Bustos virus, a new member of the negevirus group isolated from a Mansonia mosquito in the Philippines

Abstract

We isolated two distinct viruses from mosquitoes collected in Bustos, Bulacan province, Philippines, in 2009. These viruses show rapid replication and strong cytopathic effects in mosquito C6/36 cells. Whole-genome analysis of these viruses demonstrated that both viruses belong to the negevirus group. One of the viruses, from Culex vishunui mosquitoes, is a new strain of Negev virus. The other virus, from a Mansonia sp. mosquito, is a new negevirus designated Bustos virus. Gene expression analysis of the Bustos virus revealed that infected cells contain viral subgenomic RNAs that probably include open reading frame (ORF) 2 or ORF3. Purified Bustos virus particles contained at least three proteins, and the major component (a probable major capsid protein) is encoded by ORF3. Bustos virus did not show infectivity in mammalian BHK-21 cells, suggesting that it is an insect-specific virus, like other known negeviruses.

http://crossmark.crossref.org/dialog/?doi=10.1007/s00705-016-3068-4&domain=pdf

Web End = Arch Virol (2017) 162:7988 DOI 10.1007/s00705-016-3068-4

http://crossmark.crossref.org/dialog/?doi=10.1007/s00705-016-3068-4&domain=pdf

Web End = ORIGINAL ARTICLE

Bustos virus, a new member of the negevirus group isolated from a Mansonia mosquito in the Philippines

Ryosuke Fujita1,2 Ryusei Kuwata3 Daisuke Kobayashi1 Arlene Garcia Bertuso4

Haruhiko Isawa1 Kyoko Sawabe1

Received: 25 July 2016 / Accepted: 14 September 2016 / Published online: 26 September 2016 Springer-Verlag Wien 2016

Abstract We isolated two distinct viruses from mosquitoes collected in Bustos, Bulacan province, Philippines, in 2009. These viruses show rapid replication and strong cytopathic effects in mosquito C6/36 cells. Whole-genome analysis of these viruses demonstrated that both viruses belong to the negevirus group. One of the viruses, from Culex vishunui mosquitoes, is a new strain of Negev virus. The other virus, from a Mansonia sp. mosquito, is a new negevirus designated Bustos virus. Gene expression analysis of the Bustos virus revealed that infected cells contain viral subgenomic RNAs that probably include open reading frame (ORF) 2 or ORF3. Puried Bustos virus particles contained at least three proteins, and the major component (a probable major capsid protein) is encoded by ORF3. Bustos virus did not show infectivity in mammalian BHK-21 cells, suggesting that it is an insect-specic virus, like other known negeviruses.

Introduction

Mosquitoes are known to be important vectors for arthropod-borne viruses (arboviruses) [1]. The majority of these viruses are RNA viruses of the families Togaviridae, Flaviviridae, Rhabdoviridae, Bunyaviridae and Reoviridae. Several recent studies of viruses isolated from mosquitoes have revealed the existence of a new group of RNA virus, the so-called negevirus group [28]; however, they are not considered arboviruses because of their inability to infect and replicate in vertebrate cells.

Negeviruses have been found in a variety of mosquitoes, including those from the genera Culex, Anopheles, Aedes, Mansonia, and Armigeres, and a phlebotomine sand y of the genus Lutzomyia, which have been collected in various parts of the world. Previously characterized negevirus isolates grew well in cultured mosquito cells, causing a cytopathic effect (CPE) [28], but not in vertebrate cells [2]. The negevirus genome consists of a single-stranded positive-sense RNA containing three conserved putative open reading frames (ORFs). ORF1 probably encodes the RNA-dependent RNA polymerase (RdRp), while the expression of ORF2 and ORF3 and the functions of their products remain to be experimentally elucidated.

In this study, we conducted virus surveillance in mosquitoes captured in Bustos, Bulacan province, Philippines, in 2009. Our efforts resulted in the successful isolation of two distinct negeviruses, a new strain of Negev virus and a new member of the negevirus group designated Bustos virus. We also determined the growth kinetics of Bustos virus in mosquito C6/36 cells and evaluated its infectivity in mammalian BHK-21 cells. Molecular analysis of the structural proteins revealed that viral particles contained three proteins and that the ORF3 product was a major component of the virion. In mosquito cells infected with

Electronic supplementary material The online version of this article (doi:http://dx.doi.org/10.1007/s00705-016-3068-4

Web End =10.1007/s00705-016-3068-4 ) contains supplementary material, which is available to authorized users.

& Haruhiko Isawa [email protected]

1 Department of Medical Entomology, National Institute ofInfectious Diseases, 1-23-1 Toyama, Shinjuku-ku, Tokyo 162-8640, Japan

2 Department of Research Promotion, Japan Agency for Medical Research and Development, 20F Yomiuri Shimbun Bldg. 1-7-1 Otemachi, Chiyoda-ku, Tokyo 100-0004, Japan

3 Laboratory of Veterinary Microbiology, Faculty of Agriculture, Yamaguchi University, 16777-1 Yoshida, Yamaguchi 753-8515, Japan

4 Department of Parasitology, College of Public Health, University of the Philippines, Ermita, 1000 Manila, Philippines

123

80 R. Fujita et al.

Bustos virus, the antigenomic strand of the viral RNA and the subgenomic mRNAs were generated in a considerably rapid manner after infection.

