Repressor activator protein 1–promoted colorectal cell migration is associated with the regulation of Vimentin

Abstract

Repressor activator protein 1 plays important roles in telomere protection, while repressor activator protein 1 binds to extra-telomeric DNA and exerts the function as a transcriptional regulator. Previous study showed that repressor activator protein 1 regulates the transcriptional activity of nuclear factor-κB, and it was highly expressed in breast cancer tissues; however, the clinical significance of repressor activator protein 1 expression in cancer remains to be elucidated. In this study, we discovered that repressor activator protein 1 was highly expressed in colorectal cancer tissues. High expression of repressor activator protein 1 was significantly correlated with poor prognosis and distant metastasis. Knockdown of repressor activator protein 1 in colorectal cancer cells did not affect cell proliferation or colony formation, but dramatically decreased cell migration and F-actin-enriched membrane protrusions. Microarray screening revealed that Vimentin was downregulated after repressor activator protein 1 knockdown, which was validated by analysis of a colorectal cancer dataset. Furthermore, knockdown of Vimentin attenuated repressor activator protein 1–enhanced cell migration. Thus, our study suggests that repressor activator protein 1 is a prognostic marker and a potential target for colorectal cancer therapy.

Introduction

Colorectal cancer (CRC) is one of the most lethal malignancies and ranks as the third leading cause of cancer-related deaths.^1,2 In 2012, a total of 1.4 million new cases and 693,900 CRC-related deaths occurred around the world.² Most of CRC patients at local stage can be successfully cured with surgery with a 5-year survival rate of 90.5%; however, the 5-year survival rate of patients diagnosed with metastatic CRC is only 12.5%.³ Therefore, investigation of the underlying mechanisms, especially the mechanism of metastasis, will facilitate the diagnosis and therapy of the CRC patients.

Human repressor activator protein 1 (RAP1) is a telomeric protein,⁴ and it is recruited to telomeres by interacting with another telomeric protein, telomeric repeat-binding factor 2, TRF2.⁵ Mouse RAP1 protects telomere ends by repressing homology directed repair (HDR) and preventing sister telomere recombination,⁶ while loss of RAP1 in human cells does not induce DNA damage response, non-homologous end-joining (NHEJ), or HDR,⁷ suggesting that RAP1 is dispensable for the protection of human telomeres. Recent studies revealed that RAP1 could also bind to extra-telomeric DNA and is associated with gene transcriptional regulation.^6,8,9 RAP1 knockout female mice exhibited increased body weight and obesity, which is due to deregulation of metabolic genes.^8,9 In addition to the regulation of metabolism-related signaling pathway, RAP1 also transcriptionally regulates genes involved in cell adhesion and cancer progression.^8,9 Besides, RAP1 interacts with IkappaB kinases (IKK) and activates nuclear factor (NF)-κB. The expression of RAP1 was significantly higher in breast tumor tissues than in adjacent non-tumor tissues,¹⁰ indicating that RAP1 plays a potential role in cancer progression. In addition, RAP1 induces cytokine production through NF-κB pathway and is correlated with the advancement of atherosclerotic lesions.¹¹

Vimentin is a ubiquitously expressed protein of type 3 intermediate filament protein family and is the main intermediate filament protein of mesenchymal cells.¹² Several studies have demonstrated Vimentin’s role in remolding of cytoskeleton of cancer cells.^12,13 Vimentin is highly expressed in poorly differentiated cancer cells and its downregulation decreased the motility of cancer cells.^14,15 The expression level of Vimentin was proven to be correlated with the advancement of cancer, and high Vimentin is associated with poor prognosis and high frequency of metastasis in diverse types of cancer, including promyelocytic leukemia,¹⁶ gastric cancer,¹⁷ intrahepatic cholangiocarcinoma,¹⁸ cervical squamous cell carcinoma,¹⁹ renal cell carcinoma,²⁰ CRC,²¹ and ovarian cancer.²²

To date, the prognostic value of RAP1 in cancer and RAP1’s role in cell motility are largely unknown. Herein, we revealed that RAP1 is highly expressed in CRC tissues, and RAP1 is associated with distant metastasis and poor prognosis. In addition, we disclosed a promigratory role of RAP1, which is mediated by Vimentin.

