1. Introduction
Haemoglobin (Hb) plays an important role in oxygen transport. In primitive vertebrates such as lamprey, haemoglobin is a monomer. However, in most vertebrate species, including teleost fish, haemoglobin is a tetrameric molecule that consists of two α-globin subunits and two β-globin subunits with one heme group. In human, the haematopoiesis process takes place in bone marrow, but teleost fish do not have bone marrow, and a number of studies have revealed that haemopoietic tissue is found mainly in the head kidney (pronephros) and a smaller amount in the kidney (mesonephros) [1, 2]. However, blood element formation differs among teleost fish [1, 3–5], and while previous studies indicated that head kidney, kidney, and spleen are the main organs forming blood in some species, erythropoiesis is mostly found in kidney [6, 7].
Fish can adequately supply oxygen to all tissues during environmental variations, such as temperature, pH, and oxygen tension changes, by increasing their total haemoglobin content or changing the intrinsic oxygenation characteristics [8, 9]. The haemoglobin-oxygen affinity is higher in hypoxic water than in oxygenated water [10, 11]; as pH decreases, the oxygen affinity of haemoglobin decreases [12, 13]. In order to increase total haemoglobin content, fish usually change globin gene expression at the site of haematopoiesis, which is in turn regulated by adaptive molecular mechanisms [14–16].
Most marine elasmobranchs transferred to lower salinity water exhibit marked changes in plasma and erythrocyte osmolyte composition [17–21]. Plasma dilution and loss of osmolytes can alter the oxygen-carrying capacity and haemoglobin oxygen-binding properties of the blood [22]. In S. Aurata, under low-salt concentration, α1 and α2 globin mRNAs levels of the red blood cells (RBCs) increased and decreased, respectively, compared with normal conditions [14]. Unlike marine elasmobranchs, euryhaline flounders are able to survive in both FW and SW but, in common with other euryhaline fish species, maintain a lower blood tonicity in FW. This reflects the long-term adjustments in metabolism and the profile of ion and water transport across gut, kidney, bladder, and gill epithelia that fish require to survive in hypotonic environments. In FW, fish maintain volume regulation by excreting large quantities of urine through increased renal filtration rate and renal tubule diameter to enhance urine flow [23]. The changing metabolic status and blood tonicity may also cause changes in oxygen consumption. In addition, a number of studies have revealed that nitrite, which is a potent vasodilator in humans, is bioactivated by reaction with deoxyhaemoglobin to preferentially generate nitric oxide (NO) under hypoxic conditions. The physiological function of deoxyhaemoglobin in this process is as an electronically and allosterically regulated nitrite reductase [24–27].
Here, we report the characterization of cDNAs encoding four types of globin in the flounder, along with a preliminary analysis of gene expression and tissue distribution of globins. The kidney was confirmed as the major site of globin expression in this species. Using quantitative real-time PCR measures of the four types of globin mRNA expression, we have examined differences in globin expression along with NO content in kidneys of chronically FW- and SW-adapted fish.
2. Materials and Methods
2.1. Animals
The flounder, Platichthys flesus, were collected from Morecambe Bay (Cumbria, UK) and transported to aquarium facilities at the University of Manchester. Flounder were of mixed sex and ranged in weight from 300 to 500 g. The flounder were maintained in recirculating, filtered SW (seawater, Natureland, Skegness, UK) or FW (tap water) tanks at 10–12°C under a 12 h : 12 h/light : dark photoperiod for at least 2 weeks before experimentation. All experiments were performed in accordance with United Kingdom Home Office Regulatory requirements.
2.2. Animal Experiments
To determine the steady-state conditions of fully acclimated animals, fish were studied after being held in SW or FW for 2 weeks in October. Fish were removed from tanks and without anesthetic, blood samples (3–6 mL) were collected within 90 sec into ammonium-heparinized syringes by needle puncture of the caudal blood vessels. Red blood cell count (RBC), hemoglobin (Hb), and hematocrit (Hct) were measured immediately, while plasma obtained by centrifugation of blood was analysed for total NO and electrolytes. The flounder were humanely killed and to reduce RBC contamination of tissue globin content blood was quickly removed from tissues by whole body perfusion via the heart with 50 mL ammonium-heparinized saline solution. Tissues (brain, spinal cord, CNSS, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad, and muscle) were then removed and immediately snap frozen in liquid nitrogen.
