MicroRNA-200c plays an oncogenic role in nasopharyngeal carcinoma by targeting PTEN

Abstract

Recent studies suggested that microRNA-200 family microRNAs play critical roles in cancer initiation and metastasis. The underlying mechanism remained elusive. In this study, we show that microRNA-200c is upregulated in nasopharyngeal carcinoma cells. Manipulation of microRNA-200c levels affected cell growth, migration, and invasion in nasopharyngeal carcinoma cell lines. Furthermore, PTEN was identified as a direct target of microRNA-200c. Overexpression of PTEN resulted in similar effects to those of anti-microRNA-200c transfection. In vivo suppression of microRNA-200c level reduced tumor growth in mice. Overall, our data suggest that microRNA-200c plays an oncogenic role in nasopharyngeal carcinoma by targeting PTEN.

Introduction

Nasopharyngeal carcinoma (NPC) is a radiosensitive malignancy that has high prevalence in Southern China and Southeast Asia and occurs in the epithelial lining of the nasopharynx.^1–3 Genetic predisposition, Epstein–Barr virus (EBV) infection, and environmental factors all contribute to the development of NPC.^4–8 Although combination of radiotherapy with chemotherapy is effective against locally confined tumors, relapsed and distantly metastasized NPCs remain as one of the major causes of cancer-related deaths in humans.⁹ It is therefore critical to understand the molecular mechanisms underlying the development and malignant transformation of NPC in hope to uncover novel targets for therapeutic treatment of this disease.

MicroRNAs (miRNAs) are endogenously expressed, small, single-stranded, noncoding RNAs that negatively regulate gene expression at the post-transcriptional level by directly targeting the 3′-untranslated region (3′-UTR) or open reading frames of target genes.¹⁰ MiRNAs play crucial roles in the pathogenesis of various diseases, such as acute graft-versus-host disease,¹¹ Alzheimer’s disease,¹² dilated cardiomyopathy,¹³ and cancers.¹⁴ Increasing evidences suggest that aberrant expression of miRNAs, such as that of miR-93,¹⁵ miR-143,¹⁶ miR-211,¹⁷ and miR-185,¹⁸ contributes to the pathogenesis of NPC.¹⁹ However, it is still not clear how miRNAs control NPC progression and metastasis.²⁰

The miR-200 family of miRNAs is comprised of five members. In humans, miR-200a, miR-200b, and miR-429 are located on chromosome 1p36.33, while miR-200c and miR-141 are located on chromosome 12p13.31. According to their seed sequences, miR-200 family can also be divided into two functional groups. MiR-200b/c/429 share the same seed sequence “AAUACUG,” while both miR-141/200a contain “AACACUG.”²¹ The expression levels of miR-200 family miRNAs were first found to be decreased during tumor progression. As suppressors of epithelial-to-mesenchymal transition (EMT), miR-200 family effectively inhibit tumor invasion and metastasis in serous papillary ovarian tumors, mesenchymal breast cancers, and pancreatic cancers.^22–24

In contrast, we now show that miR-200 family is upregulated in NPC cell lines. MiR-200c, a member of the miR-200 family, promotes NPC cell growth, migration, and invasion by targeting PTEN. Our data suggested an oncogenic role of miR-200c in NPC, which is different from previous reports in other cancers.

Materials and methods

Cell culture

Human NPC cell lines HONE1, HK1, and C666 were raised in RPMI-1640 medium (GIBCO) supplemented with 10% fetal bovine serum, 100 IU/mL penicillin, and 100 mg/mL streptomycin (GIBCO). Immortalized human nasopharyngeal epithelial cell line NP460 was grown in 1:1 ratio of defined Keratinocyte-SFM (DKSFM) medium supplemented with growth factors (GIBCO) and EpiLife medium supplemented with growth factor EDGS (GIBCO).

Transient transfection

MiR-200c, anti-miR-200c, miR-Ctrl, and anti-miR-Ctrl were synthesized by Invitrogen. PTEN plasmid was constructed by inserting the coding region of PTEN (gene bank ID: NM_001304718.1) into expression vector PTGFP (a modified vector from pEGFP-C1 and donated by Professor Liu, Shenzhen PKU-HKUST Medical Center). PTGFP vector was used as the control. HONE1, HK1, and NP460 cells were plated in six-well plates (3–4 × 10⁵ cells per well) for 16–18 h before transfected with miRNA or plasmid using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instruction. Cells were harvested 24 h or 48 h post transfection. Sequences and primers of miRNAs are listed in Table 1.