Materials and methods

Sample collection and immunohistochemistry

All volunteers for this study were recruited with informed consent. Moreover, this study was approved by the committee on ethics of biomedicine research at Peking University Cancer Hospital & Institute. A total of 104 CRC patients who had been diagnosed and had undergone surgery in Peking University Cancer Hospital between 2006 and 2009 were included in this study. Fresh CRC specimens and paired adjacent normal mucosa from each patient were formalin-fixed, paraffin-embedded, and constructed into tissue microarrays. The characteristics of all the patients are described in Table 1. For immunohistochemical staining, the tissue sections were first dewaxed in xylene and then rehydrated with graded alcohol solution. Antigen retrieval was performed by microwave heating the sections in sodium citrate buffer (pH 6.0) for 10 min. Afterward, the sections were subjected to overnight incubation at 4°C with a mouse monoclonal antibody against RAP1 (1:200 dilution), which was produced in our laboratory. The sections were then washed with phosphate-buffered saline (PBS) and incubated with Dako EnVision System HRP mouse antibody for 1 h. Finally, the sections were incubated with 3,3′-diaminobenzidine (DAB) chromogen and counterstained with hematoxylin (Sigma, St. Louis, MO, USA). Stained sections were visualized and photographed using a Leica microscope (Leica Microsystems, Wetzlar, Germany).

Table 1.

Summary of patient characteristics (n = 104).

Clinicopathological features	Number of patients	Percentage of patients
Gender
Male	39	37.50
Female	65	62.50
Age (years)
<60	10	9.62
≥60	94	90.38
Lymphovascular invasion
Absent	68	65.38
Present	36	34.62
Depth of invasion
T1/T2	78	75.00
T3/T4	26	25.00
Lymph node metastasis
N0	55	52.88
N1–N2	49	47.12
Distant metastasis
M0	72	69.23
M1	32	30.77
TNM stage
I + II	54	51.92
III + IV	50	48.08

Evaluation of immunohistochemical staining

The RAP1 staining was microscopically examined and scored by two independent pathologists who were blind to the clinical data pertaining to the patients. For RAP1 immunohistochemical staining assessment, immunoreactivity score (IRS) was assessed, in which both the percentage of positive cells and the staining intensity were evaluated. The percentage of positive cells was scored as 0 (negative), 1 (<25%), 2 (25%–75%), and 3 (>75%); staining intensity was graded as 0 (colorless), 1 (pallide-flavens), 2 (yellow), and 3 (brown). The above two scores were multiplied, and “negative” and “positive” expressions were defined according to IRS values of 0 and >0, respectively.

Plasmids, small interfering RNA, and short hairpin RNA

Full-length human RAP1 was polymerase chain reaction (PCR) amplified from a HCT116 cell complementary DNA (cDNA). PCR product was cloned into plasmid pcDNA3.0-HA and the plasmid was verified by sequencing. Lentiviral vectors expressing human RAP1-targeting short hairpin RNA (shRAP1) were designed and constructed by GenePharma (Shanghai, China). The target nucleotide sequences of the oligoduplexes were as follows: Lv-shRAP1-3#: 5′-GGA GAA GTT TAA CTT GGA TCT-3′; Lv-shRAP1-4#: 5′-GAA TGT AGC TCG GAG GAT TGA-3′; Lv-shNC: 5′-TTC TCC GAA CGT GTC ACG TTT C-3′. Small interfering RNA (siRNA) pairs for human Vimentin gene and a negative control (NC) siRNA were also designed and chemically synthesized by GenePharma. The two human Vimentin siRNA sequences and the NC siRNA sequence were as follows: si-Vimentin-2#: 5′-GCA AGU AUC CAA CCA ACU Utt-3′; si-Vimentin-3#: 5′-GGG AAA CUA AUC UGG AUU Ctt-3′; si-NC: 5′-UUC UCC GAA CGU GUC ACG Utt-3′.

