191.56.848 1.449 0.514 0.128 TNF- 5.4220.486 8.1510.947* 0.425** 0.349** 0.290** IFN- 2.0910.192 2.4010.282 0.007 0.023 0.057

Table 2. Serum cytokine levels in control subjects and CP/CPPS patients, and their correlation with NIHCPSI, SAS, and SDS. IL: interleukin; MCP: monocyte chemokine protein; TNF: tumor necrosis factor; IFN: interferon; Mean values SD are reported for all parameters. *CP/CPPS compared to controls when p<0.05 (Students t-test). **The index correlated to cytokines when p< 0.05 (Spearman rank correlation).

support that autoimmunity is a major cause of dysfunction of the organs involved in CP/CPPS in both humans and in rodent models of autoimmune CP/CPPS1215. Furthermore, inammatory cytokines play a critical role in pathogenesis of autoimmune dysfunction and prove to be closely correlated to anxiety and depression1621.

Nevertheless, there is no study evaluating anxiety levels and depression-like behavior, and their correlation with inammatory cytokine levels in human CP/CPPS or rodent models.

Over the last decades neuroscience research has identied specic brain areas, such as the basolateral amygdala (BLA), nucleus accumbens (NAc), hippocampus (Hippo), and caudate nucleus (Cau), which are related to anxiety, depression, and spatial and associative memory2225. Synaptic plasticity is the cellular mechanism underlying cerebral physiological function26. Several reports have shown that the dysfunction of synaptic plasticity in the above brain areas is related to brain dysfunctions, such as anxiety, depression, and memory impairment2729.

The extracellular signal-regulated protein kinase (ERK1/2) signaling pathway is part of the complex network of signaling pathways implicated in synaptic plasticity, and the alteration of ERK1/2 signaling in neurons has been associated with impairment of structural plasticity, mood disorders, and MHD30,31.

Thus, to explore the molecular mechanisms underlying CP/CPPS associated MHD, psychological status and proles of serum inammatory cytokine levels were examined in CP/CPPS patients. Furthermore, behavioral performance of anxiety and depression, learning and memory disturbances, cytokine levels in prostates and cerebrospinal uid (CSF), and alterations of ERK1/2 signaling were studied in specic brain areas in a rodent model of CP/CPPS.

Baseline clinical and mental parameters of recruited control subjects and CP/CPPS patients revealed no signicant dierences in age and BMI (Table1). Signicantly increased number of CP/CPPS patients displayed signs of anxiety or depression compared with control subjects as determined by higher scores with cut-o score of 50 (p< 0.05). Consistently, SAS, and SDS scores of CP/CPPS patients were signicantly elevated compared with control subjects (p<0.0001).

The serum levels of the cytokines IL-1, IL-1, IL-4, IL-6, IL-8, IL-10, IL-13, MCP-1, TNF- and IFN- were measured in CP/CPPS patients and control subjects (Table2). The levels of IL-1, IL-1, IL-4, IL-13, and TNF- were signicantly increased compared with control subjects (p< 0.05). Correlation analysis showed that

Cytokines

SCIENTIFIC REPORTS

2

www.nature.com/scientificreports/

Figure 1. Hematoxylin and eosin stained sections of the prostates of controls and CP/CPPS rats. Normal control groups at day 45 and day 60, and CP/CPPS groups at day 45 and day 60 are shown. Inammatory cell inltration () and vascular congestion () were observed at 50X magnication in the treatment groups. Ducts and glands damage () were visible at 200X magnication in the treatment groups. Scale bar is 200m for 50X magnication and 50m for 200X magnication.

the levels of IL-1, IL-6, IL-8, and TNF- of patients signicantly and positively correlated with SAS and SDS (Table2, p< 0.05). Interestingly, the levels of IL-10 and TNF- were signicantly and positively correlated with NIH-CPSI in patients with CP/CPPS (p<0.05).

Histological examination. Aer H&E staining of the prostates, N45 and N60 control groups showed normal prostatic histology with minimal inammatory inltration, duct changes, or tissue damage at 50x and 200x magnications. However, the prostates of CP/CPPS rats showed a prominent increase in inammatory inltration, duct ectasia, and vascular congestion in the C45 group at both magnications indicating that the autoimmune CP/CPPS model was successfully established in the individual rats. Furthermore, inammatory duct inltration and gland destruction was observed in the C60 group (Fig.1).

Increased anxiety-like behavior in the CP/CPPS rat model. In the EPM, the percentage of time spent in the open arms was signicantly lower in the C45 group (10.42%) compared with the N45 group (Fig.2A, 19.88%, p<0.05). The percentage of time spent in the open arms was also lower in the C60 group (9.61%), when compared with the N60 group (Fig.2B, 17.13%, p < 0.05). Furthermore, in both, day 45 and day 60 groups, the percentages of explorations of the open arms in the CP/CPPS groups were much lower compared with the control groups (day 45: 47.82% vs. 47.95%; day 60: 55.46% vs. 67.42%). Moreover, the percentages of entrances in the open arms in the C60 group (14.45%) was lower than that in the N60 group (30.33%), but no dierence was observed between the C45 and N45 group (24.04% vs. 24.60%). Thus, the reduced activity in the open arms in the CP/CPPS groups reect anxiety-like behavior.

Increased depression-like behavior in the CP/CPPS rat model. In both, the rst 5min and 10min tests in the OF, the C45 group showed a lower percentage of distance traveled, ambulatory counts, and entries in the center zone compared with the N45 groups (Fig.2C, 5 min: 5.67% vs. 10.15%, 6.43% vs. 11.39%, 37.08% vs. 46.13%; 10 min: 5.80% vs. 9.77%, 6.86% vs. 11.24%, 41.60% vs. 48.40%, respectively), but dierences did not reach signicance levels. During the rst 5 min the percentage of ambulatory counts in the center zone in the C60 group (5.07%) was signicantly lower compared with the N60 group (Fig.2D, 9.82%, p < 0.05). Similarly, the distance traveled (5.59% vs. 8.87%) and number of entries (40.25% vs. 47.09%) into the center zone were lower, although these did not reach signicance levels. During the entire test (10min), the percentage of the distance traveled in the center zone in the C60 group (6.31%) was signicantly lower compared to the N60 group (9.77%, p< 0.05). The percentage of ambulatory counts (6.51%) and entries (45.76%) in the center zone was lower compared to the N60 group (10.40% and 48.44%, respectively) without reaching signicance levels. Therefore, the reduced activities in the center zone observed in the CP/CPPS groups compared to the control groups indicated depression-like behavior.