Materials and methods

Mosquito collection

Adult female mosquitoes were collected in Bustos, Bulacan province, Philippines, in 2009. The mosquitoes that were collected were classied using their external features and were then subgrouped according to species or genus [913]. The pools used in this study are summarized in supplementary Table 1.

Cell culture

The mosquito (Aedes albopictus) cell line C6/36 was used to isolate viruses [14]. These cells were cultured in Eagles minimum essential medium (MEM, Sigma) containing 10 % fetal bovine serum (FBS) and 2 % nonessential amino acids (NEAA, Sigma) and were maintained at 28 C in 5 % CO2. Mammalian BHK-21 cells were cultured in

MEM containing 10 % FBS and maintained at 37 C in 5 % CO2.

Viral isolation from mosquito pools

The pooled mosquitoes were homogenized and passed through a sterile 0.45-lm lter. The ltrates were diluted in culture medium and used to inoculate monolayers of C6/36 cells. The cells were cultured for 7 days. After two additional blind passages, the supernatants were harvested and stored as a viral stock at -80 C.

Purication of viruses

The viruses isolated from the initial C6/36 cell culture were puried by plaque assay. In brief, diluted viral stocks were used to inoculate C6/36 cells. After a 1-h incubation at 28 C in 5 % CO2, the supernatants were replaced with

MEM containing 2 % FBS, 2 % NEAA, and 1 % Seq-Plaque GTG agarose (Lonza). After overnight incubation, plaques were picked and used for the next infection. The plaque purication was repeated twice.

For further purication, C6/36 cells were inoculated with the plaque-puried viruses. After 2 days of incubation, the supernatants were concentrated by ultraltration using Centriprep YM-50 concentrators (Millipore) and layered onto a 15 %70 % gradient of sucrose in phosphate-buffered saline (PBS). The samples were separated

by ultracentrifugation (83,000 g, 16 h, 4 C), and the formed layer was harvested and dialyzed with PBS.

For viral titration, C6/36 cells were infected with Bustos virus at a multiplicity of infection (MOI) of 0.1, and the supernatants were harvested at 0, 3, 6, 9, 24, 48, and 72 h postinfection. Viral titration was performed using the plaque assay described above, and the number of plaque-forming units (PFU) was determined.

Antibodies

The synthetic peptides CTHGNVLEISAAPGSWM, derived from the Bustos virus ORF1 sequence (amino acid positions 827-842, preceded by an additional C residue), CMIDNDGNELFTVTHTSTD, derived from the Bustos virus ORF2 sequence (amino acid positions 156-173, preceded by an additional C residue), and MVLKRTGTVVR PVSTARRAC, derived from the Bustos virus ORF3 sequence (amino acid positions 1-19), were used as antigens. Serum from a rabbit immunized with each peptide was recovered and used as antibody (Sigma).

Protein analysis

Protein samples from sucrose-gradient-puried virions and virus-infected C6/36 cells (0, 3, 6, 24, and 48 h post infection) were mixed with sample buffer containing bmercaptoethanol and then denatured at 95 C for 5 min. The samples were separated by 5-20 % gradient SDS-PAGE. The gels were stained with Oriole Fluorescent Gel Stain (Bio-Rad), and the protein bands were visualized under UV. For enzyme immunoassay, the proteins in the gels were transferred onto a PVDF membrane and then blocked with 2 % BSA in TBST. The membrane was incubated with primary antibodies against the appropriate synthetic peptide derived from the Bustos virus ORF1, 2, or 3 sequence described above. The membranes were rinsed in TBST and then allowed to react with secondary antibodies (goat anti-rabbit IgG-HRP conjugate, Milli-pore). The HRP substrates (ECL Prime Western Blotting Detection Reagent, GE Healthcare) was applied to the membrane, and signals were detected using a CCD camera.

For N-terminal sequencing of viral proteins, the virion proteins were separated by SDS-PAGE and then transferred to a PVDF membrane, followed by staining with CBB. The protein bands of interest were cut out and analyzed by ve rounds of reaction in a Procise 494 HT Protein Sequencing System (Applied Biosystems).

The deduced amino acid sequence of each ORF of the Negev and Bustos virus genomes was analyzed for prediction of transmembrane helices using TMHMM 2.0.

123

Novel negevirus isolated in the Philippines 81

Determination of the complete viral genome sequence

Viral RNAs were extracted from puried viruses using Isogen II (Nippon Gene) according to the manufacturers instruction. The RNAs were analyzed by denaturing agar-ose gel electrophoresis. To determine the viral genomic sequences, cDNA libraries were rst synthesized using a SeqPlex RNA Amplication Kit (Sigma). Adaptor-ligated cDNA libraries were then prepared using an Ion Plus Fragment Library Kit (ThermoFisher) and analyzed using an Ion PGM System (ThermoFisher) with a 314 chip kit. The sequence data were analyzed using CLC Genomic Workbench Software (QIAGEN).