2.3. RNA Preparation
Total RNA was extracted from tissues using TRIZOL reagent in accordance with the manufacturer’s protocol (Invitrogen, Paisley, UK), and RNA yield was quantified using a NanoDrop spectrophotometer ND-1000 (NanoDrop, Wilmington, DE). At this stage, total RNA from each sample (
2.4. cDNA Library Construction and EST Sequence
First strand cDNA synthesis was carried out using the Clontech SMART cDNA Library Kit (Clontech, Basingstoke, UK) as detailed by the manufacturers and amplified by polymerase chain reaction (PCR). The resulting cDNA was purified, cloned to the pDNR-LIB vector (Clontech, Basingstoke, UK), and then transformed into DH5α Escherichia coli (Eurogentec). Following cloning, 2,794 colonies (29 plates of 96 wells) were randomly picked from kidney library, sequenced (Macrogen, Seoul, Korea), and aligned with BLAST (basic local alignment search tool) against available databases using Trace2dBest [28]. The sequence alignment and homology analysis was performed using DNAMAN V4.15 software.
2.5. Northern Blot Analysis
10 μg of total RNA from 15 perfused SW flounder tissues (brain, spinal cord, CNSS, gill, head kidney, kidney, bladder, stomach, intestine, rectum, heart, spleen, liver, gonad, and muscle) were electrophoresed on 1% denaturing agarose formaldehyde gel for 2.5 h at 150 V. The RNA samples were then blotted and subsequently fixed onto Hybond N nylon membranes (Amersham Biosciences, Buckinghamshire, UK) as previously described [29]. The full-length flounder α1-globin and β1-globin were used as cDNA probes for Northern blotting.
2.6. Real-Time Quantitative PCR Analysis
The tissue distribution of α-globin and β-globin mRNAs was analyzed by quantitative PCR of the 15 pooled total RNA tissue samples described above. The effect of salinity on kidney α-globin and β-globin mRNA expression was also examined for individual flounder samples (
Table 1
Gene-specific primers and probes for α-globin, β-globin, β-actin, and 18S rRNA.
Name of primer | Sequence of primer 5′-3′ |
---|---|
Hbα1 sense-221F | TCCGCTCCGGTGAGGAA |
Hbα1 antisense-323R | GCTCGCTGTATTTGGAGAGGAA |
Hbα1 TaqMan probe-273T | 6-FAM-CCGTCGGACACATGGATGATCTTCAA-TAMRA |
Hbα2 sense-261F | GGGCATGGGCGTGAAAT |
Hbα2 antisense-329R | AAGGCGTGCAGCTCACTGA |
Hbα2 TaqMan probe-279T | 6-FAM-CATCGTTACTCTCACCGAAGCCAT-TAMRA |
Hbβ1 sense-F | CATGGTCCAGTGGACAGATAGT |
Hbβ1 antisense-R | CTCCCCCACATCGATTTTTC |
Hbβ1 TaqMan probe-T | 6-FAM-AGCGCAGCGCCATCATTTCCCTTTG-TAMRA |
Hbβ2 sense-30F | CATGGTCCAGTGGACAGATAGC |
Hbβ2 antisense-100R | TCTCCCCCACATCGATTTTC |
Hbβ2 TaqMan probe-53T | 6-FAM-AGCGCAGCTCCATCATTGCCCTATG-TAMRA |
Actin sense-352F | AAGATGACCCAGATCATGTTCGA |
Actin antisense-454R | CGATACCAGTGGTACGACCAGA |
Actin TaqMan probe-382T | 6-FAM-AACACCCCCGCCATGTACGTTGC- TAMRA |
18S sense-625F | TCGTAGTTCCGACCGTAAACG |
18S antisense-691R | GCCCGGCGGGTCAT |
18S TaqMan probe-649T | 6-FAM-CCAACTAGCGATCCGGCGG-TAMRA |
The optimization and validation of primers and probes were performed using standard ABI protocols. PCRs were performed in triplicate as described by Lu et al. [30]. For the relative quantification of α-globin and β-globin genes expression, the
2.7. In Situ Hybridisation (ISH)
The head kidney and kidney were dissected and fixed in 4% paraformaldehyde [31] and embedded in paraffin wax. Longitudinal 4 μm thick sections were cut, mounted on positive charged slides, and incubated at 60°C for 5 days. In situ hybridization was carried out as previously described [29]. The full-length flounder α1-, α2-, β1-, and β2-globin were used to synthesize 35S-labelled RNA probes for in situ hybridisation.
2.8. Immunocytochemistry
The α-globin (H80) or β-globin (H-76) antibodies were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, Calif). These rabbit polyclonal antibodies were raised against amino acid 62–142 of human haemoglobin α and amino acid 62–147 mapping near the C-terminus of human haemoglobin β. Antibody specificity was tested by Western blotting on Wistar rat and flounder blood cell samples. The proliferating cell nuclear antigen (PCNA, C-20; Santa Cruz) antibody is a goat polyclonal IgG mapped at the C-terminus of PCNA of human origin. PCNA is a highly conserved protein in both animal and plant systems and was used as a marker for the heamopoietic stroma of kidney. Immunocytochemistry was carried out based on the method of Lu et al. [30] using goat antirabbit or rabbit antigoat antiserum (DAKO, UK), respectively, as the linking reagent and diaminobenzidine as the chromogen. Control experiments were carried out by omitting the primary antibody.