Impaired spatial memory in the CP/CPPS rat model. In the Y maze test, reduced time spent in the novel arm (34.96% vs. 38.21%) and the absolute latency (35.07% vs. 37.73%) was observed in the C45 group when compared with the N45 group, but the latency between the C45 and N45 group did not dier from each other (Fig.2E, both 33.37%). In the novel arms of the Y maze, the percentage of the absolute latency in the C60 group (53.18%) was signicantly shortened when compared with the N60 group (Fig.2F, 27.36%, p< 0.05). Although the percentage of time spent in the novel arms (44.30%) and the latency (26.13%) in the C60 group were lower compared with the N60 group (48.12% and 46.12%, respectively), the dierences were not statistically signicant. Overall, the decreased activities at day 60 in the novel arms indicated that the CP/CPPS groups had difficulties in recollecting memory, which implies impaired spatial memory capacity in the CP/CPPS groups.

SCIENTIFIC REPORTS

3

www.nature.com/scientificreports/

Figure 2. Behavioral analysis in controls (n=8) and CP/CPPS rat model (n=10). Elevated plus maze (EPM) performance ((A) day 45 and (B) day 60) of controls and CP/CPPS rats. Bars represent time (in %) spent in the open/closed arms, and explorations and entrances (in %) in the open/close arms in 5min. Open eld (OF) performance (C) day 45 and (D) day 60). Bars represent the distance traveled, ambulatory counts (total steps of rats in center zone), and entries into the center zone in the rst 5 and 10min. Y maze performance((E) day 45 and (F) day 60). Bars represent time spent, latency, and absolute latency staying in the novel armin 5min during the 2nd test. (G) Shuttle box passive avoidance (SBPA) performance at day 45 and day 60. Bars represent the latency in the light box on the 2nd test day. *Indicate a signicance level of p< 0.05 versus controls. The data are presented as meansSD.

Impaired associative memory related behavior was observed in the CP/CPPS rat model. In the SBPA test (Fig.2G), the latency in the C45 group was signicantly lower compared with the N45 group (10.78s vs. 172.87s, p<0.05). In addition, the latency in the C60 group remained signicantly lower than that in the N60 group (120.28 s vs. 215.19 s, p < 0.05). Although rodents instinctively enter darkness, the previous foot shock provided a negative association with darkness. Thus, the lessened latency reected impaired associative memory in the CP/CPPS groups.

SCIENTIFIC REPORTS

4

www.nature.com/scientificreports/

Figure 3. Quantication of the levels of IL-1, IL-1, IL-4, IL-13, TNF- (A), and their receptors (B) in prostates of controls (n= 8) and CP/CPPS rats (n= 8) using RT-qPCR. Bars represent relative gene expression levels of cytokines and their receptors in prostates and brain regions (BLA, NAc, Hippo, and Cau) of control rats (D45 and D60) and CP/CPPS rats (D45 and D60). *Indicate signicance levels of p< 0.05 compared with controls. The data are presented as meansSD.

The expression of cytokines and their receptors in prostate and specic brain areas associated with anxiety, depression, and memory. In prostates, RT-qPCR showed that the levels of IL-1, IL-1 and IL-4 in the CP/CPPS rats were signicantly elevated compared with controls (p< 0.05, Fig.3A). However, the dierence in IL-13 between the N60 and C60 groups, and TNF- between the N45 and C45 groups were not signicant. Furthermore, in brain tissues the receptors of these cytokines, including IL-1R1, IL-1R2, IL-1R4, IL13R1, IL-13R2, TNFR1, and

SCIENTIFIC REPORTS

5

www.nature.com/scientificreports/

EPM OF Y maze SBPA Time in open

arms

Distance

traveled

Absolute

latency Latency

IL-1 0.161** 0.000571 0.000427 0.0000814 3.45*107

IL-1 0.339 0.0167 0.00583 0.00476 2.21*106

IL-4 0.252 0.000860 0.000854 0.000138 6.85*109

IL-13 0.000558 0.0000180 8.04*106 7.78*106 2.28*108

TNF- 0.270 0.00137 0.00104 0.000462 6.55*108

Table 3. The correlation of cytokine levels with behavioral performance in controls and the CP/CPPS rat model. EPM: elevated plus maze; OF: open eld; SBPA: shuttle box passive avoidance; **The correlation coefficient correlating cytokines with behavioral performance when p< 0.05 (Spearman rank correlation).

Cytokines

TNFR2, were detectable in BLA, NAc, Hippo, and Cau (Fig.3B). Note that IL-13 and TNF- both have two kinds of subtype receptors (IL-13R1 and IL-13R2, TNFR1 and TNFR2). The expression levels of the cytokine receptors IL-1R2, IL-4R, IL-13R1, IL-13R2, TNFR1, and TNFR2 were signicantly reduced in BLA; IL-1R1, IL-1R2, IL-4R, IL-13R1, IL-13R2, and TNFR2 were signicantly reduced in NAc; and IL-1R1, IL-1R2, IL-13R1, TNFR1, and TNFR2 were signicantly reduced in Hippo. In contrast, IL-1R2, IL-4R, and IL-13R2 were signicantly increased, and IL-13R1 was signicantly reduced in Cau in CP/CPPS rats compared with controls.

Elevated cytokines in prostate correlated to MHD related behavioral pattern in rats. Correlation analysis using the Spearman rank correlation was performed for cytokines in the prostate and MHD related behavioral pattern. The signicantly elevated IL-1, IL-1, IL-4, IL-13, and TNF- levels in the prostate were all negatively related to positive responses in MHD related behavioral tests, which means positive correlation to anxiety, depression, and spatial and associative memory impairment, although signicance levels were not reached (Table3).