The 50- and 30-terminal sequences were determined using the RACE method. In brief, viral RNA was labeled with DT88 oligo DNA [15] at the 30terminus of the RNA and then reverse transcribed using the DT89 primer [15]. The second adaptor (primer A, [16]) was ligated to the 30 terminus of the cDNA synthesized in the previous step, and the resultant DNAs were used for subsequent PCR. The rst PCR was performed with the following primer sets: for 50-RACE, PL17-r1 (50-GGGCA

GGAGTTTGGTGGAATTC-30, nucleotide positions 154-133) or PL42-r3 (50-CTTTATTACGAGATGTACAGATA

G-30, nucleotide positions 1,286-1,263) and B-RA (50-CTGA TCTAGACCTGCAGGCTCGAGGTGCACGGTCTACGA

GACCT-30); for 30-RACE, PL17-f1 (50-CTGGAGATG TAGCCACTTCAAG-30, nucleotide positions 9,372-9,393)

or PL42-f1 (50-CACTAACCCCTCAGGTCAGTGA-30, nucleotide positions 8,907-8,928) and DT89 primer. Semi-nested PCR was performed with an adaptor primer and the following nested primers: for 50-RACE, PL17-r2 (50-GTG

AGGAATTCCTGGTTAAGAC-30, nucleotide positions 130-109) or PL42-r4 (50-TGTATCTAAATCATGAACGTA GGC-30, nucleotide positions 1,240-1,217) and RA primer (50-CTGATCTAGACCTGCAGGCTC-30); for 30-

RACE, PL17-f2 (50-TTCCGAGCATCGCTGCGATTTG-30, nucleotide positions 9,398-9,419) or PL42-f2 (50-CCTCAT TCACTTTCACAGGTTTC-30, nucleotide positions 8,930-8,952) and DT89 primer. Amplied DNAs were subjected to agarose gel electrophoresis and subsequently extracted from the gel. DNA sequences were determined using an ABI 3130xl Genetic Analyzer (Applied Biosystems).

The complete nucleotide sequences of the viruses reported in this study have been submitted to the DDBJ/ GenBank/EMBL database under accession numbers LC103139 (Bustos virus strain PL42) and LC3140 (Negev virus strain PL17).

Phylogenetic analysis

Phylogenetic analysis was conducted using sequences for selected negeviruses and two other plant viruses, based on

the protein sequence deduced from the conserved RdRp gene. A multiple sequence alignment matrix was created using DDBJ ClustalW (http://clustalw.ddbj.nig.ac.jp/

Web End =http://clustalw.ddbj.nig.ac.jp/ ) with default settings. The aligned matrix data were conrmed manually, and the amino acid sequences that were completely conserved among viruses (complete deletion of gap/ missing data) were analyzed using the maximum-likelihood method with the JTT matrix model. The statistical signicance of the resulting tree was evaluated using a bootstrap test with 1,000 replications.

Northern hybridization

The template DNAs used to prepare RNA probes were synthesized by PCR with the specic primer sets PL42-orf3-s (50-GGTCCTCAAGCGTACTGGTA-30, nucleotide positions 8,337-8,356) and PL42-orf3-as (50-TTGGACGGTC

TAACGGACAC-30, nucleotide positions 8,699-8,680) or PL42northf1 (50-TTCGATACCCAGAACAAGGTTG-30, nucleotide positions 36-57) and PL42northr1 (50-CCT

TAACATGGTCAACTACATG-30 (nucleotide positions 386-365), one of which contained the T7 promoter sequence (50-TAATACGACTCACTATAGGG-30) at its 50 terminus.

Digoxigenin (DIG)-labeled RNA was synthesized from the amplied PCR products by using T7 RNA polymerase and DIG-UTP. RNA was extracted from puried Bustos virus particles or C6/36 cells infected with Bustos virus (MOI = 5) at 1, 3, or 5 h postinfection. In another experiment, RNA was extracted from infected cells at 3, 6, 24, or 48 h postinfection. The extracted RNAs were separated in a denaturing agarose gel and transferred to a nylon membrane (Hybond-N? , GE Healthcare). In the denaturing agarose gel electrophoresis, we used DynaMarker Prestain Marker for RNA High (Biodynamics Laboratory Inc.) as an RNA sizing standard. After immobilization using UV light, the membrane was incubated with hybridization solution (DIG Easy Hyb Granules, Roche) at 68 C for 30 min. The DIG-labeled probe was denatured by heating, suspended in hybridization solution (100 ng/ml), and incubated with the membrane at 68 C overnight. After washing, the membrane was incubated with blocking reagent (Roche), dissolved in maleic acid buffer (100 mM maleic acid, 150 mM NaCl, pH7.5) for 30 min, and incubated with blocking solution containing an anti-DIG -AP Fab fragment (Roche) for 30 min. The membrane was washed and reacted with CDP-star substrate (Roche), and images were obtained using a CCD camera.

The transcription start sites (TSSs) of the viral subgenomic RNAs were determined using a GeneRacer kit (Invitrogen) according to the manufacturers instructions. For PCR, we used an adaptor primer and the specic primers PL42-orf1-as (50-AATTGTTCAAGAGGGGATAGAG-30, nucleotide positions 2,186-2,165), PL42-orf2-as (50-

123

82 R. Fujita et al.

GACAAAATGCGACGGACACGT-30, nucleotide positions 7,408-7,388), and PL42-orf3-as (50-TTGGACGGTC

TAACGGACAC-30, nucleotide positions 8,699-8,680), and the amplication products were sequenced.