Table 1.

Primers list.

Primer name	Sequences: 5′–3′
miR-200c	UAAUACUGCCGGGUAAUGAUGGA
anti-miR-200c	UAACACUUGCCGGGUAAUGGUGUA
miR-Ctrl	UAACGUGUCACGUCUCCGACUA
anti-miR-Ctrl	UCUUGCCGGGCCCGAUCCAACGA
PTEN	CGGGATCCATGACAGCCATCATCAAAGACGGAATTCTCAGACTTTTGTAATTTGTGTATGC
snRNAU6	GCTTCGGCAGCACATATACTAAAATCGCTTCACGAATTTGCGTGTCAT

RNA extraction and quantitative reverse transcription-PCR

Total RNA was extracted using Trizol Reagent (Invitrogen) followed by reverse transcription. Complementary DNAs (CDNAs) were then used as templates in Real-time PCR using iQ™ SYBR® Green Supermix (Bio-Rad). RNU6B (U6) was used as the control for normalization, and relative expression levels were calculated using the 2^−ΔΔCT method. All experiments were repeated for at least three times.

MTS assay

After 24 h of transfection, cells were collected and re-seeded in 96-well plates (3 × 10³ cells per well) for cell growth assay using CellTiter 96 Aqueous reagent (Promega). Then, 10 µL MTS/PMS solution was added to each well and incubated for 1–3 h at 37°C. Absorbance was recorded at 490 nm using an enzyme-linked immunosorbent assay (ELISA) plate reader. All experiments were repeated three times with six parallel samples measured at each time.

Wound-healing assay

Cells were plated in six-well plates (4–5 × 10⁵ cells per well) and transfected with miRNA. When cells reached 90% confluence, artificial wounds were created on cell monolayer using a sterile 200-µL pipette tip. Wound areas were visualized under an optical microscope with a magnification of 200× at 0 and 24 h.

Trans-well invasion assay

Cell invasion was examined by using trans-well chambers (Corning) coated with Matrigel (BD Biosciences) on the upper surface of the membrane. Transfected cells were suspended in serum-free medium and re-seeded into the upper chamber. The culture medium containing 10% fetal bovine serum was added to the lower chamber. After 24 h of incubation at 37°C, cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. Cells in the upper chamber were removed with a cotton swab. Cells adhering to the bottom of the membrane were visualized under a light microscope at 200× magnification. The chamber was then soaked in 500 µL 33% glacial acetic acid, and the absorbance at 570 nm was recorded using an ELISA plate reader. The experiment was repeated for three times; three parallel samples were measured each time.

Antibodies and western blotting

Cells were harvested after 48 h of transfection and lysed in radioimmunoprecipitation assay (RIPA) buffer (150 mM NaCl, 5 mM ethylenediaminetetraacetic acid (EDTA), 50 mM Tris-HCl, 1% (v/v) Nonidet P-40, 0.5% sodium deoxycholate, 0.1% (w/v) SDS) containing protease inhibitors (cocktail; Sigma) and 1 mM phenylmethanesulfonyl fluoride (Sigma). Whole cell proteins were separated in 12% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) gels and transferred onto nitrocellulose membranes (PALL). The membranes were blocked with 5% (w/v) skim milk in TBS-T (Tris-buffered saline containing 0.1% Tween-20) buffer at room temperature (RT) for 1 h, followed by incubation with primary antibodies at 4°C overnight, anti-rabbit immunoglobulin G (IgG) secondary antibody at RT for 2 h, and enhanced chemiluminescence (ECL) detection reagent (Millipore) for the detection of protein expression levels. Primary antibodies used in this study include monoclonal anti-p-Akt (Thr473), anti-Akt, anti-p-Erk (Thr202/Tyr204), anti-Erk, anti-PTEN, and anti-GAPDH (Cell Signaling Technology). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as a loading control.