ERK1/2 activation in BLA and NAc and inactivation in Hippo and Cau in the CP/CPPS rat model. Western blot analysis revealed that the phosphorylation level of the ERK1/2 was signicantly increased in BLA and NAc of CP/CPPS rats compared with controls (p< 0.05), indicating enhanced ERK1/2 activation. In contrast, ERK1/2 phosphorylation levels were significantly reduced in the Hippo in CP/CPPS rats compared with controls (p< 0.05), indicating ERK1/2 inactivation in these brain regions. However, the phosphorylation level of ERK1/2 did not show alterations in Cau between CP/CPPS and control rats (Fig.4A,B).

Elevated IL-1 in serum and CSF of the CP/CPPS rat models. In serum, the levels of IL-1 in both the C45 and C60 group were signicantly increased compared with controls (p< 0.05). Similarly, in the CSF the level of IL-1 was elevated although the dierences were not signicant (Fig.5).

The present study comprising 810 CP/CPPS patients with MHD and 992 control subjects showed signicantly more anxiety and depression with higher SAS and SDS scores observed in CP/CPPS patients compared with normal control subjects, which was consistent with the previous reports3234. Next, we investigated potential mechanisms that may facilitate CP/CPPS-related MHD. Five cytokines, IL-1, IL-1, IL-4, IL-13 and TNF-, were signicantly elevated in the serum of CP/CPPS patients. Among them, both IL-1 and TNF- were positively correlated with SAS and SDS scores, which hint to the potential role of IL-1 and TNF- in CP/CPPS-related MHD.

To further investigate the role of cytokines in CP/CPPS-related MHD, an established autoimmune rodent animal model of CP/CPPS was employed. Multiple intracutaneous injections at the neck, the tail, and the pelvic limbs with immuno-agent and an intraperitoneal injection with pertussis-diphtheria-tetanus triple vaccine for 45 and 60 days generated CP/CPPS in rats. CP/CPPS-related MHD in rats was evaluated by tests for anxiety in EPM, depression-related activity levels in OF, spatial memory impairment in the Y maze, and associative memory impairment in SBPA3538. Similar to the nding in human subjects, anxiety-like and depression-like behavior was more common in the CP/CPPS rat model compared with control animals. Moreover, signicant spatial and associative memory impairment was observed in the CP/CPPS group, what supports a possible link between disturbances in anxiety- and depression-like behavior and memory.

Similar to the ndings in CP/CPPS patients, elevated levels of IL-1, IL-1, IL-4, IL-13, and TNF- were observed in CP/CPPS rat prostates, and these elevated cytokine levels showed a positive trend in their correlation with anxiety, depression, and memory impairment. Even though signicant levels were not achieved, there was a consistent trend for a correlation between elevated cytokine patterns and the behavioral performance of MHD, which suggested a potential valuable link between cytokines and CP/CPPS-related MHD. In the present study, we found that not only cytokine expression showed signicant changes in specic brain areas, but that also the receptors of IL-1, IL-1, IL-4, and IL-13 showed decreased expression proles, some of them reaching statistical signicance levels, in BLA, NAc, and Hippo in CP/CPPS rats compared with controls. Interestingly, the changes of these receptors in Cau between CP/CPPS rats and controls seemed not predictable from the changes observed for their ligands. Thus, it is likely that rather than one kind of cytokine probably the integration of multiple cytokines and their receptors is important for the behavioral impact. Previous studies have demonstrated that cytokines by interacting with their specic receptors may modulate the MAPK/ERK downstream signaling pathway39,40. Through stabilizing structural changes in dendritic spines, MAPK/ERK regulates a wide variety

Ambulatory

counts

SCIENTIFIC REPORTS

6

www.nature.com/scientificreports/

Figure 4. Western blot analysis of ERK1/2 activation in BLA, NAc, Hippo, and Cau in controls and CP/ CPPS rats. (A) Representative Western blots. (B) Quantication of ERK1/2 phosphorylation level (pERK1/2) in BLA, NAc, Hippo, and Cau in controls (n= 8) and CP/CPPS rats (n= 8) using densitometric analysis of the bands shown in (A). Expression levels values normalized to -actin levels. *Indicate signicance levels of p<0.05 vs. controls. The data are presented as meansSD.

Figure 5. Quantication of the IL-1 in serum and CSF of controls and CP/CPPS rats. Bars represent the concentration (pg/ml) of serum and CSF IL-1 in controls (N45 and N60, n= 6) and CP/CPPS rats (D45 and D60, n=7). *Indicate p<0.05 vs. controls. The data are presented as meansSD.

of forms of synaptic plasticity. Synaptic plasticity is a crucial cellular mechanism underlying a variety of brain functions, including learning and memory, but also depressive and anxiety behavior. Interestingly, in anxiety and depression patients, ERK1/2 has been found activated in BLA and NAc4144. However, during impairment of memory functions ERK1/2 has been shown to be inactivated in the Hippo and Cau45,46. Briey, when ERK1/2 was inhibited synapse formation was reduced leading to the inhibition of synaptic plasticity26. Consistently, by using the 3T morphometric system, Mordasini et al. described reduction in relative gray matter volume in the anterior cingulate cortex, a core structure of emotional pain processing, correlating with bother of CP/CPPS. Even though the disaccord on brain area alterations were found compared to the demonstration of Farmer et al., both of these

SCIENTIFIC REPORTS

7

www.nature.com/scientificreports/

research units discovered the specic alteration in brain areas, which supported by the theory that dysfunctional central plasticity and functional reorganization lead to peripheral discomfort, such as chronic pain5,11. The functional magnetic resonance imaging and identication of dierent phases of CP/CPPS would probably be helpful in solving current divergence. In the present study, ERK1/2 phosphorylation levels were increased in the BLA and NAc and were reduced in the Hippo of CP/CPPS rats. The changes of this signaling pathway downstream of cytokines were consistent with the observed changes in behavioral test. We also noted that CP/CPPS rats showing reduced associative memory behavioral performance compared with controls, did not show changes in ERK1/2 activity. Therefore, these signicant behavioral dierences must be correlated with several other factors, besides ERK1/2, such as glucocorticoids and dopamine-dependent memory retrieval signaling pathways, which likely contribute to the associative memory impairment.