Strand-specic RT-PCR

Mammalian BHK-21 cells were challenged with Bustos virus (MOI = 10). The supernatant and cells were harvested at 0, 2, 4, and 6 days postinfection, and RNAs were extracted using Isogen II. Strand-specic RT-PCR was performed using an RNA PCR kit and PrimeSTAR max (Takara) using the specic primer sets PL42-orf1-s (50-

TTCCCTATTACTCGTGTTGTTTC-30, nucleotide positions 1,976-1,998) and PL42-orf1-as (50-AATTGTTCAA GAGGGGATAGAG-30, nucleotide positions 2,165-2,186).

The amplied DNAs were separated by agarose gel electrophoresis.

Results

Isolation of viruses from mosquito pools

We isolated viruses from mosquitoes collected in Bustos, Bulacan province, Philippines (summarized in Supplementary Table 1). In this experiment, 2 of 43 pooled samples (PL17 from Culex vishnui and PL42 from Mansonia sp.) induced severe CPE in mosquito C6/36 cells. The viruses isolated using this procedure were plaque puried (Fig. 1a) and subsequently puried using sucrose gradient ultracentrifugation. We then extracted viral RNA from the puried virions. Both viruses had RNA genomes that were around 9 kb in length (Fig. 1b). To identify these viruses, the viral RNAs were subjected to next-generation sequencing and RACE analyses. The viral genomic RNAs of PL17 and PL42 are composed of 9,537 and 9,112 nucleotides, respectively, followed by a 30 poly(A) tail. Both of the genomic RNAs contain three ORFs in their positive strands (Fig. 1d). The predicted sizes of the PL17-encoded proteins are 268 kDa (ORF1, 2,368 amino acids), 46 kDa (ORF2, 400 amino acids), and 22 kDa (ORF3, 208 amino acids). PL42 also encodes three proteins, with predicted sizes of 261 kDa (ORF1, 2,265 amino acids), 44 kDa (ORF2, 382 amino acids), and 22 kDa (ORF3, 197 amino acids) (Fig. 1c).

Previous phylogenetic analyses of negeviruses suggested that the negeviruses could be grouped into two distinct clades, called nelorpivirus (also called group I negevirus) and sandewavirus (also called group II negevirus) [5, 7, 8]. Phylogenetic analysis of the putative RdRp (ORF1) genes and genomic comparison revealed that the PL17 virus can be regarded as a new isolate of Negev virus (genomic nucleotide sequence similarity to Negev

virus M30957 [2] = 93.6 %) (Fig. 2). In contrast, PL42 formed a distinct branch within the sandewavirus cluster in the phylogenetic tree. We designated PL17 as Negev virus strain PL17, and because the highest similarity was to Santana virus BeAR517449 (50.2 %) [2], PL42 virus was designated as the new virus Bustos virus.

The amino acid sequence of Bustos virus ORF2 were more divergent than other genes. Pairwise alignment of the ORF2 sequence of Bustos virus with that of Santana virus showed only 28.2 % amino acid sequence identity, and21.6 % of the alignment had gaps, although Bustos virus was the most closely related in its ORF1 sequence to Santana virus. On the other hand, the ORF3 sequence of Bustos virus showed the highest similarity to that of Wallereld virus (56.5 % amino acid sequence identity). The gaps in the pairwise alignments of Bustos virus ORF1 and ORF3 with those of the closest relatives constituted11.0 % and 2.0 % of the sequence, respectively. These results implied that the genomic regions containing ORF2 and ORF3 had experienced repeated indel mutations or recombination during the evolution of negeviruses (see also Supplementary Fig. 1).

Growth kinetics of Bustos virus in C6/36 cells

When we performed plaque assays to purify Negev virus and Bustos virus, both viruses formed large plaques within 1 day of infection. This indicates that these two viruses replicate rapidly in C6/36 cells. Analysis of the growth kinetics of Bustos virus revealed that the release of infectious viral particles could be observed within 6 h postinfection, and viral growth reached a plateau at 24 h postinfection (Fig. 3). The viral titer in the cell supernatant was approximately 5 9 109 PFU/ml at24 h postinfection, indicating remarkably rapid and efcient propagation in C6/36 cells.

Composition of the viral particles and expression of the viral proteins in infected cells

To characterize the viral structural proteins, puried viral particles were analyzed by SDS-PAGE. We detected two major bands and two minor bands from Negev virus and one major band and two minor bands from Bustos virus (Fig. 4a). Size estimation suggested that a protein migrating at 27 kDa would be encoded by ORF3 for both viruses. This 27-kDa protein is the major component in Bustos virus particles, suggesting that this protein is a major capsid protein (CP). To conrm the identity of the CP gene, we performed N-terminal sequencing of the Bustos virus 27-kDa protein (Fig. 4b). We found that the N-terminal sequence of the 27-kDa protein is consistent with the predicted N-terminal sequence of ORF3, indicating that Bustos virus ORF3 encodes the major CP. (The N-terminal translation initiator

123

Novel negevirus isolated in the Philippines 83

a

b

c

Fig. 1 (a) Cytopathic effects in C6/36 cells observed in a plaque assay for viruses isolated from mosquito pools PL17 and PL42 at 24 h postinfection. (b) Denaturing gel electrophoresis images of viral RNAs extracted from puried PL17 or PL42 viral particles. Single-stranded RNA size markers are shown on the left-hand side of the panels. (c) Schematic diagrams of PL17 and PL42 genomic RNA.