Cell culture and transfection

Human CRC cell lines, HCT116 and SW480, were purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum plus 1% penicillin–streptomycin. Cells were transfected with candidate siRNAs (final concentration = 50 nM) or a NC using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. For lentiviral infection, cells were seeded into six-well plates at a density of 50,000 cells per well and transduced with lentiviral particles at a multiplicity of infection (MOI) of 20. The infection efficiency was determined after 72 h of infection by counting green fluorescent protein (GFP)-expressing cells under fluorescence microscopy. Then, reverse transcription PCR (RT-PCR) and Western blotting were used to analyze the knockdown efficiency at indicated time points.

RNA extraction and quantitative RT-PCR

Total RNA was extracted using the TRIzol reagent (Invitrogen) under RNase-free conditions. Quality and concentration of RNA samples were monitored by the NanoDrop 2000 system (Thermo Fisher Scientific, Waltham, MA, USA). Qualified RNA samples were used to synthesize cDNA with a GoScript™ Reverse Transcription System (Promega, Madison, WI, USA). Quantitative RT-PCR (qRT-PCR) was performed using a StepOne Real-time PCR System (Applied Biosystems, Foster City, CA, USA) and SYBR Green PCR master mix reagents (TOYOBO, Osaka, Japan). Expression data were normalized to that of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Primers used are listed in Table 2. Each sample was performed in triplicates. Relative expression quantification analysis relied on the classical delta-delta-Ct method.

Table 2.

The primers of qRT-PCR.

Gene symbol	Forward primer sequence (5′ to 3′)	Reverse primer sequence (5′ to 3′)	Amplicon size (bp)
RAP1	TGAAGGACCGCTACCTCAAG	GGCTTCCACAAGCATCTTTTTG	233
Vimentin	GCCCTAGACGAACTGGGTC	GGCTGCAACTGCCTAATGAG	137
GAPDH	CATCAAGAAGGTGGTGAAGCAG	CGTCAAAGGTGGAGGAGTGG	119

qRT-PCR: quantitative reverse transcription polymerase chain reaction; RAP1: repressor activator protein 1; GAPDH: glyceraldehyde 3-phosphate dehydrogenase.

Western blotting

Cellular proteins were extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (50 mmol/L Tris–HCl, pH 7.4; 1% NP-40; 0.25% Na-deoxycholate; 150 mmol/L NaCl) containing protease inhibitors (Roche, Basel, Switzerland). Equal amount of proteins were subjected to 10% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) under denaturing conditions. The samples were then transferred to nitrocellulose filter membranes (Merck Millipore, Billerica, MA, USA). Membranes were blocked by incubating them in phosphate-buffered saline with Tween 20 (PBST) buffer with 5% non-fat dried milk for 1 h. Afterward, membranes were incubated overnight at 4°C with primary antibodies against RAP1 (1:500 dilution), GAPDH (1:1000 dilution; ab8245, Abcam, Cambridge, MA, USA), or Vimentin (BS1776; 1:500 dilution; Bioworld Technology, St. Louis Park, MN, USA). Then, membranes were washed three times with PBST buffer, followed by incubation in goat anti-rabbit or anti-mouse secondary antibody conjugated with horseradish peroxidase (1:2000, Invitrogen) for 1 h at room temperature. After washing with PBST for three times, protein bands were visualized using an eECL Western Blot kit (CWBIO, Beijing, China).

Cell migration assay

Transwell chamber with 8.0 µm pore membranes (Corning, Corning, NY, USA) was used in the cell migration assay. The bottom chamber was filled with 800 µL medium containing 10% fetal bovine serum (FBS) as chemoattractant. Cells were resuspended in serum-free medium and then carefully transferred onto the top chamber of each transwell apparatus at a density of 2 × 10⁵ cells/mL (100 µL/chamber). Cells were allowed to migrate for 36 h at 37°C. The top surface of each membrane was cleared of cells with a cotton swab. Cells penetrated to the bottom of the membrane were fixed in cold methanol, stained with 0.1% crystal violet, and counted in nine randomly selected microscopic fields per well. Each sample was prepared in triplicate chambers and each experiment was repeated at least three times.