Cytokine levels showed similarly elevated trend in humans and in the CP/CPPS rat models, hence the PPE combined FCA induced autoimmune CP/CPPS appears to mimic the inammatory status of CP/CPPS patients. Importantly, Leonard et al. have suggested that IL-1 could be transported from peripheral blood into the brain by an active transport mechanism47. Our results showed elevated IL-1 in CSF of the CP/CPPS rat model. It appears likely that these elevated CSF cytokines interact through some of the identied receptors for these cytokines in specic brain areas. Therefore, IL-1 derived from prostate may pass through the blood brain barrier, be transported by CSF, and interact with its receptors in specic brain areas.

Previous reports have shown that IL-1 may lead to anxiety by interacting with the endocannabinoid system and modulate neuronal function of the BLA48,49. Through participating in hypothalamic-pituitary-adrenal axis hyperactivity, IL-1 has been shown to cause depression50,51. In addition, IL-1 has been closely correlated with spatial and associative memory injury in previous studies52,53. In our study, IL-1 was signicantly elevated in the CP/CPPS group and was positively correlated with SAS and SDS. Thus, the cytokine IL-1 may be one of the major molecular factors responsible for CP/CPPS-related MHD. Altogether, results in an animal model and in CP/CPPS patients conrm that anxiety and depression are associated with CP/CPPS. This study also conrms that elevated peripheral cytokine levels in the prostate and serum are likely involved in the molecular pathophysiology of CP/CPPS-related MHD. Taken together, it is a possibility that the prostate-derived cytokines, especially IL-1, cross the blood brain barrier and can interact with their respective receptors in specic brain areas, which may lead to changes in ERK1/2 activity, and in turn lead to CP/CPPS related anxiety, depression, and spatial and associative memory impairment.

The present study has several limitations. The lack of signicant dierences in the activity of ERK1/2 made it difficult to assign a specic mechanism of action for prostate-derived cytokines in CP/CPPS-related MHD. The downstream ERK1/2 signaling pathway in neurons is conditioned by various kinds of factors, such cytokines interaction, growth factors, and ligands of G protein coupled receptors. The current results are probably an account of the balance of these eects. Further studies on the mechanism of action, such as perfusion with ILs, polyamines, and their antagonists by stereotaxic techniques and by in vitro chronic stimulation in primary cultures of specic brain areas are needed to address those issues. However, CP/CPPS-related MHD in patients as well as in rats and changes of peripheral inammatory cytokines and downstream cerebral ERK1/2 signaling activity observed in the present study will undoubtedly give additional opportunity to explore uro-neurology diseases in this direction. Clinically, possibly blockage or depletion of inammation cytokines in peripheral blood and CSF would be helpful not only in reducing inammation, but also in developing available strategy in relieving CP/CPPS related MHD.

The clinical protocol of this study was reviewed and approved (No. 0015004) by the Institutional Ethical Review Committee, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, and aer fully explaining the procedure and the aims of the investigation, all study subjects signed an informed consent form. The clinical trial was strictly executed in accordance with the approved guidelines and requirements. The rodent animal study was designed and conducted (No. SYXK 20130050) in accordance with the approval of the Animal Care and Use Committee of the School of Medicine, Shanghai Jiao Tong University.

Between July 2012 and August 2013, 1000 patients at seven hospitals (Ren Ji Hospital and Shanghai General Hospital affiliated with the Shanghai Jiao Tong University, Zhongshan Hospital affiliated with the Fudan University, East Hospital affiliated with the Tongji University, Shanghai Eighth Hospital affiliated with the Jiangsu Hospital, and Longhua and Yueyang Hospital affiliated with the Shanghai University of Traditional Chinese Medicine) who complained of discomfort or pain in the pelvic region (penis, testes, scrotum, perineum, pubic area, or lower back) for at least three of six months, were interviewed and examined by experienced urologists. Eight hundred and ten patients (aged 1859), who were diagnosed with CP/CPPS based on the National Institute of Health (NIH) criteria, were enrolled in this case-control study1. Age matched healthy men (n= 1000) without any discomfort in the pelvic region were interviewed and examined by the urologists, and 992 were recruited as healthy controls.

All patients and healthy controls underwent physical and rectal examinations, hemanalysis, midstream urine analysis for microbe growth, and quantication of the prostate specic antigen (PSA). All patients and control subjects completed the Chinese versions of the NIH Chronic Prostatitis Symptom Score (NIH-CPSI), the Self Anxiety Scale (SAS) and the Self Depression Scale (SDS)54,55. Both SAS and SDS set scores of 50 as cut-o value with higher values being considered diagnostic for anxiety or depression. Within both groups, the serum samples of 56 individuals (28 patients and 28 controls) were randomly selected for analysis of inammatory cytokine levels.

SCIENTIFIC REPORTS

8

www.nature.com/scientificreports/

The serum cytokine levels were assayed using a Quantibody Human Inammatory Array (RayBiotech, Atlanta, GA, USA), which quantied the levels of interleukin-1 (IL-1), IL-1, IL-4, IL-6, IL-8/CXCL8, IL-10, IL-13, monocyte chemotactic protein (MCP)-1/ CCL2, tumor necrosis factor (TNF)- and interferon (IFN)- in the serum of the study subjects. The test was performed by multiplex sandwich enzyme-linked immunosorbent assay (ELISA) according to the manufacturers instructions. Assay sensitivity for all proteins tested was <1pg/ml.

Four-month-old male Sprague-Dawley (SD) rats (n= 7, specic pathogen-free) received anesthesia with sodium pentobarbital (30mg/kg, i.p.) under aseptic conditions. A lower abdominal incision was made and the prostate was identied and extracted. For protein analysis, the prostate was homogenized manually with 0.5% Triton X-100 lysis buer and centrifuged (13,500rpm, 30min) twice at 4 C. The supernatant was then collected as prostate protein extract (PPE). The PPE concentration was quantied and normalized to 40 mg/ml by spectrophotometry (NanoDrop ND-100, Wilmington, DE, USA).