2.9. Total NO Measurement
To assess the relative nitric oxide status of SW and FW fish kidneys, renal tissue samples from 7 SW- or 7 FW-adapted fish were pooled. NO breakdown products (NO x ) were measured using an enzymatic test (Immundiagnostik, Bensheim, Germany) according to the manufacturer’s instructions.
2.10. Statistical Analysis
Plasma and blood analysis data are presented as means ± SE, and comparisons are by t-test. Results for tissue measurements of the mRNA levels of α1-globin, α2-globin, β1-globin, and β2-globin are also expressed as means ± SE. Differences between groups were analysed by ANOVA. Significance levels were set at *
3. Results
3.1. Isolation and Characterization α-Globin and β-Globin cDNA
Six α1-globin (accession number: HQ843790), three α2-globin (Accession number: HQ843791), six β1-globin (accession number: HQ843792), and two β2-globin (accession number: HQ843793) cDNA clones were obtained following sequence screening of 2,794 randomly picked colonies from the kidney library. They were characterized by nucleotide sequence analysis. The entire open reading frames (including stop codon) of α1 and α2 genes were 432 and 435 bp long, encoding a putative protein of 143 and 144 amino acids, respectively. The α2-globin had a Gly inserted at residue 48 (Figure 1). Comparison of the deduced amino acid sequences of flounder α1-globin and human α-globin polypeptide revealed that 12 of 16 heme interfaces, 9 of 16 α1β1 interfaces and 11 of 14 α1β2 interfaces were similar, but 5 of 6 Bohr effect residues were different (Supplementary, see Figure 1(a) in Supplementary Material available online at doi: 10.1155/2011/965153). The homology between α1 and α2 was 58.3% for nucleotides and 65.7% for deduced amino acids. The open reading frames (including stop codon) of β1 and β2 genes were both 447 bp encoding a putative protein of 148 amino acids. The homology between β1 and β2 was 89.9% for nucleotides and 98.6% for deduced amino acids. In the flounder β1-globin, 11 of 16 heme interfaces, 9 of 16 α1β1 interfaces, and 11 of 13 α1β2 interfaces were similar to those in human β-globin (Supplementary, see Figure 1(b) in Supplementary Material available online at doi: 10.1155/2011/965153). The deduced amino acid sequences of α-globin and β-globin only shared 15% identity.
[figure omitted; refer to PDF]3.2. Alignment of α-Globin and β-Globin Amino Acid Sequences
Cluster analysis of the two types of flounder α-globin cDNAs named α1 and α2 is presented in Figure 2(a). The homology of flounder α1 and α2 was 65.7%, and they were placed in different homology tree clusters. Amino acid homology of the flounder α1-globin gene compared with other reported fish ranged from 62.2% to 79.7%, whereas homology for α2-globin amino acid sequences was between 52.4% and 68.1%. The flounder α1-globin shared 50.0% and α2-globin 43.7% sequence homology with human α1- and α2-globin. Irrespective of the different nomenclature, the flounder α1-globin was closely related to yellowtail α-globin type A, red seabream α-globin type A, and gilthead seabream α-globin type 2, whereas flounder α2-globin was more closely related to yellowtail α-globin type B, Amoy croaker α-globin type 2, large yellow croaker α-globin type 1, red rum α-globin type 2, and gilthead seabream α-globin type 1.
[figures omitted; refer to PDF]
The homology analysis of the flounder β-globin cDNAs is shown in Figure 2(b), both have 148 amino acid residues. β1 and β2 shared 98.6% sequence homology and were placed together in the same homology tree cluster. Comparison of flounder β-globin with orthologous vertebrate β-globin showed that flounder β-globin shared between 59.9% and 85.0% homology with other fish β-globin, and only 50.3% homology with human β-globin. Cluster analysis showed that the β-globin gene in yellowtail was closest to that in flounder.