Cell proliferation assay

Cells were plated in six-well plates at a density of 1 × 10⁵ cells/well in triplicates. Proliferation of cells was quantified by monitoring cell confluence with a CloneSelect Imager (Molecular Devices, Sunnyvale, CA, USA).

Colony formation assay

Cells were cultured at a density of 1 × 10³/well in six-well plates at 37°C with 5% CO₂ for 7 days. On the last day, the medium was removed, and the cells were washed twice with PBS, fixed with 4% paraformaldehyde for 20 min, stained with crystal violet for 30 min at room temperature, washed, and photographed.

Immunofluorescence

Cells grown on cover glasses were fixed in 4% paraformaldehyde for 30 min at room temperature and then permeabilized with 0.5% Triton X-100 for 5 min. For F-actin visualization, cells were stained with Alexa Fluor 555 phalloidin (Invitrogen) for 30 min at room temperature. Then, the cells were washed with PBS and incubated with 4′,6-diamidino-2-phenylindole (DAPI; 5 µg/mL) for nuclear staining at room temperature for 10 min and visualized and photographed by a Leica SP2 confocal system (Leica Microsystems).

Microarray analysis

HCT116 cells (1 × 10⁶ per 10 cm² plate) were washed with PBS and harvested in TRIzol reagent. RNA samples were examined in OE Biotechnology (Shanghai, China) by Affymetrix GeneChip^® PrimeView™ Human Gene Expression Array. (‘Affymetrix Inc., Santa Clara, CA, USA) Microarray data have been deposited in National Center for Biotechnology Information’s (NCBI) Gene Expression Omnibus (GEO; Accession No. GSE84121). Raw data were recorded by Affymetrix GeneChip Command Console (version 4.0; Affymetrix, Santa Clara, CA, USA). Next, GeneSpring Software (version 12.5; Agilent Technologies, Santa Clara, CA, USA) was employed to finish the basic analysis with the raw data. To begin with, the raw data was normalized with the RMA algorithm. Differentially expressed genes were then identified through fold change. The threshold set for upregulated and downregulated genes was a fold change ≥1.5.

Microarray dataset analysis

We analyzed a public gene expression profile (GFP) microarray dataset GSE41258, including 182 primary CRC specimens from patients.²³ The dataset was retrieved from the GEO database and processed using R scripting. We used the expression level for RAP1 probe set (201174 s at) or Vimentin probe set (201426 s at) of 182 CRC specimens for further analysis. We investigated the association between RAP1 and Vimentin expression as well as the correlation of RAP1 and Vimentin expression with survival time. Patients were divided into two groups (“high” and “low”) based on the RAP1 messenger RNA (mRNA) expression levels, and another two groups (“high” and “low”) based on the Vimentin mRNA expression levels.

Statistical analysis

Statistical analysis was carried out using SPSS software package version 16.0 (IBM, Armonk, NY, USA). For cell proliferation assays, colony formation assays, cell migration assays, and qRT-PCR, the Student’s t test was used to test statistical differences. The differential mRNA levels of RAP1 and Vimentin between CRC tissues and adjacent normal mucosa were compared using a Wilcoxon signed-rank test. Two-tailed χ² test was used to evaluate the expression difference of RAP1 between CRC tissue and normal mucosa as well as the relationships between the clinicopathological features and RAP1 expression. For analyzing the human CRC sample microarray dataset, correlation between RAP1 expression and Vimentin expression was tested using Pearson’s correlation test. The survival curves were estimated by Kaplan–Meier analysis, and p values were calculated by log-rank test. p < 0.05 was considered statistically significant.