To establish a CP/CPPS animal model, two-month-old male SD rats were randomly divided into four groups, two CP/CPPS groups (C45 and C60) and two normal control groups (N45 and N60). The C45 (n= 10) and C60 (n= 10) groups were treated by the autoimmune method for 45 days or 60 days, respectively, to induce development of CP/CPPS. Briey, the animals underwent multiple intracutaneous injections at the neck (0.4ml), the end of the tail (0.3ml), and the pelvic limbs (0.15ml) with immuno-agent (1:1 mixed PPE and Freuds complete adjuvant) and an intraperitoneal injection with pertussis-diphtheria-tetanus triple vaccine (0.5ml). The corresponding normal control groups N45 (n= 8) and N60 (n= 8) received the same injection regimen for 45 and 60 days, respectively, but using saline. The autoimmune method was conducted at the 1st day and repeated at the 30th day.

The inammation status of the prostate was evaluated by visual examination of gland integrity, white blood cell inltration, and structure of prostatic ducts through hematoxylin and eosin (H&E) staining. Briey, the prostates from each group were immersed in 10% neutral buered formalin, embedded in paraffin, and cut into 5 m sections. Slides were cleared in xylene and dehydrated, followed by standard H&E staining procedure.

Elevated plus maze (EPM). The potential eects of CP/CPPS in rats on anxiety-like behavior were assessed in the EPM. At the start of each trial, a single rat was placed in the open central square formed by the arms, facing the open arm. Time spent in open and closed arms, explorations, and entries to these arms were recorded and analyzed over a 5 min observation period by video camera system and analysis soware (Med-Associates, St. Albans, VT, USA). The arms were cleaned thoroughly with 95% ethanol and water aer each animal had been tested to prevent odor recognition. Lower activity in the open arms of the EPM, were suggestive of an anxiety-like condition56.

Open eld (OF). The potential eects of CP/CPPS in rats on depression-like behavior were assessed in the OF paradigm. A single rat was placed in the center of the OF apparatus. The distance traveled, ambulatory (walking) counts, and entries into the center zone of the OF were recorded and analyzed for a period of 10min with a video camera system and analysis soware (Med-Associates, St. Albans, VT, USA). The apparatus was cleaned thoroughly with 95% ethanol and water aer each test session. Low locomotor activity levels in the center zone were considered depressive behavioral condition57.

Y maze. The potential eects of CP/CPPS in rats on spatial memory were assessed in the Y maze. On the rst trial, rats were habituated individually to a randomly selected start arm for 5min, one of the two remaining arms was randomly blocked as novel arm, whereas on the second trial, lasting for 5min, all the arms of the maze were open. The two trials were separated by a 2min break, during which the rat was returned to its home cage. Travel times into the novel arms, latency (i.e., percentage of time in novel arms compared to total time), and absolute latency (i.e., percentage of time in novel arms compared to total time without the time staying in the center zone) before moving in the novel arms were measured with a video camera system and analysis soware (ANY-maze, Wood Dale, IL, USA). Between trials, the maze was cleaned using 95% ethanol and water and then dried. It was assumed that spatial memory was impaired when the activity in the novel arms was reduced58.

Shuttle box passive avoidance (SBPA). The potential eects of CP/CPPS in rats on associative memory related behavior were assessed in the shuttle box (Med-Associates, St. Albans, VT, USA). During the training session, rats were accustomed to the behavioral apparatus in the light box and were free to move into the dark box. Aerwards, the rats were given a foot shock (1mA, 2s) whenever they entered the dark box. During the test session, the rats were placed in the light box again and no electric foot shock was applied. The session ended aer the animal stayed in the light box for more than 300 s. All animals were tested for associative memory retention 24 h aer the training session. The latency change between training and test session was recorded and the apparatus was cleaned thoroughly with 95% ethanol and water aer each session. Previous reports have shown that associative memory was impaired when the latency in the light box on the 2nd day was decreased59.

CSF and brain tissue collection. CSF of each rat was collected by ne needle puncture at the foramen magnum. Under anesthesia (sodium pentobarbital, 30mg/kg, i.p.), rats were kept in a lateral position to allow the back of the neck to be fully exposed. The puncture was made at the level of the foramen magnum and CSF was collected and stored at 80 C. Aer euthanasia, the rat brain was excised and the BLA, NAc, Hippo, and Cau were dissected according to The Rat Brain instruction and stored at 80C60.

SCIENTIFIC REPORTS

9

www.nature.com/scientificreports/

Gene Primer (From 5 to 3)

IL-1 Forward: TGAGTCGGCAAAGAAATCAA

Reverse: GACAGATGGTCAATGGCAGA

IL-1 Forward: GCCAACAAGTGGTATTCTCCA

Reverse: CCGTCTTTCATCACACAGGA

IL-4 Forward: ACCTTGCTGTCACCCTGTTC

Reverse: GTGTTCCTTGTTGCCGTAAG

IL-13 Forward: CTCAGGGAGCTTATCGAGGA

Reverse: GCAACTGGAGATGTTGGTCA

TNF- Forward: TGCCTCAGCCTCTTCTCATT

Reverse: GCTTGGTGGTTTGCTACGAC

IL-1R1 Forward: CGCACGTCCTACACATACCA

Reverse: CATTCCGTGGGCTCATAATC

IL-1R2 Forward: AAGTTGGTGTGGACGATGTTC

Reverse: GGGTGCTTCTCTGATGTAACG

IL-4R Forward: ACTGGCTGGAACTGTGGTCT

Reverse: TGGAGTGTGAGGTTGTCTGG

IL-13R1 Forward: TTGATGACAACGACCTGTGG

Reverse: CACTGCGACAAAGACTGGAA

IL-13R2 Forward: GGAATGCTGGGAAGGTTACA

Reverse: CAGTGTGGGTTCAGGGTCTT

TNFR1 Forward: GAGGTGGAGGGTGAAGGAAT

Reverse: TGGAGACAGGATGACTGAAGC

TNFR2 Forward: TTAGGACTGGCGAACTGCTT

GAPDH Reverse: GCCTTCCGTGTTCCTA

Forward: AGACAACCTGGTCCTCA

Table 4. Primer sequences for cytokines and cytokine receptors.