These genomes are polyadenylated at their 30 ends and contain three open reading frames (ORFs, open arrows). ORF2 and ORF3 are encoded in the ?1 and -1 reading frame, respectively, (relative to the ORF1) of the viral genome of PL17 (Negev virus) or PL42 (Bustos virus)

Met might be removed by a cellular methionine aminopeptidase [17, 18].) Western blot analysis using antibodies against a synthetic peptide derived from Bustos virus ORF3 also supported these results (Fig. 4c).

The 39-kDa protein of Negev virus and the 49-kDa protein of Bustos virus might correspond to a product translated from ORF2 of each virus. Western blot analysis using antibodies against a synthetic peptide derived from Bustos virus ORF2 conrmed that the 49-kDa protein in the virion was encoded by ORF2, although the apparent size of the protein was larger than predicted from the amino acid sequence (Fig. 4c).

Bustos virus ORF1 was predicted to encode a 261-kDa protein (Fig. 1c). Western blot analysis using antibodies against a synthetic peptide derived from Bustos virus ORF1 detected an approximately 127-kDa protein in C6/36 cells at 48 h postinfection (Fig. 4c). The size of the protein detected was denitely smaller than estimated, suggesting that the ORF1 product of Bustos virus is post-translationally processed [6].

We also found an approximately 63-kDa protein from both Negev virus and Bustos virus. However, its size is not consistent with the molecular mass predicted from the full-length ORF sequences. Unfortunately, we could not

123

84 R. Fujita et al.

Fig. 2 Phylogenetic analysis of PL17 (Negev virus) and PL42 (Bustos virus) with other negeviruses and three related plant viruses base on the RdRp (ORF1) sequences. The GI number of each viral sequence is as follows: Negev virus, 384638719; Negewotan virus, 428227288; Okushiri virus, 937574533; Piura virus, 384638729; Brejeira virus, 693673103; Loreto virus, 384638744; Tanay virus, 629633533; Santana virus, 384638724; Goutanap virus, 675145302; Wallereld virus, 693673053; Dezidougou virus, 384638714; Negev-

like virus, 829496479; hibiscus green spot virus, 355348566; and citrus leprosis virus C, 109255261. The amino acid sequences encoded by the putative RdRp genes (ORF1) were aligned, and the amino acid sequence stretches conserved among these viruses were used for the analysis. The tree was produced using the maximum-likelihood method based on a JTT matrix-based model with 1,000 bootstrap replications. Bootstrap replications are shown on the branches

Fig. 3 Bustos virus growth kinetics in C6/36 cells, determined using a plaque assay. The cells were infected with Bustos virus (multiplicity of infection = 0.1), and the cell culture supernatants were harvested at 0, 3, 6, 9, 24, 48, and 72 h postinfection. The experiments were performed in triplicate, and the standard deviations are shown

identify this protein by N-terminal sequencing, possibly because it contains a blocked N-terminal residue (data not shown).

Bustos virus gene expression

Whole-genome analysis showed that ORF2 and ORF3 of Negev virus (strain PL17) are encoded in the ?1 reading frame (relative to ORF1), whereas ORF2 and ORF3 of

Bustos virus are encoded in the -1 reading frame (Fig. 1c). In Santana virus, the closest relative of Bustos virus, ORF2 is encoded in the -1 reading frame and ORF3 is encoded in the same frame as ORF1 [2]. These observations led to the hypothesis that the putative proteins encoded by ORF2 and ORF3 of the negeviruses are translated from independent subgenomic RNAs. To test this hypothesis, we analyzed the transcripts arising from Bustos virus genes in infected C6/36 cells by Northern blot analysis using probes specic for ORF3 or the 50-UTR (Fig. 5a). Strand-specic detection of viral RNAs revealed that only positive-sense RNAs roughly equal to the genome length can be detected in puried viral particles (Fig. 5b and c). In infected cells, genome-length RNAs of both strands clearly appeared by 5 h postinfection (Fig. 5b, lanes 5 and 10). During this period, some smaller RNAs (about 2 and 1 kb in length) were also detected as major bands. As estimated from the sizes of these bands, these molecules could be subgenomic mRNAs containing ORF2 and 3 (a 2-kb RNA), and ORF3 (a 1-kb RNA), respectively (Fig. 5a). Because the corresponding smaller antisense RNAs were not detected during all periods of the experiment, these smaller sense-strand RNAs might be transcribed from the intergenic regions of the long antisense RNA. These ndings were conrmed by the results using a probe specic for the 50-UTR region (Fig. 5c). Interestingly, a sense-strand RNA molecule longer than the genome-length RNA (approximately 10 kb)

123

Novel negevirus isolated in the Philippines 85

a b

V L X R T M V L C R T

1 2 3 4 5 6

c

Fig. 4 Structural protein analysis of Negev virus and Bustos virus. (a) SDS-PAGE images of puried viral particles. Protein size markers are indicated on the left-hand side of the gel images, and the detected protein bands are indicated with black arrowheads. (b) The results of N-terminal amino acid sequencing of Bustos virus 27-kDa protein. The upper panel shows the resultant sequence of the 27-kDa protein after ve rounds of reaction, while the lower panel indicates the N-terminal amino acid sequences encoded by Bustos virus ORF3.