3.3. Tissue Distribution of Flounder α-Globin and β-Globin mRNA
Northern analysis on a range of flounder tissues showed that α-globin and β-globin transcripts were only present in head kidney, kidney, and spleen RNA samples (Figure 3(a)). The major band size was approximately 650 nucleotides, which was consistent with the predicted length based on the cDNA clones obtained. The relative α-globin and β-globin mRNA expression levels in different tissues were also determined by real-time PCR (Figure 3(b)). The expression levels of α-globin and β-globin mRNA in head kidney and kidney were much greater than in other tissues, while the spleen also appeared to express relatively high levels of α-globin and β-globin transcripts. The expression level of α-globin and β-globin mRNA in the kidney was 1.5 times higher than those in head kidney. In kidney, expression levels of the four individual types of globin mRNA also differed. Figure 3(c) shows that the expression levels of α1-globin and β1-globin mRNAs were higher than those of α2-globin and β2-globin mRNAs.
[figures omitted; refer to PDF]
3.4. Differential Expression of Globins between SW- and FW-Adapted Fish
Blood composition of chronically FW- and SW-adapted flounder is shown in Table 2. Plasma chloride, magnesium, and osmolality were significantly higher in SW- than in FW-adapted fish. No significant differences were evident for calcium, potassium, and sodium between long-term SW- and FW-adapted fish. There were also no significant differences in blood hematocrit, RBC, and haemoglobin content, which were slightly higher in FW- than in SW-adapted fish. Although there were no statistically significant differences in RBC or haemoglobin content between FW- and SW-adapted flounder, expression levels of α-globin and β-globin mRNAs in the kidney were significantly higher in FW- than in SW-adapted fish (Figure 4(a)). Notably, the pooled kidney NO x level in FW-adapted fish was double that in SW- adapted fish (Figure 4(b)).
Table 2
Plasma (a) and blood (b) composition of flounder chronically adapted to SW or FW.
(a)
Plasma composition.
SW | FW | |
---|---|---|
Osmolality (mosmo/kgH2O) | 302.62 ± 3.32 | 285.2 ± 3.35** |
Mg2+ (mmol/liter) | 4.7 ± 0.18 | 2.8 ± 0.35** |
Cl− (mmol/liter) | 141.4 ± 1.65 | 124.4 ± 2.21** |
Ca2+ (free) (mmol/liter) | 1.77 ± 0.027 | 1.8 ± 0.039 |
Na+ (mmol/liter) | 151.48 ± 2.39 | 146.92 ± 2.38 |
K+ (mmol/liter) | 2.7 ± 0.038 | 2.74 ± 0.13 |
(b)
Blood composition.
SW | FW | |
---|---|---|
Hematocrit (Hct) % | 25.82 ± 1.3 | 29.78 ± 1.7 |
RBC × 1012/L | 2.258 ± 0.1 | 2.562 ± 0.2 |
Hgb g/L | 74.4 ± 3.6 | 84.2 ± 5.4 |
Independent samples t-test was used to assess differences between chronically adapted FW and SW flounder and between experimental and time matched controls at each time point, *
[figures omitted; refer to PDF]
Further study of the kidney as the major site of α-globin and β-globin expression, by in situ hybridisation using 35S-labeled α-globin and β-globin RNA probes (antisense) showed that all four types of globin genes were expressed in cells around the renal blood vessels (Figure 5). Abundant expression of both α1 and β globin (both types of β globin) genes was evident in the FW-adapted fish kidney, and the incidence and apparent density of signal was much higher for β-globin than α1-globin. There was no precise signal detected in α2-globin-hybridised tissue sections. In SW-adapted fish kidney, the signal obtained was weak, and no cells contained precisely dark dots. The transcriptional activity of both α- and β-globin was clearly higher in FW- than in SW-adapted fish kidney tissue sections. RBCs were void of signal. The negative controls showed few silver grains, indicating the background produced by weak nonspecific binding (Supplementary, see Figure 2 in Supplementary Material available online at doi: 10.1155/2011/965153).
[figures omitted; refer to PDF]
In FW-adapted fish kidney, the immunoreactivity of α1-globin was located in both the haematopoietic stroma and the external contour of renal tubules, whereas β-globins were localised only in the haematopoietic stroma. In SW-adapted fish kidney, α1-globin was localised in the haematopoietic stroma and internal contour of tubules, but there was no detectable signal for β-globin (Figure 6). The protein expression level seemed to be higher in FW- than in SW-adapted kidney tissues. Immunoreactivity for PCNA in kidney appeared limited to the haematopoietic stroma, and again the expression level seemed to be higher in FW- than in SW-adapted kidney tissues (Figure 7). The heterogeneous nature of the results regarding the peroxidase precipitates intensity in kidney tissue sections and obviates more precise statements regarding the levels of PCNA, α-globin, and β-globin present.
[figures omitted; refer to PDF]
[figures omitted; refer to PDF]
4. Discussion
This paper is the first to describe the cloning and molecular characterization of flounder α- and β-globin genes, and to examine the effect of altered environmental salinity on α- and β-globin gene expression.