Result

RAP1 is upregulated in colorectal tumor tissues and is related with poor prognosis

RAP1 was previously found to be highly expressed in breast cancer tissues but its prognostic value in cancer remains to be determined. Herein, we examined RAP1 expression in CRC tissues. With freshly isolated CRC samples, we found the mRNA level of RAP1 was much higher in 40 tumor tissues compared with matched normal mucosa (p < 0.0001; Figure 1(a)). Immunohistochemical staining showed that positivity of RAP1 protein in CRC tissues was significantly higher than in normal mucosa (n = 104; 80.77 % vs 5.77%; p < 0.0001; Figure 1(b) and (c)). Furthermore, we investigated the correlation between RAP1 protein expression and the clinicopathological features. As shown in Table 3, RAP1 expression was markedly higher in patients with distant metastasis (p < 0.0001), but it had no correlation with gender, age, lymphovascular invasion, depth of invasion, lymph node metastasis, or TNM stage. Using a CRC microarray dataset GSE41258 which has follow-up data, we also analyzed the prognostic implication of RAP1 in CRC. The result showed that patients with high RAP1 mRNA expression had a significantly poorer prognosis (p = 0.006; Figure 1(d)). Besides, RAP1 protein was detected in 16 cell lines of different cancer types (Figure 1(e)).

Figure 1.

RAP1 is upregulated in colorectal tumor tissues and is correlated with poor prognosis. (a) mRNA expression of RAP1 in CRC tissues was higher than that in normal mucosa of 40 pairs of CRC tissues and matched normal mucosa (Wilcoxon signed-rank test, p < 0.0001). mRNA expression was evaluated by qRT-PCR. (b) Representative immunohistochemical staining of RAP1 in normal mucosa and matched CRC tissue: (1) RAP1 negative staining in normal mucosa, (2) RAP1 positive staining in CRC tissue from the same patient. (c) RAP1 in tumor tissues was higher than that in normal mucosa of 104 pairs of CRC tissues and matched normal mucosa (two-tailed χ² test, p < 0.0001). (d) Kaplan–Meier overall survival analysis of colorectal cancer patients according to the expression status of RAP1 (log-rank test, p = 0.006). (e) Western blotting analysis of RAP1 expression in 16 cancer cell lines of six different types of cancer, including colorectal cancer cells (HCT116, SW480, LoVo), gastric cancer cells (AGS, MGC803, MKN45), lung cancer cells (PG, H1299, H446), breast cancer cells (BICR, MCF-7, MDA-MB231), liver cancer cells (HepG2, BEL-7402), and bladder cancer cells (EJ, T24).

[Figure omitted. See PDF]

Table 3.

Association of RAP1 expression with clinicopathological features.

Clinicopathological features	RAP1 expression
	Positive (%)	Negative (%)	p value
Gender
Male	20 (51.28)	19 (48.72)	0.151
Female	24 (36.92)	41 (63.08)
Age (years)
<60	6 (60.00)	4 (40.00)	0.234
≥60	38 (40.43)	56 (59.57)
Lymphovascular invasion
Absent	22 (33.33)	44 (66.67)	0.070
Present	20 (52.63)	18 (47.37)
Depth of invasion
T1/T2	36 (46.15)	42 (53.85)	0.169
T3/T4	8 (30.77)	18 (69.23)
Lymph node metastasis
N0	20 (36.36)	35 (63.64)	0.194
N1–N2	24 (48.98)	25 (51.02)
Distant metastasis
M0	22 (30.56)	50 (69.44)	<0.0001
M1	22 (68.75)	10 (31.25)
TNM stage
I + II	20 (37.04)	34 (62.96)	0.125
III + IV	26 (52.00)	24 (48.00)

RAP1: repressor activator protein 1.

Knockdown of RAP1 inhibits CRC cell migration

To examine the effects of RAP1 on the malignant phenotypes of CRC cells, RAP1 was stably interfered in HCT116 and SW480 cells by lentiviral-mediated infection of two short hairpin RNAs (shRNAs; 3# and 4#; Figure 2(a)). With these cells, we found that knockdown of RAP1 did not significantly affect the proliferation or colony formation (Figure 2(b) and (c)). However, knockdown of RAP1 greatly inhibited cell migration (Figure 2(d)). Using immunofluorescence staining, we observed a pronounced decrease in F-actin-enriched membrane protrusions in HCT116 and SW480 cells when RAP1 knockdown occurred (Figure 2(e)). The essential role of RAP1 in cell migration supports the positive correlation between RAP1 status and distant metastasis in CRC.