(c) The puried Bustos virus particles (lane 1) and the lysate of Bustos-virus-infected C6/36 cells (lane 2-6: mock, 3, 6, 24, and 48 h postinfection, respectively) were immunoreacted with antibodies against synthetic peptides derived from partial amino acid sequences of ORF1 (left), ORF2 (middle), or ORF3 (right). The size of each protein molecular weight marker is indicated on the left side of each panel

was detected only in the infected cells but not in puried virions (Fig. 5b and c). However, we could not characterize this long RNA molecule because the 50-RACE experiment did not identify any other molecules with a 5-extended sequence (Fig. 6).

We then examined the TSSs of the viral subgenomic RNAs using the RACE method. We detected three viral RNA species with 50-capped ends (Fig. 5a). Two of them were initiated at nucleotide positions 7,023 and 8,191 of the Bustos virus genomic RNA, which are located in the intergenic regions

123

86 R. Fujita et al.

b Fig. 5 Northern blot analyses of Bustos virus RNAs in C6/36 cells. (a) Schematic diagrams of the Bustos virus genome organization (upper) and presumptive viral RNA species detected in the analysis (lower). The transcriptional start sites (bent arrows) determined by 50-

RACE analysis are also shown. The positions of the probes used in the Northern blot analysis are indicated as black bars (probe 1 and 2). Gray boxes indicate ORFs corresponding to the upper diagram (b) Membrane images of Northern blots using the probes corresponding to the ORF3 region (probe 1). The left panel shows the results obtained using an antisense RNA probe to detect the sense strand. The right panel shows the results obtained using a sense RNA probe to detect the antisense strand at the same locus recognized by the antisense RNA probe. RNA extracted from puried Bustos virus particles (1.5 ng, lanes 1 and 6) and RNA extracted from mock-infected C6/36 cells were used as controls (lanes 2 and 7). Total RNA was extracted from C6/36 cells infected with Bustos virus (multiplicity of infection = 5) at 1 h (lanes 3 and 8), 3 h (lanes 4 and 9), or 5 h (lanes 5 and 19) postinfection. (c) Membrane images of the Northern blots using the probes corresponding to the 50-UTR region (probe 2). The left panel shows the results obtained using an antisense RNA probe to detect the sense strand. The right panel shows the results obtained using a sense RNA probe to detect the antisense strand at the same locus recognized by the antisense RNA probe. RNA extracted from puried Bustos virus particles (7.5 ng, lanes 1 and 6; 1.5 ng, lane 2 and 7) and RNA extracted from mock-infected C6/36 cells were used as controls. Total RNA was extracted from mock-infected C6/36 cells (lane 3 and 8) and cells infected with Bustos virus (multiplicity of infection = 5) at 6 h (lanes 4 and 9) or 24 h (lanes 5 and 10) postinfection

a

b

c

8 4

2

1 0.5 0.2

between ORF1 and ORF2 and between ORF2 and ORF3, respectively. The lengths of putative transcripts from these start sites are consistent with those detected in the Northern blot analysis described above (Fig. 5a).

Evaluation of Bustos virus infectivity in BHK-21 cells

To examine whether Bustos virus could infect and multiply in mammalian cells, we performed an infection experiment and subsequent strand-specic RT-PCR assay. In this experiment, we could not detect any viral RNAs in BHK-21 cells incubated with the Bustos virus at an MOI of 10, indicating a lack of infectivity. Throughout the study period, both positive- and negative-sense RNAs were detected in the culture supernatants, which are probably derived from remnants of the virus inoculum.

Discussion

Recently, viruses belonging to the negevirus group have been isolated from a variety of mosquito species worldwide [28]. In this study, we isolated and characterized a Negev virus from Cx. vishnui and Bustos virus from Mansonia sp. in the Philippines. Negev viruses were rst isolated from Anopheles coustani in Israel and Culex quinquefasciatus and Culex coronator in the United States [2]. In Southeast Asia, Ngewotan virus, a close relative of Negev virus, was isolated from Cx. vishnui in Indonesia [2]. The host mosquito species and natural habitat of the Negev virus strain isolated in this study share similarities with those of Nge-wotan virus; however, the genomic sequence of the Negev virus strain isolated in this study is more similar to those of other known Negev virus strains. These facts imply that the evolution and adaptation of Negev viruses do not simply depend on their hosts and habitats.