Reverse transcription quantitative real-time PCR (RT-qPCR). Cytokines IL-1, IL-1, IL-4, IL-13, and TNF- mRNA expression levels were studied in the prostate, and the mRNA expression levels of the corresponding cytokine receptors, IL-1R1, IL-1R2, IL-4R, IL-13R1 (IL-13R1), IL-13R2 (IL-13R2), TNFR1 (TNFRsf1a), and TNFR2 (TNFRsf1b) were studied in the brain nuclei. Briey, total RNA was extracted from TRIzol homogenates and puried using trichloromethane and isopropanol. cDNA was synthesized using RevertAid First Strand cDNA Synthesis Kit (Fermentas, Waltham, MA, USA). qPCR for cytokines was performed with Platinum RTS SYBR

Green qPCR SuperMix-UDG (Invitrogen, Carlsbad, CA, USA) using specic primer sequences (Table4). Briey, initial activation was at 95C for 2min, denaturation at 95C for 15s, annealing at 60C for 30s, and extension at 72C for 30s with a single uorescence measurement up to 40 cycles. A melting step with temperature ramps was set from 60C to 95C. The cycle time values were normalized against the endogenous control GAPDH.

Western blot analysis. Brain tissue from CP/CPPS rats was homogenized twice at high speed for 15s in slurry tubes with magnetic beads in 1 ml ice-cold homogenization buer. The extraction buer consisted of radioimmunoprecipitation assay (RIPA) lysis buer (200 ml), supplemented with protease inhibitor cocktail (P8340, 2 ml, 1%), phenylmethanesulfonyl uoride (PMSF, 4 ml, 2%), Triton X-100 (1 ml, 0.5%), and protease inhibitor cocktail (10 ml, 5%; all Sigma-Aldrich, St. Louis, MO, USA), and quantied using the BCA method. Aer quantication, proteins (100 mg/lane) were subjected to 1012% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) to separate the proteins, and then electrotransferred onto polyvinylidene uoride (PVDF) membrane. The membrane was incubated for 1 h at room temperature with blocking buer (5% milk in TBS), and then further incubated with the relevant primary antibodies (phospho-MAPK (Erk1/2) mAb, Cell Signaling Technology, Beverly, MA, USA; MAPK (Erk1/2) mAb, Cell Signaling Technology, Beverly, MA, USA; and b-actin mAb, Santa Cruz Biotechnology, Santa Cruz, CA, USA) overnight at 4 C. All primary antibodies were used at dilutions recommended by the manufacturer. Aer washing, membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (anti-rabbit IgG, Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h and the reaction was visualized using the enhanced chemiluminescence (ECL) method (SuperSignalWest Pico Trial Kit, Rockford, IL, USA).

Enzyme-linked immunosorbent assays (ELISA). The level of IL-1 in serum and CSF was determined using the rat IL-1 Platinum Kit (eBioscience, San Diego, CA, USA) according to the manufacturers instructions. The optical density of each well was determined at 450 nm using a Bio-Rad spectrophotometer (BioRad, Hercules, CA, USA).

Statistical analysis. Quantitative data are presented as means standard deviations (SD). Students t-test was used for comparison between two samples. The chi-square test was used to compare the dierence between

SCIENTIFIC REPORTS

10

www.nature.com/scientificreports/

groups. Differences among more than two groups were assessed by one-way ANOVA with conservative Bonferronis test. Correlation analysis was achieved by Spearman rank correlation. All statistical analyses were performed on SAS for Windows 8.0 (SAS Institute Inc, Cary, NC, USA). Statistical signicance was considered at a p< 0.05 level for all parameters.

1. Krieger, J. N., Nyberg, L., Jr. & Nickel, J. C. NIH consensus denition and classication of prostatitis. JAMA-J. Am. Med. Assoc. 282,

236237 (1999).

2. Thakkinstian, A., Attia, J., Anothaisintawee, T. & Nickel, J. C. alpha-blockers, antibiotics and anti-inammatories have a role in the management of chronic prostatitis/chronic pelvic pain syndrome. BJU Int. 110, 10141022 (2012).

3. Anothaisintawee, T. et al. Management of chronic prostatitis/chronic pelvic pain syndrome: a systematic review and network meta-analysis. JAMA-J. Am. Med. Assoc. 305, 7886 (2011).

4. Kessler, T. M. et al. Sono-electro-magnetic therapy for treating chronic pelvic pain syndrome in men: a randomized, placebo-controlled, double-blind trial. PLoS One. 9, e113368 (2014).

5. Mordasini, L. et al. Chronic pelvic pain syndrome in men is associated with reduction of relative gray matter volume in the anterior cingulate cortex compared to healthy controls. J Urol. 188, 22332237 (2012).

6. Tripp, D. A. et al. Catastrophizing and pain-contingent rest predict patient adjustment in men with chronic prostatitis/chronic pelvic pain syndrome. J. Pain. 7, 697708 (2006).

7. Egan, K. J. & Krieger, J. N. Psychological problems in chronic prostatitis patients with pain. Clin. J. Pain. 10, 218226 (1994).8. Anderson, R. U., Orenberg, E. K., Chan, C. A., Morey, A. & Flores, V. Psychometric proles and hypothalamic-pituitary-adrenal axis function in men with chronic prostatitis/chronic pelvic pain syndrome. J. Urol. 179, 956960 (2008).

9. Zhang, G. X., Bai, W. J., Xu, T. & Wang, X. F. A preliminary evaluation of the psychometric proles in Chinese men with chronic prostatitis/chronic pelvic pain syndrome. Chin. Med. J. 124, 514518 (2011).

10. Anderson, R. U., Orenberg, E. K., Morey, A., Chavez, N. & Chan, C. A. Stress induced hypothalamus-pituitary-adrenal axis responses and disturbances in psychological proles in men with chronic prostatitis/chronic pelvic pain syndrome. J. Urol. 182, 23192324 (2009).