Figure 2.

Knockdown of RAP1 inhibited colorectal cancer cells migration. (a) Confirmation of RAP1 knockdown in HCT116 and SW480 cells by Western blotting and qRT-PCR (Student’s t test). (b) Knockdown of RAP1 does not affect cell proliferation in HCT116 and SW480 cells (Student’s t test). (c) Knockdown of RAP1 does not affect cell colony formation in HCT116 and SW480 cells. Representative images of cell colony were shown (top) and the bar graph (bottom) presented the number of cell colonies (Student’s t test). (d) Knockdown of RAP1 decreases migration of HCT116 and SW480 cells. Representative images of migrated cells were shown (top) and the bar graph (bottom) presented the number of migrated cells (Student’s t test). (e) Knockdown of RAP1 decreases F-actin enrichment at membrane protrusions of HCT116 and SW480 cells. HCT116 and SW480 cells were seeded on glass coverslips and fixed cells were stained with phalloidin to visualize F-actin enrichment. The magnified images show sites of F-actin-rich membrane projections (blue: DAPI; red: F-actin; scale bars: 5 µm).

ns: no significant difference.

Data are expressed as mean ± SEM.

*p < 0.05, **p < 0.01, ***p < 0.001.

[Figure omitted. See PDF]

Knockdown of RAP1 reduces the expression of Vimentin

To understand the mechanism underlying RAP1’s contribution to CRC cell migration and metastasis, we performed the microarray analysis to investigate RAP1’s effect on gene profiles using the RNA samples extracted from HCT116-Lvsh-NC and HCT116-LvshRAP1-4# cells. Expression levels of 128 genes were significantly reduced in RAP1-knockdown cells, while increase was observed in 155 genes (profiles of representative genes were shown in Figure 3(a)). These genes participate in pathways related to various aspects of physiological and pathological processes, including regulation of gene expression, cellular lipid metabolic process, cell adhesion, response to reactive oxygen species, chromatin organization, epithelial cell differentiation, and insulin receptor signaling pathway (Figure 3(a)). Expression of Vimentin was shown to be decreased by RAP1 knockdown (Figure 3(a)), which was confirmed by qRT-PCR and Western blotting in HCT116 and SW480 cells (Figure 3(b)). We also detected the mRNA level of Vimentin in the above mentioned 40 pairs of primary CRC and matched normal mucosa, and the result showed that Vimentin was much higher in tumor tissues than in normal mucosa (p = 0.0001; Figure 3(c)), which was consistent with previous studies reporting overexpression of Vimentin in other types of cancer.^17,18,24 Moreover, we analyzed the correlation between the mRNA levels of RAP1 and Vimentin in 182 CRC tissues from the dataset GES41258, and the result revealed that the transcript levels of Vimentin correlated with those of RAP1 (R = 0.3443, p < 0.001; Figure 3(d)). Therefore, Vimentin is likely to be a downstream gene of RAP1 in CRC cells.

Figure 3.

Knockdown of RAP1 reduces the expression of Vimentin. (a) Differentially expressed genes affected by knockdown of RAP1 in HCT116 cells. The color intensity is proportional to log₂ of expression ratio (blue: downregulated; red: upregulated). Biological processes are listed on the left. All genes had a false discovery rate (FDR) < 0.15. (b) qRT-PCR and Western blotting assays confirmed that knockdown of RAP1 reduced the expression of Vimentin (Student’s t test). (c) qRT-PCR analysis of mRNA expression of Vimentin in 40 pairs of CRC tissues and matched normal mucosa (Wilcoxon signed-rank test, p = 0.0001). (d) RAP1 mRNA expression levels were positively correlated with those of Vimentin in CRC patients of dataset GES41258 (n = 182; Pearson’s correlation test, p < 0.001).

Data are expressed as mean ± SEM.

*p < 0.05, **p < 0.01.