Luciferase reporter assay

3′-UTR of PTEN containing predicted miR-200c binding sites was inserted into a pMIR-REPORT vector (Ambion). NP460 and HONE1 cells were co-transfected with miR-200c or anti-miR-200c, pMIR-PTEN 3′-UTR wild-type vector (Wt) or pMIR-PTEN 3′-UTR mutant vector (Mt), and pMIR-REPORT β-gal control plasmid (Ambion) using Lipofectamine 2000 (Invitrogen). Dual-Luciferase Reporter Assay System (Promega) was used to analyze luciferase activities 48 h after transfection.

Tumor formation assay in nude mice

Male BALB/c nude mice (4 weeks old) were purchased from Charles River Laboratory (Beijing, China) and were randomly divided into four groups. NPC cell lines (HONE1 and HK1) were pre-transfected with anti-miR-200c or anti-miR-Ctrl. Around 1.5 × 106 transfected cells in 0.1 mL PBS containing 50% Matrigel were injected into both axilla subcutaneously. Same-host controls were employed to compare the effects of miR-Ctrl and anti-miR-Ctrl to those of miR-200c and anti-miR-200c transfection. Tumor diameters were measured every 2 days and tumor volume (V) was calculated using the formula: V = (L × W²)/2, where L was the length and W was the width of the tumor. Mice were sacrificed 25 days after cell injection, and tumors were dissected and weighted. All animal handling and research protocols were approved by the Animal Care and Use Ethnic Committee.

Statistical analysis

Data are represented as the mean ± standard error of the mean (SEM). Two-sided unpaired Student’s t-tests were used to analyze the statistical significance. Differences were considered statistically significant when p < 0.05.

Results

MiR-200c is upregulated in NPC cell lines

To investigate the roles of miR-200 family miRNAs in NPC tumorigenesis, we examined their expression levels in NPC cell lines (HONE1, HK1, and C666) and NP460 immortalized human NPC cells. Our results showed that miR-200 family members are all significantly upregulated in NPC cell lines (Figure 1). Among them, miR-200c is known to target PTEN expression (Supplementary Figure 1).

Figure 1.

Expression of miR-200 family miRNAs in NPC cell lines. Relative expression levels of miR-200 family microRNAs in three NPC cell lines HONE1, HK1, and C666 were examined by quantitative RT-PCR. Data are presented as mean ± SEM.

[Figure omitted. See PDF]

MiR-200c promotes the growth of NPC cells

To test the roles of miR-200c on NPC development, we transfected NPC cell lines HONE1 and HK1 with miR-200c/miR-Ctrl and anti-miR-200c/anti-miR-Ctrl. The levels of miR-200c were increased after transfection with miR-200c, and decreased after transfection with anti-miR-200c (Figure 2). By means of MTS assay, we found that miR-200c promotes the proliferation of NPC cells (Figure 3).

Figure 2.

Transfection of miR-200c. Levels of miR-200c in NPC cell lines HONE1 and HK1 were examined after transfection with (a) anti-miR-200c and (b) miR-200c, respectively (n = 3). Data are presented as mean ± SEM.

[Figure omitted. See PDF]

Figure 3.

MiR-200c promotes NPC cell growth. Representative images of the MTS assay of (a) HONE1 and (b) HK1 cells after transfection with anti-miR-200c and miR-200c. Data are presented as mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

MiR-200c promotes NPC cell migration and invasion

To investigate the roles of miR-200c in NPC malignant transformation and metastasis, we tested its impact on NPC cells’ ability to migrate and penetrate intercellular matrix. NPC cells that overexpressed miR-200c showed enhanced migrating capacity in the in vitro wound-healing assay, whereas those transfected with anti-miR-200c exhibited delayed gap closure (Figure 4). Transfection of anti-miR-200c to NPC cells also decreased their ability to invade intercellular matrix, whereas overexpression of miR-200c did not alter this process significantly (Figure 5). The latter may reflect the possibility that high basal level of miR-200c in NPC cells is already sufficient in promoting matrix invasion.

Figure 4.

MiR-200c promotes NPC cell migration. Representative images of the wound-healing assay of (a) HONE1 and (b) HK1 cells after transfection with miR-200c and anti-miR-200c, respectively. Images were taken under microscope at a magnification of 200× at 0 and 24 h. Data are presented as mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

Figure 5.