11. Farmer, M. A. et al. Brain functional and anatomical changes in chronic prostatitis/chronic pelvic pain syndrome. J. Urol. 186, 117124 (2011).

12. Pontari, M. & Giusto, L. New developments in the diagnosis and treatment of chronic prostatitis/chronic pelvic pain syndrome. Curr. Opin. Urol. 23, 565569 (2013).

13. Penna, G., Fibbi, B., Maggi, M. & Adorini, L. Prostate autoimmunity: from experimental models to clinical counterparts. Expert Rev. Clin. Immunol. 5, 577586 (2009).

14. Done, J. D., Rudick, C. N., Quick, M. L., Schaeer, A. J. & Thumbikat, P. Role of mast cells in male chronic pelvic pain. J. Urol. 187, 14731482 (2012).

15. Altuntas, C. Z. et al. A novel murine model of chronic prostatitis/chronic pelvic pain syndrome (CP/CPPS) induced by immunization with a spermine binding protein (p25) peptide. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 304, R415422 (2013).

16. Quick, M. L. et al. CCL2 and CCL3 are essential mediators of pelvic pain in experimental autoimmune prostatitis. Am. J. Physiol.-Regul. Integr. Comp. Physiol. 303, R580589 (2012).

17. Penna, G. et al. Seminal plasma cytokines and chemokines in prostate inammation: interleukin 8 as a predictive biomarker in chronic prostatitis/chronic pelvic pain syndrome and benign prostatic hyperplasia. Eur. Urol. 51, 524533; discussion 533 (2007).

18. Wohleb, E. S. et al. Knockdown of interleukin-1 receptor type-1 on endothelial cells attenuated stress-induced neuroinammation and prevented anxiety-like behavior. J. Neurosci. 34, 25832591 (2014).

19. Gadek-Michalska, A., Tadeusz, J., Rachwalska, P. & Bugajski, J. Cytokines, prostaglandins and nitric oxide in the regulation of stress-response systems. Pharmacol. Rep. 65, 16551662 (2013).

20. Martin, C., Tansey, K. E., Schalkwyk, L. C. & Powell, T. R. The inammatory cytokines: molecular biomarkers for major depressive disorder? Biomark. Med. 9, 169180 (2014).

21. Lichtblau, N., Schmidt, F. M., Schumann, R., Kirkby, K. C. & Himmerich, H. Cytokines as biomarkers in depressive disorder: current standing and prospects. Int. Rev. Psych. 25, 592603 (2013).

22. Koob, G. F. Brain stress systems in the amygdala and addiction. Brain Res. 1293, 6175 (2009).23. Lucassen, P. J. et al. Neuropathology of stress. Acta Neuropathol. 127, 109135 (2014).24. Hein, A. M. et al. Behavioral, structural and molecular changes following long-term hippocampal IL-1beta overexpression in transgenic mice. J. Neuroimmune Pharm. 7, 145155 (2012).

25. Chang, Q. & Gold, P. E. Switching memory systems during learning: changes in patterns of brain acetylcholine release in the hippocampus and striatum in rats. J. Neurosci. 23, 30013005 (2003).

26. Kennedy, M. B. Synaptic Signaling in Learning and Memory. Cold Spring Harbor Perspect. Biol. 8, a016824, doi: 10.1101/cshperspect. a016824 (2013).

27. Chocyk, A., Majcher-Maslanka, I., Dudys, D., Przyborowska, A. & Wedzony, K. Impact of early-life stress on the medial prefrontal cortex functions - a search for the pathomechanisms of anxiety and mood disorders. Pharmacol. Rep. 65, 14621470 (2013).

28. Duman, R. S. Pathophysiology of depression: the concept of synaptic plasticity. Eur. Psychiat. 17 Suppl 3, 306310 (2002).29. McEwen, B. S. Stress and hippocampal plasticity. Annu. Rev. Neurosci. 22, 105122 (1999).30. Impey, S., Obrietan, K. & Storm, D. R. Making new connections: role of ERK/MAP kinase signaling in neuronal plasticity. Neuron 23, 1114 (1999).

31. Gray, N. A., Zhou, R., Du, J., Moore, G. J. & Manji, H. K. The use of mood stabilizers as plasticity enhancers in the treatment of neuropsychiatric disorders. J. Clin. Psychiatry 64 Suppl 5, 317 (2003).

32. Chung, S. D. & Lin, H. C. Association between chronic prostatitis/chronic pelvic pain syndrome and anxiety disorder: a population-based study. PLoS One 8, e64630 (2013).

33. Tripp, D. A., Nickel, J. C., Shoskes, D. & Koljuskov, A. A 2-year follow-up of quality of life, pain, and psychosocial factors in patients with chronic prostatitis/chronic pelvic pain syndrome and their spouses. World J. Urol. 31, 733739 (2013).

34. Kwon, J. K. & Chang, I. H. Pain, catastrophizing, and depression in chronic prostatitis/chronic pelvic pain syndrome. Int. Neurourol. J. 17, 4858 (2013).

35. Carobrez, A. P. & Bertoglio, L. J. Ethological and temporal analyses of anxiety-like behavior: the elevated plus-maze model 20 years on. Neurosci. Biobehav. Rev. 29, 11931205 (2005).

36. Stanford, S. C. The Open Field Test: reinventing the wheel. J. Psychopharmacol. 21, 134135 (2007).37. Rusu, G., Popa, G., Ochiuz, L., Nechifor, M. & Tartau, L. Eects of some dopamine antagonists on spatial memory performance in ratsexperimental research. Rev. Med. Chir. Soc. Med. Nat. Iasi. 118, 116124 (2014).

38. Montag-Sallaz, M. & Montag, D. Severe cognitive and motor coordination decits in tenascin-R-decient mice. Genes Brain Behav. 2, 2031 (2003).

39. Gonzalez, P. et al. Molecular mechanisms involved in interleukin 1-beta (IL-1beta)-induced memory impairment. Modulation by alpha-melanocyte-stimulating hormone (alpha-MSH). Brain Behav. Immun. 34, 141150 (2013).