In general, negevirus genomes contain three ORFs on the positive strand. Our Northern blot analysis of Bustos virus suggested that the putative proteins encoded by the second and third ORFs might be translated from subgenomic RNAs transcribed in infected cells (Fig. 5). The 1-kb transcript encoding only ORF3 was the most abundant of all viral RNAs in infected cells, which agrees well with the relative abundance of the ORF3-encoded 27-kDa protein in the virus particles. In contrast, transcription of the 2-kb RNA species was initiated at position 7,023 in the

123

Novel negevirus isolated in the Philippines 87

a

b

Fig. 6 Detection of Bustos virus RNA from BHK-21 cells inoculated at a multiplicity of infection of 10. (a) To detect the viral sense strand, strand-specic RT-PCR was performed using the RNA extracted from the cell culture supernatants (medium) or infected BHK-21 cells

(cells) at 0, 2, 4, or 6 days postinoculation. (b) To detect the viral antisense strand, strand-specic RT-PCR was performed using the same RNA as used above

viral genomic RNA (Fig. 5). Because the rst AUG codon of ORF2 (at positions 7,0247,026) is located just adjacent to the TSS, it is not likely to be used as the actual translation initiator. Therefore, the ORF2 product is likely to be translated from the second AUG codon (at positions 7,0877,089), resulting in the production of a putative 41-kDa protein. However, the apparent size of the ORF2-encoded protein was 49 kDa, which was larger than predicted (Fig. 4c). This could be due to a post-translational modication such as glycosylation. Indeed, in silico analysis of glycosylation sites (NetOGlyc 4.0) predicted six potential glycosylation sites at amino acid positions 168, 231, 235, 243, 249, and 258 in ORF2 [19].

ORF2 and ORF3 of Bustos virus are thought to encode virion proteins (Fig. 4). In previous studies, ORF2 and ORF3 of negeviruses were predicted to have several transmembrane domains [2, 8]. Prediction of transmembrane domains using the TMHMM program also showed that Bustos virus ORF2 possesses a transmembrane domain in its C-terminal region, and Bustos virus ORF3 has three predicted transmembrane domains (Supplementary Fig. 2). This conserved feature of negevirus ORF2 and ORF3 proteins suggested the functional importance of the membrane localization of these proteins, although it is not clear whether negeviruses are enveloped or not.

Bustos virus particles also contained a 63-kDa protein (Fig. 4a), which is larger than the predicted molecular mass of the ORF2 or ORF3 product, but smaller than that of the ORF1 product. Because the intergenic region between ORF2 and ORF3 contains two in-frame stop codons, it seems unlikely that the protein is a readthrough product of the two downstream ORFs. This hypothesis is also supported by the fact that ORF2 and ORF3 of Santana virus, the closest relative of Bustos virus, are encoded by different frames separated by an intergenic region containing

multiple stop codons [2]. Nabeshima et al. [6] reported that the culture uid of Tanay-virus-infected cells contains processed or internally translated polypeptides derived from ORF1. Our Western blot analysis suggested that at least the 63-kDa protein did not contain the amino acid sequence corresponding to residues 821-842 of ORF1 (Fig. 4c). Further studies are needed to identify the origin and production process of this virion protein.

Bustos virus, a new distinct member of the sandewavirus group (group II negevirus), showed efcient infection and a high replication rate in mosquito C6/36 cells, whereas no infectivity was observed in mammalian BHK-21 cells. Similar infectivity was seen with Negev virus, a member of the nelorpivirus group (group I negevirus) [2]. The known negeviruses are distributed worldwide and are found in various species of mosquitoes, including important arbovirus vectors; however, there has been no report on the natural transmission cycle or the natural host range of negeviruses. Information about the natural history of negeviruses, particularly the mechanism of circulation and maintenance in nature, would be important for understanding the geographic distribution, genetic diversity, and evolution of the negeviruses.

Acknowledgements This research was supported by JSPS KAKENHI Grant Number JP25305010 and the Research Program on Emerging and Re-emerging Infectious Diseases from Japan Agency for Medical Research and Development, AMED.

Compliance with ethical standards

All authors declare that they have no conict of interest. All of the animal procedures were conducted in accordance with the guidelines of the National Institute of Infectious Diseases in Japan. This article does not contain any studies with human participants performed by any of the authors.

123

88 R. Fujita et al.

References

1. Zouache K, Failloux A-B (2015) Insect-pathogen interactions: Contribution of viral adaptation to the emergence of vector-borne diseases, the example of chikungunya. Curr Opin Insect Sci. doi:http://dx.doi.org/10.1016/j.cois.2015.04.010

Web End =10.1016/j.cois.2015.04.010

2. Vasilakis N, Forrester NL, Palacios G et al (2013) Negevirus: a proposed new taxon of insect-specic viruses with wide geographic distribution. J Virol 87:24752488. doi:http://dx.doi.org/10.1128/JVI.00776-12

Web End =10.1128/JVI. http://dx.doi.org/10.1128/JVI.00776-12

Web End =00776-12

3. Ferreira DD, Cook S, Lopes et al (2013) Characterization of an insect-specic avivirus (OCFVPT) co-isolated from Ochlerotatus caspius collected in southern Portugal along with a putative new Negev-like virus. Virus Genes 47:532545. doi:http://dx.doi.org/10.1007/s11262-013-0960-9