MiR-200c promotes NPC cell invasion through intercellular matrix. Representative images of trans-well invasion assay of HONE1 and HK1 cells after transfection with miR-200c (a) or anti-miR-200c (b). Cells were stained and captured under light microscope at a magnification of 200×. Data are presented as mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

PTEN is a direct target of miR-200c in NPC cells

To investigate the molecular mechanism by which miR-200c promotes NPC cell growth, migration, and invasion, we predicted potential targets of miR-200c by TargetScan. Among the predicted targets, PTEN is a known tumor suppressor gene. In order to confirm the targeting of PTEN by miR-200c, we cloned the 3′-UTR of PTEN into a luciferase reporter construct and tested the potential of miR-200c-mediated suppression on luciferase reading. As shown in Figure 6(b), NP460 cells transfected with miR-200c showed decreased luciferase activity compared with the control group. In contrast, HONE1 cells transfected with anti-miR-200c showed increased luciferase activity. Such changes were not observed when cells were transfected with luciferase constructs guided by PTEN 3′-UTR that carried mutation on putative miR-200c targeting site. Overexpression or downregulation of miR-200c also decreased or increased the level of PTEN proteins in NPC cells, respectively (Figure 6(c)).

Figure 6.

PTEN is a direct target of miR-200c in NPC cells. (a) Schematic diagram of putative miR-200c binding sites in human PTEN 3′-UTR. (b) Relative luciferase activity of NP460 and HONE1 cells after co-transfection with wild-type (Wt) or mutant (Mt) forms of PTEN 3′-UTR along with miR-200c and anti-miR-200c (n = 4). (c) Quantification of PTEN protein levels after transfection of miR-200c to NP460 and anti-miR-200c to HONE1 cells. Data are presented as mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

PTEN inhibits miR-200c-promoted NPC cell growth and invasion

To further verify PTEN as a direct target of miR-200c, we transfected NPC cell lines HONE1 and HK1 with a PTEN-GFP (green fluorescent protein) construct and miR-200c/miR-Ctrl (Figure 7(a)). Overexpression of PTEN reversed miR-200c-promoted cell growth (Figure 7(b)), and inhibited invasion of extracellular matrix similar to that by anti-miR-200c (Figure 7(c)). These data suggest that PTEN is a downstream target of miR-200c regulation, and its translational suppression mediates miR-200c’s role in promoting NPC growth and progression. Consistent with this notion, overexpression of miR-200c suppresses the activity of Akt and extracellular signal–regulated kinase (ERK) pathways, two signaling events that are subjected to negative regulation by PTEN (Figure 8). On the contrary, downregulation of miR-200c by anti-miR-200c transfection reduced the levels of active Akt and ERK (Figure 8).

Figure 7.

PTEN inhibits NPC cell growth and matrix invasion. (a) Overexpression of PTEN in NPC cell lines HONE1 and HK1 cells. (b) MTS assay to detect cell growth after co-transfection with miR-200c and/or PTEN (*200c + GFP group vs 200c + PTEN group; ^†200c + PTEN group vs PTEN group). (c) Representative images of trans-well invasion assay for HONE1 and HK1 cells after transfection with PTEN. Cells were stained and imaged under light microscope at a magnification of 200×. Data are presented as the mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

Figure 8.

MiR-200c activates Akt and ERK signaling pathways. Western blotting analysis of levels of total (t)-AKT, phosphorylated (p)-AKT, t-ERK, and p-ERK in (a) HONE1 and (b) HK1 cells transfected with anti-miR-200c or miR-200c.

[Figure omitted. See PDF]

MiR-200c promotes NPC tumor growth in vivo

To further confirm the effect of miR-200c in NPC growth in vivo, we transfected NPC cells with anti-miR-200c and transplanted these cells into nude mice. Tumor cells transfected with anti-miR-200c grew more slowly and had a smaller volume than the control cells (Figure 9). Tumor volumes at the end point in anti-miR-200c groups (513.71 ± 221.34 mm³ for HONE1 cells and 327.93 ± 136.55 mm³ for HK1 cells) were significantly smaller than those in anti-miR-Ctrl groups (1043.31 ± 201.13 mm³ for HONE1 cells and 640.64 ± 264.79 mm³ for HK1 cells). Moreover, tumor weights in the anti-miR-200c group (328.60 ± 128.24 mg for HONE1 cells and 161.83 ± 71.19 mg for HK1 cells) were markedly lower than those in anti-miR-Ctrl groups (552.80 ± 115.72 mg for HONE1 cells and 305.83 ± 86.47 mg for HK1 cells). However, we did not find significant differences between the miR-200c group and the control group. These data suggest that miR-200c promotes NPC growth in the in vivo environment.