SCIENTIFIC REPORTS

11

www.nature.com/scientificreports/

40. Song, K. S. et al. Induction of MUC8 gene expression by interleukin-1 beta is mediated by a sequential ERK MAPK/RSK1/CREB cascade pathway in human airway epithelial cells. J. Biol. Chem. 278, 3489034896 (2003).

41. Espana, J. et al. Intraneuronal beta-amyloid accumulation in the amygdala enhances fear and anxiety in Alzheimers disease transgenic mice. Biol. Psychiatry. 67, 513521 (2010).

42. Herry, C., Trilie, P., Micheau, J., Luthi, A. & Mons, N. Extinction of auditory fear conditioning requires MAPK/ERK activation in the basolateral amygdala. Eur. J. Neurosci. 24, 261269 (2006).

43. Duric, V. et al. A negative regulator of MAP kinase causes depressive behavior. Nat. Med. 16, 13281332 (2010).44. Zhang, L. et al. Curcumin produces antidepressant eects via activating MAPK/ERK-dependent brain-derived neurotrophic factor expression in the amygdala of mice. Behav. Brain Res. 235, 6772 (2012).

45. Sweatt, J. D. The neuronal MAP kinase cascade: a biochemical signal integration system subserving synaptic plasticity and memory. J. Neurochem. 76, 110 (2001).46. Atkins, C. M., Selcher, J. C., Petraitis, J. J., Trzaskos, J. M. & Sweatt, J. D. The MAPK cascade is required for mammalian associative learning. Nat. Neurosci. 1, 602609 (1998).

47. Leonard, B. E. & Song, C. Changes in the immune system in rodent models of depression. Int. J. Neuropsychopharmacol. 5, 345356 (2002).

48. Rossi, S. et al. Interleukin-1beta causes anxiety by interacting with the endocannabinoid system. J. Neurosci. 32, 1389613905 (2012).

49. Peng, Z. et al. Gastrodin ameliorates anxiety-like behaviors and inhibits IL-1beta level and p38 MAPK phosphorylation of hippocampus in the rat model of posttraumatic stress disorder. Physiol. Res. 62, 537545 (2013).

50. Schiepers, O. J., Wichers, M. C. & Maes, M. Cytokines and major depression. Prog. Neuro-Psychopharmacol. Biol. Psychiatry. 29, 201217 (2005).

51. Lawson, M. A., McCusker, R. H. & Kelley, K. W. Interleukin-1 beta converting enzyme is necessary for development of depression-like behavior following intracerebroventricular administration of lipopolysaccharide to mice. J. Neuroinamm. 10, 54 (2013).

52. Ribeiro, L. R. et al. Chronic administration of methylmalonate on young rats alters neuroinammatory markers and spatial memory. Immunobiology. 218, 11751183 (2013).

53. Zhang, Y. Y., Fan, Y. C., Wang, M., Wang, D. & Li, X. H. Atorvastatin attenuates the production of IL-1beta, IL-6, and TNF-alpha in the hippocampus of an amyloid beta1-42-induced rat model of Alzheimers disease. Clin. Interv. Aging. 8, 103110 (2013).

54. Olatunji, B. O., Deacon, B. J., Abramowitz, J. S. & Tolin, D. F. Dimensionality of somatic complaints: factor structure and psychometric properties of the Self-Rating Anxiety Scale. J. Anxiety Disord. 20, 543561 (2006).

55. Taylor, R., Lovibond, P. F., Nicholas, M. K., Cayley, C. & Wilson, P. H. The utility of somatic items in the assessment of depression in patients with chronic pain: a comparison of the Zung Self-Rating Depression Scale and the Depression Anxiety Stress Scales in chronic pain and clinical and community samples. Clin. J. Pain. 21, 91100 (2005).

56. Song, C., Li, X., Leonard, B. E. & Horrobin, D. F. Eects of dietary n-3 or n-6 fatty acids on interleukin-1beta-induced anxiety, stress, and inammatory responses in rats. J. Lipid Res. 44, 19841991 (2003).

57. Zheng, H. et al. Benecial eects of exercise and its molecular mechanisms on depression in rats. Behav. Brain Res. 168, 4755 (2006).

58. Schreiber, S. et al. Enriched environment improves the cognitive eects from traumatic brain injury in mice. Behav. Brain Res. 271, 5964 (2014).

59. Ghavipanjeh, G. R., Alaei, H., Khazaei, M., Pourshanazari, A. A. & Hoveida, R. Eect of acute and chronic hypertension on short-and long-term spatial and avoidance memory in male rats. Pathophysiology. 17, 3944 (2010).

60. Charles, W. & George, P. The Rat Brain in Stereotaxic Coordinates, 5th edn. 1129, 1266, 3447, 40 (Elsevier Academic Press, 2004).

We thank Guofeng Yan, Chen Xu, Qian Huang, Cuini Wang, Yang Wang, Beiyan Tong and Qiongdan Zheng for expert technical help.

C.H. and J.C.D. organized and carried out the questionnaire design and epidemiological investigation. C.H. and Y.H.D. participated in the clinical sample collection and examination. C.H. and X.C. established and evaluated CP/CPPS rat model. C.H., H.L.Y. and Y.F.Z. performed the behavioral analysis and CSF and brain tissue collection. C.H., Y.Y.D. and L.L. performed the molecular biological experiments. C.H., J.F.C., T.Y.Z., P.Z. and J.C.D. participated in the design of the study. C.H. draed the manuscript and performed the statistical analysis. J.F.C. and T.Y.Z. provided the technical and administrative support. P.Z. and C.-S.L. helped to revise the manuscript. C.H. and J.C.D. managed the study coordination and supervised its conduct. All authors read and approved the nal manuscript.

Competing nancial interests: The authors declare no competing nancial interests.

How to cite this article: Hu, C. et al. The role of inammatory cytokines and ERK1/2 signaling in chronic prostatitis/chronic pelvic pain syndrome with related mental health disorders. Sci. Rep. 6, 28608; doi: 10.1038/ srep28608 (2016).

This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

SCIENTIFIC REPORTS

12