Web End =10.1007/ http://dx.doi.org/10.1007/s11262-013-0960-9

Web End =s11262-013-0960-9

4. Auguste AJ, Carrington CVF, Forrester NL et al (2014) Characterization of a novel Negevirus and a novel Bunyavirus isolated from Culex (Culex) declarator mosquitoes in Trinidad. J Gen Virol 95:481485. doi:http://dx.doi.org/10.1099/vir.0.058412-0

Web End =10.1099/vir.0.058412-0

5. Kallies R, Kopp A, Zirkel F et al (2014) Genetic characterization of goutanap virus, a novel virus related to negeviruses, cileviruses and higreviruses. Viruses 6:43464357. doi:http://dx.doi.org/10.3390/v6114346

Web End =10.3390/v6114346

6. Nabeshima T, Inoue S, Okamoto K et al (2014) Tanay virus, a new species of virus isolated from mosquitoes in the Philippines. J Gen Virol 95:13901395. doi:http://dx.doi.org/10.1099/vir.0.061887-0

Web End =10.1099/vir.0.061887-0

7. Carapeta S, do Bem B, McGuinness J et al (2015) Negeviruses found in multiple species of mosquitoes from southern Portugal: isolation, genetic diversity, and replication in insect cell culture. Virology 483:318328. doi:http://dx.doi.org/10.1016/j.virol.2015.04.021

Web End =10.1016/j.virol.2015.04.021

8. Kawakami K, Kurnia YW, Fujita R et al (2016) Characterization of a novel negevirus isolated from Aedes larvae collected in a subarctic region of Japan. Arch Virol 161:801809. doi:http://dx.doi.org/10.1007/s00705-015-2711-9

Web End =10.1007/ http://dx.doi.org/10.1007/s00705-015-2711-9

Web End =s00705-015-2711-9

9. Rattanarithikul R, Harbach RE, Harrison BA et al (2010) Illustrated keys to the mosquitoes of Thailand VI. Tribe Aedini. Southeast Asian J Trop Med Public Health 41(suppl 1):1225

10. Rattanarithikul R, Harbach RE, Harrison BA et al (2007) Illustrated keys to the mosquitoes of Thailand V. Genera

Orthopodomyia, Kimia, Malaya, Topomyia, Tripteroides, and Toxorhynchites. Southeast Asian J Trop Med Public Health 38(suppl 2):16511. Rattanarithikul R, Harrison BA, Harbach RE et al (2006) Illustrated keys to the mosquitoes of Thailand IV. Anopheles. Southeast Asian J Trop Med Public Health 37(suppl 2):1128

12. Rattanarithikul R, Harrison BA, Panthusiri P et al (2007) Illustrated keys to the mosquitoes of Thailand III. Genera Aedeomyia Ficalbia, Mimomyia, Hodgesia, Coquilletidia, Mansonia, and Uranotaenia. Southeast Asian J Trop Med Public Health 37(suppl1):18513. Rattanarithikul R, Harbach RE, Harrison BA et al (2005) Illustrated keys to the mosquitoes of Thailand II. Genus Culex. Southeast Asian J Trop Med Public Health 36(suppl 2):197

14. Isawa H, Kuwata R, Hohino K et al (2011) Identication and molecular characterization of a new segmented double-stranded RNA virus isolated from Culex mosquitoes in Japan. Virus Res 155:147155. doi:http://dx.doi.org/10.1016/j.virusres.2010.09.013

Web End =10.1016/j.virusres.2010.09.013

15. Li Z, Yu M, Zhang H et al (2005) Improved rapid amplication of cDNA ends (RACE) for mapping both the 50 and 30 terminal sequences of paramyxovirus genomes. J Virol Methods 130:154156. doi:http://dx.doi.org/10.1016/j.jviromet.2005.06.022

Web End =10.1016/j.jviromet.2005.06.022

16. Attoui H, Billoir F, Cantaloube JF et al (2000) Strategies for the sequence determination of viral dsRNA genomes. J Virol Methods 89:147158. doi:http://dx.doi.org/10.1016/S0166-0934(00)00212-3

Web End =10.1016/S0166-0934(00)00212-3

17. Bradshaw RA, Brickey WW, Walker KW (1998) N-terminal processing: the methionine aminopeptidase and N alpha-acetyl transferase families. Trends Biochem Sci 23:263267. doi:http://dx.doi.org/10.1016/S0968-004(98)01227-4

Web End =10. http://dx.doi.org/10.1016/S0968-004(98)01227-4

Web End =1016/S0968-004(98)01227-4

18. Giglione C, Fieulaine S, Meinnel T (2015) N-terminal protein modication: bringing back into play the ribosome. Biochemie. 114:134146. doi:http://dx.doi.org/10.1016/j.biochi.2014.11.008

Web End =10.1016/j.biochi.2014.11.008

19. Steentoft C, Vakhrushev SY, Joshi HJ et al (2013) Precision mapping of the human O-GalNac glycoproteome through SimpleCell technology. EMBO J 32:14781488. doi:http://dx.doi.org/10.1038/emboj.2013.79

Web End =10.1038/emboj. http://dx.doi.org/10.1038/emboj.2013.79

Web End =2013.79

123