Figure 9.

Anti-miR-200c suppresses NPC xenograft tumor growth in vivo. Cells were transfected with miR-Ctrl, anti-miR-Ctrl, miR-200c, and anti-miR-200c and transplanted subcutaneously to nude mice. Control and (anti)microRNA transfected cells were transplanted to the left and right sides of the same mice for comparison. Six mice were employed for each experiment. Tumors were dissected, and camera images, tumor volume, and tumor weight were shown for those that originated from (a) HONE1 and (b) HK1 cells. Data are presented as mean ± SEM, *p < 0.05; **p < 0.01.

[Figure omitted. See PDF]

Discussion

Previous studies suggested that miR-200 family miRNAs play important roles in cancer initiation, development, and progression. For example, miR-200b prevents carcinogen-exposed cells from malignant transformation.²⁵ MiR-200c inhibits matrix invasion by breast cancer cell MDA-MB-231,²⁶ while miR-200b/c/429 cluster significantly reduces cell growth and promotes apoptosis.²⁷ Meanwhile, miR-200 family also inhibits EMT by downregulating ZEB1 and ZEB2.^28–30 These studies all suggest anti-cancer roles of miR-200 family. In addition, miR-200a was also reported to be downregulated in NPC samples compared with adjacent normal tissues.³¹ In contrast, we now show that miR-200 family miRNAs are upregulated in NPC cell lines. These findings may be due to variations in miRNA expression levels in cancers of different stages and origins, along with other variables. For example, miR-141 expression is increased in poorly differentiated NPC cell lines compared with well-differentiated NPC cell lines. However, in some highly differentiated cell lines, miR-141 expression is also high.³² Therefore, the expression of miR-200 family miRNAs may correlate well with the degree of NPC cell differentiation. It is plausible that the higher expression level of miR-200a in adjacent normal tissues may be related to the degree of cell differentiation in NPC.

Among the cell lines that were employed in this study, HONE1 and C666 cells are poorly differentiated and are EBV positive.^33,34 HK1 is well differentiated and EBV negative.³⁵ Our results showed that anti-miR-200c transfection decreased cell growth, invasion, and migration, while miR-200c overexpression accelerates these processes. Downregulation of miR-200c by anti-miR-200c transfection also reduced the rate of tumor growth in nude mice. In contrary, overexpression of miR-200c did not result in significant changes in the levels of phosphorylated Akt, the degree of NPC cell invasion or the tumor growth in vivo. This might be due to the high levels of endogenous miR-200c that saturates its signaling events such that further overexpression of the miRNA did not generate an observable impact.

We have previously shown that PTEN is a target of miR-200c inhibition, and now show that this is also true in NPC. Consistent with its roles in suppressing Akt and ERK pathway activities, PTEN’s downregulation by miR-200c resulted in elevated levels of activated Akt and ERK. Akt and ERK are known oncogenes in cancer development, and further studies are required to delineate their roles in mediating the effect of miR-200c in NPC.

Dysregulation of miR-200 family is closely related to the development of different cancers, but their roles in cancers and the underlying mechanisms remain largely uncovered. Nor is known about why miR-200 family miRNAs play divergent roles in different cancer types. MiR-200 family is downregulated and decreased cell proliferation in some cancer types such as that of the ovary,³⁶ while miR-141 is overexpressed in several epithelial cancer types such as prostate cancer.³⁷ We now report that miR-200c is overexpressed in NPC and supports the growth and progression of NPC. Delineating the roles of different miR-200 family miRNAs in specific cancer types may provide more clues on how cancers evolve as well as how we can design novel anti-cancer treatments for the benefit of human health.

Z.-Z.Z., H.-C.C., J.W., and W.Z. contributed equally to this work.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

The author(s) disclosed receipt of the following financial support for the research, authorship, and/or publication of this article: This work was supported by the National Natural Science Foundation of China (81371737, 81673053), Guangdong Natural Science Foundation (2014A030313708), and Shenzhen Research Grant (JCYJ20160428173958860, JCYJ20150403110829614).