4.1. Molecular Identification and Characterization of α-Globin and β-Globin cDNA
Two α-globin genes were isolated, and the homology of deduced amino acid sequences was 65.7%. The α2-globin had one Gly insertion at position 48. However, Yellowtail α-globin type B has a Gly insertion at position 47 [32, 33]. Miyata et al. [33] suggested that an insertion of Arg or Asp residue at position 47 in carp α-globin produced only inconsequential changes in function and the three-dimensional structure of globin. Despite these structural similarities, a comparison of deduced amino acid sequences of the two types of flounder α-globin placed them in different homology tree clusters, namely, those that are structurally more akin to α1-globin, and those more akin to α2-globin. Flounder α1-globin is most closely related to that of yellowtail α-globin type A, red seabream α-globin type A, and gilthead seabream α-globin type 2 (75–78%), while Salmonidae α1-globin only shares 68% identity with flounder and occupies a separate group. The other two groups consist of the rest of known freshwater teleosts, namely, carp, goldfish, and zebrafish (72–75%), and a separate group which contains human α-globin (Figure 2(a)).
We isolated two β-globin genes in flounder, and the deduced amino acid sequences were 98.6% homologous, and considerably homologous with other vertebrate β-globins. Both types of flounder β-globin had a Phe residue at position 121, in contrast to a Lys residue in yellowtail β-globins, when compared with human β-globin [32]. Yoshizaki et al. [34] suggested that such a residue insertion may affect the function of β-globin. The homology tree was consistent with the phylogeny based on classical taxonomy. The two types of β-globin were placed together and although yellowtail β-globin was the closest β-globin of members of Sciaenidae, Cyprinidae, and Salmonidae were also close to that of flounder. It appears that β-globins are more conserved than α-globin in fishes.
4.2. Tissue Distribution of Flounder Globin mRNAs
Northern blot analysis of total RNA prepared from a range of flounder tissues revealed that the kidney (mesonephros), head kidney (pronephros), and spleen are major sites of expression of the α-globin and β-globin transcripts. Previous histological studies in Clarias gariepinus and Sarotherodon mossambicus revealed that the kidney, head kidney, and the spleen are the main organs forming blood [6]. Boomker also demonstrated that the cells forming the erythroid and granuloid lineage are mostly found in kidney, while thrombocytes and monocytes are formed in head kidney and spleen in these species [7]. The presence of higher levels of α-globin and β-globin transcripts in kidney, suggests that the kidney may be a more important site of erythropoiesis than head kidney and spleen in flounder.
4.3. Differential Expression of Globins between SW and FW
European flounders are able to survive in both FW and SW but, in common with other euryhaline fish species, maintain a lower blood tonicity, and also increased urine volume and reduced urine osmolality in the FW environment. In terms of blood oxygen transport, we did not see significant differences in blood hematocrit, RBC, or haemoglobin content between FW- and SW-adapted fish. In contrast, the expression levels of all four types of globin mRNAs in the kidney were significantly higher in FW-adapted compared with SW-adapted fish. This is consistent with the observed expression changes of two α-globins following exposure of the elasmobranch, S. aurata, to low salinity [14]. These observations suggest that Hb may be involved in some aspects of salinity adaption in fish although exactly the mechanism by which Hb is employed remains unclear.
To clarify these important observations, further investigations were performed using histochemical methods. The apparent increased necessity for globin protein in FW-adapted fish was further supported by the higher globin mRNA expression determined by ISH. This increased mRNA expression in FW kidney was regionalised in the haematopoietic stroma, in a group of cells probably associated with the early stages of erythrocyte generation, but no expression was identified in RBCs themselves. This was coincident with apparently greater immunoreactivity of PCNA, a cell proliferation marker, in the haematopoietic stroma of FW kidney tissue. Importantly, the immunohistochemistry results also showed that both α- and β-globin subunits were located in haematopoietic stroma, confirming the kidney as a major site of production of all four types of globin and of the erythropoietic processes.
In humans, deoxyhaemoglobin is an electronically and allosterically regulated nitrite reductase, and it can convert nitrite to NO preferentially under hypoxic conditions [24–27]. NO may also be controlled by haemoglobin binding properties [35]. Interestingly, kidney tubules dilate and tubule diameter increase in FW flounder [23]. The finding that kidney total NO level in FW-adapted fish was double that in SW-adapted fish, in combination with our previous studies [23], suggests that NO could perhaps play a role in variation of tubule diameter dependent upon haemoglobin binding and reductase activity. The exact mechanisms clearly warrant further investigation.
5. Conclusion
From this study, we conclude that head kidney, kidney, and spleen are erythropoietic tissues in flounder, The kidney is the major site of production of all four types of globin although all four types of globin genes are not expressed equally. Importantly, we also found that α- and β-globin mRNAs are differentially expressed in chronically FW- and SW-adapted flounder, which raises the possibility that, in fish, these globins may be important in some aspects of salinity adaptation. The newly generated deoxyhaemoglobin may play an important role in combating the hemodilution faced in FW. This may be particularly relevant for migratory fish such as flounder and salmonids as they move between media of different salinities. Similar mechanism may also be of importance in mammals and would be of interest to examine in the future.
Acknowledgments
This work was supported in part by Shanghai Education Commission Grant (no. 10ZZ102), Shanghai Ocean University (A-2400-09-0140), National Natural Science Foundation of China (31072228), and Science & Technology Committee of Shanghai (09320503500), and Natural Environment Research Council (NER/T/S/2001/00282) also funded the study.
Glossary
Abbreviations
Hb:Haemoglobin
PCR:Polymerase chain reaction
PCNA:Proliferating cell nuclear antigen
CNSS:Caudal neurosecretory system
NO x :Nitric oxide and nitrogen dioxide
Hct:Hematocrit.
[1] C. E. Willett, A. Cortes, A. Zuasti, A. G. Zapata, "Early hematopoiesis and developing lymphoid organs in the zebrafish," Developmental Dynamics, vol. 214 no. 4, pp. 323-336, 1999.
[2] J. H. Rombout, H. B. Huttenhuis, S. Picchietti, G. Scapigliati, "Phylogeny and ontogeny of fish leucocytes," Fish and Shellfish Immunology, vol. 19 no. 5, pp. 441-455, DOI: 10.1016/j.fsi.2005.03.007, 2005.
[3] J. Meseguer, M. A. Esteban, A. Garcia Ayala, A. Lopez Ruiz, B. Agulleiro, "Granulopoiesis in the head-kidney of the sea bass (Dicentrarchus labrax l.): an ultrastructural study," Archives of Histology and Cytology, vol. 53 no. 3, pp. 287-296, 1990.
[4] M. A. Esteban, J. Munoz, J. Meseguer, "Blood cells of sea bass (Dicentrarchus labrax L.). Flow cytometric and microscopic studies," Anatomical Record, vol. 258 no. 1, pp. 80-89, 2000.
[5] F. J. Stephens, S. R. Raidal, B. Jones, "Haematopoietic necrosis in a goldfish (Carassius auratus) associated with an agent morphologically similar to herpesvirus," Australian Veterinary Journal, vol. 82 no. 3, pp. 167-169, DOI: 10.1111/j.1751-0813.2004.tb12650.x, 2004.
[6] J. Boomker, "The haemocytology and histology of the haemopoietic organs of South African fresh water fish. I. The haemopoietic organs of Clarias gariepinus and Sarotherodon mossambicus," Onderstepoort Journal of Veterinary Research, vol. 46 no. 4, pp. 217-222, 1979.
[7] J. Boomker, "The haematology and histology of the haemopoietic organs of South African freshwater fish. III. The leucocytes, plasma cells and macrophages of Clarias gariepinus and Sarotherodon mossambicus," Onderstepoort Journal of Veterinary Research, vol. 48 no. 4, pp. 185-193, 1981.
[8] P. C. de Souza, G. O. Bonilla-Rodriguez, "Fish hemoglobins," Brazilian Journal of Medical and Biological Research, vol. 40 no. 6, pp. 769-778, 2007.
[9] M. E. Favero, F. F. Costa, "Alpha-hemoglobin-stabilizing protein: an erythroid molecular chaperone," Biochemistry Research International, vol. 2011,DOI: 10.1155/2011/373859, 2011.
[10] D. A. Powers, G. S. Greaney, A. R. Place, "Physiological correlation between lactate dehydrogenase genotype and haemoglobin function in killifish," Nature, vol. 277 no. 5693, pp. 240-241, 1979.
[11] M. Nikinmaa, "Haemoglobin function in vertebrates: evolutionary changes in cellular regulation in hypoxia," Respiration Physiology, vol. 128 no. 3, pp. 317-329, DOI: 10.1016/S0034-5687(01)00309-7, 2001.
[12] B. Giardina, D. Mosca, M. C. De Rosa, "The Bohr effect of haemoglobin in vertebrates: an example of molecular adaptation to different physiological requirements," Acta Physiologica Scandinavica, vol. 182 no. 3, pp. 229-244, DOI: 10.1111/j.1365-201X.2004.01360.x, 2004.
[13] F. B. Jensen, "Red blood cell pH, the Bohr effect, and other oxygenation-linked phenomena in blood O 2 and CO 2 transport," Acta Physiologica Scandinavica, vol. 182 no. 3, pp. 215-227, DOI: 10.1111/j.1365-201X.2004.01361.x, 2004.
[14] S. Campo, G. Nastasi, A. D'Ascola, G. M. Campo, A. Avenoso, P. Traina, A. Calatroni, E. Burrascano, A. Ferlazzo, G. Lupidi, R. Gabbianelli, G. Falcioni, "Hemoglobin system of Sparus aurata changes in fishes farmed under extreme conditions," Science of the Total Environment, vol. 403 no. 1–3, pp. 148-153, DOI: 10.1016/j.scitotenv.2008.05.027, 2008.
[15] C. Ton, D. Stamatiou, C. C. Liew, "Gene expression profile of zebrafish exposed to hypoxia during development," Physiological Genomics, vol. 13 no. 2, pp. 97-106, 2003.
[16] D. L. van der Meer, G. E. van den Thillart, F. Witte, M. A. G. De Bakker, J. Besser, M. K. Richardson, H. P. Spaink, J. T. D. Leito, C. P. Bagowski, "Gene expression profiling of the long-term adaptive response to hypoxia in the gills of adult zebrafish," American Journal of Physiology, vol. 289 no. 5, pp. R1512-R1519, DOI: 10.1152/ajpregu.00089.2005, 2005.
[17] J. A. Sulikowski, L. A. Maginniss, "Effects of environmental dilution on body fluid regulation in the yellow stingray, Urolophus jamaicensis," Comparative Biochemistry and Physiology A, vol. 128 no. 2, pp. 223-232, DOI: 10.1016/S1095-6433(00)00304-4, 2001.
[18] B. L. Mui, P. R. Cullis, E. A. Evans, T. D. Madden, "Osmotic properties of large unilamellar vesicles prepared by extrusion," Biophysical Journal, vol. 64 no. 2, pp. 443-453, 1993.
[19] P. K. T. Pang, R. W. Griffith, J. W. Atz, "Osmoregulation in elasmobranchs," American Zoologist, vol. 17 no. 2, pp. 365-377, 1977.
[20] T. J. Shuttleworth, "Salt and water balance-extrarenal mechanisms," Physiology of Elasmobranch Fishes, pp. 171-199, 1988.
[21] W. N. Holmes, E. M. Donaldson, "Body compartments and distribution of electrolytes," Fish Physiology, vol. 1, 1969.
[22] A. R. Cooper, S. Morris, "Haemoglobin function and respiratory status of the Port Jackson shark, Heterodontus portusjacksoni , in response to lowered salinity," Journal of Comparative Physiology B, vol. 174 no. 3, pp. 223-236, DOI: 10.1007/s00360-003-0405-1, 2004.
[23] E. Weybourne, J. M. Warne, H. Hentschel, M. Elger, R. J. Balment, "Renal morphology of the euryhaline flounder ( Platichthys flesus ): distribution of arginine vasotocin receptor," Annals of the New York Academy of Sciences, vol. 1040, pp. 521-523, DOI: 10.1196/annals.1327.109, 2005.
[24] R. Grubina, Z. Huang, S. Shiva, M. S. Joshi, I. Azarov, S. Basu, L. A. Ringwood, A. Jiang, N. Hogg, D. B. Kim-Shapiro, M. T. Gladwin, "Concerted nitric oxide formation and release from the simultaneous reactions of nitrite with deoxy—and oxyhemoglobin," Journal of Biological Chemistry, vol. 282 no. 17, pp. 12916-12927, DOI: 10.1074/jbc.M700546200, 2007.
[25] K. Cosby, K. S. Partovi, J. H. Crawford, R. P. Patel, C. D. Reiter, S. Martyr, B. K. Yang, M. A. Waclawiw, G. Zalos, X. Xu, K. T. Huang, H. Shields, D. B. Kim-Shapiro, A. N. Schechter, R. O. Cannon, M. T. Gladwin, "Nitrite reduction to nitric oxide by deoxyhemoglobin vasodilates the human circulation," Nature Medicine, vol. 9 no. 12, pp. 1498-1505, DOI: 10.1038/nm954, 2003.
[26] K. T. Huang, A. Keszler, N. Patel, R. P. Patell, M. T. Gladwin, D. B. Kim-Shapiro, N. Hogg, "The reaction between nitrite and deoxyhemoglobin: reassessment of reaction kinetics and stoichiometry," Journal of Biological Chemistry, vol. 280 no. 35, pp. 31126-31131, DOI: 10.1074/jbc.M501496200, 2005.
[27] S. Shiva, Z. Huang, R. Grubina, J. Sun, L. A. Ringwood, P. H. MacArthur, X. Xu, E. Murphy, V. M. Darley-Usmar, M. T. Gladwin, "Deoxymyoglobin is a nitrite reductase that generates nitric oxide and regulates mitochondrial respiration," Circulation Research, vol. 100 no. 5, pp. 654-661, DOI: 10.1161/01.RES.0000260171.52224.6b, 2007.
[28] S. Kalujnaia, I. S. McWilliam, V. A. Zaguinaiko, A. L. Feilen, J. Nicholson, N. Hazon, C. P. Cutler, G. Cramb, "Transcriptomic approach to the study of osmoregulation in the European eel Anguilla anguilla," Physiological Genomics, vol. 31 no. 3, pp. 385-401, DOI: 10.1152/physiolgenomics.00059.2007, 2007.
[29] E. Lu, L. Dow, S. Gumusgoz, M. J. Brierley, J. M. Warne, C. R. McCrohan, R. J. Balment, D. Riccardi, "Coexpression of corticotropin-releasing hormone and urotensin I precursor genes in the caudal neurosecretory system of the euryhaline flounder ( Platichthys flesus ): a possible shared role in peripheral regulation," Endocrinology, vol. 145 no. 12, pp. 5786-5797, DOI: 10.1210/en.2004-0144, 2004.
[30] W. Lu, M. Greenwood, L. Dow, J. Yuill, J. Worthington, M. J. Brierley, C. R. McCrohan, D. Riccardi, R. J. Balment, "Molecular characterization and expression of urotensin II and its receptor in the flounder ( Platichthys flesus ): a hormone system supporting body fluid homeostasis in euryhaline fish," Endocrinology, vol. 147 no. 8, pp. 3692-3708, DOI: 10.1210/en.2005-1457, 2006.
[31] A. E. Nikolaev, G. Myszkiewicz, G. Berden, W. L. Meerts, J. F. Pfanstiel, D. W. Pratt, "Twisted intramolecular charge transfer states: rotationally resolved fluorescence excitation spectra of 4,4'- dimethylaminobenzonitrile in a molecular beam," Journal of Chemical Physics, vol. 122 no. 8,DOI: 10.1063/1.1850092, 2005.
[32] K. Okamoto, M. Sakai, M. Miyata, "Molecular cloning and sequence analysis of α —and β -globin cDNAs from yellowtail, Seriola quinqueradiata," Comparative Biochemistry and Physiology B, vol. 130 no. 2 , pp. 207-216, 2001.
[33] M. M. Miyata, I. Hirono, T. Aoki, "Analysis of α -globin gene family of carp α -globin gene structure of no. 3, no. 6 and no. 7," Nippon Suisan Gakkaishi, vol. 59 no. 6, pp. 1077-1083, 1983.
[34] G. Yoshizaki, I. Hirono, T. Aoki, F. Takashima, "Cloning and sequencing of cDNAs of the β -globin gene family in carp," Journal of Fish Biology, vol. 51 no. 6, pp. 1125-1136, DOI: 10.1006/jfbi.1997.0515, 1997.
[35] T. L. Stepuro, V. V. Zinchuk, "Nitric oxide effect on the hemoglobin-oxygen affinity," Journal of Physiology and Pharmacology, vol. 57 no. 1, pp. 29-38, 2006.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2011 Weiqun Lu et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. https://creativecommons.org/licenses/by/4.0/
Abstract
In order to understand the possible role of globin genes in fish salinity adaptation, we report the molecular characterization and expression of all four subunits of haemoglobin, and their response to salinity challenge in flounder. The entire open reading frames of α1-globin and α2-globin genes were 432 and 435 bp long, respectively, whereas the β1-globin and β2-globin genes were both 447 bp. Although the head kidney (pronephros) is the predicted major site of haematopoiesis, real-time PCR revealed that expression of α-globin and β-globin in kidney (mesonephros) was 1.5 times higher than in head kidney. Notably, the α1-globin and β1-globin mRNA expression was higher than α2-globin and β2-globin in kidney. Expression levels of all four globin subunits were higher in freshwater- (FW-) than in seawater- (SW-)adapted fish kidney. If globins do play a role in salinity adaptation, this is likely to be more important in combating the hemodilution faced by fish in FW than the dehydration and salt loading which occur in SW.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 Key Laboratory of Exploration and Utilization of Aquatic Genetic Resources, Shanghai Ocean University, Shanghai 201306, China
2 Faculty of Life Sciences, The University of Manchester, Oxford Road, Manchester M13 9PT, UK
3 Laboratory of Adaptive Biology, College of Fisheries and Life Science, Shanghai Ocean University, 999 Huchenghuan Road, Shanghai 201306, China