[Figure omitted. See PDF]

Knockdown of Vimentin compromises RAP1-enhanced cell migration and Vimentin affects the prognostic value of RAP1

Previous reports showed overexpression of Vimentin could promote cell migration through determination of cellular polarity, regulation of cell contact formation and arrangement, and transport of signal proteins associated with cell movement.^25–28 In this study, we explored the contribution of Vimentin to RAP1-enhanced cell migration. Knockdown of Vimentin by siRNA interference decreased cell migration in both HCT116 and SW480 cells (Figure 4(a)), which is in line with previous studies.^15,20,29 As expected, overexpression of RAP1 increased the expression of Vimentin and cell migration (Figure 4(a)). Importantly, knockdown of Vimentin significantly compromised RAP1-increased cell migration (Figure 4(a)), suggesting that Vimentin is essential for RAP1-promoted cell migration.

Figure 4.

Knockdown of Vimentin counteracts RAP1-enhanced cell migration and Vimentin affects the prognostic value of RAP1. (a) Knockdown of Vimentin compromised RAP1-enhanced cell migration. Cells were transfected with indicated siRNAs for 72 h following the transfection of pcDNA3.0-HA-RAP1 for 32 h. Cell lysates were analyzed by Western blotting (right above). Representative images of migrated cells were shown (left) and the bar graph (right bottom) presented the number of migrated cells (Student’s t test). (b) Kaplan–Meier overall survival analysis of CRC patients of dataset GES41258, according to the expression status of Vimentin (p = 0.051). (c) Kaplan–Meier overall survival analysis of CRC patients of dataset GES41258, according to the expression status of RAP1 combined with Vimentin (p = 0.007). RAP1−/Vim− represents the expression status of low RAP1 combined with low Vimentin (n = 54); RAP1+/Vim− represents the expression status of high RAP1 combined with low Vimentin (n = 34); RAP1+/Vim+ represents the expression status of high RAP1 combined with high Vimentin (n = 58).

Data are expressed as mean ± SEM.

*p < 0.05, **p < 0.01.

[Figure omitted. See PDF]

Similar to previous studies,^18,21,22,24 patients with high level of Vimentin had a relatively poorer prognosis (p = 0.051; Figure 4(b)). We also tested the prognostic value of combined expression statuses of RAP1 and Vimentin. CRC patients with both high mRNA levels of RAP1 and Vimentin (RAP1+/Vim+) had a significantly shorter survival time than those with other expression statuses. However, CRC patients with high mRNA level of RAP1 and low mRNA level of Vimentin (RAP1+/Vim−) had an attenuated poor survival time than patients with RAP1+/Vim+, while CRC patients with both low mRNA level of RAP1 and Vimentin (RAP1−/Vim−) had a remarkably longer survival time than those with other expression statuses (Figure 4(c)). The result showed that the prognostic value of RAP1 could be affected by Vimentin and the combination of RAP1 and Vimentin might be a valuable survival indicator in CRC.

Discussion

In this study, we showed that RAP1 exerted an oncogenic effect on CRC cells by promoting cell migration. RAP1 was highly expressed in CRC tissues when compared with normal mucosa and was significantly correlated with poor survival. Knockdown of RAP1 inhibited cell migration, decreased F-actin enrichment, and lowered Vimentin expression. Furthermore, we discovered that RAP1-promoted cell migration could be compromised by knockdown of Vimentin, thus revealing that Vimentin plays an important role in mediating RAP1’s promigratory effect.

The telomere protection effect of RAP1 has been widely investigated in different model systems.^6,7,30,31 Loss of RAP1 in yeast leads to NHEJ and telomere attrition; however, such effects were not observed in human or mouse cells with inactivated RAP1,^7,30,31 suggesting that RAP1 alone is insufficient to achieve telomere protection in mammalian cells. Interestingly, RAP1 also localizes to extra-telomeric sites and regulates genes involved in metabolism regulation, cell adhesion, and cancer progression, further highlighting RAP1’s role in transcriptional regulation.^8,9,32 It is of note that RAP1 is highly expressed in advanced breast cancer tissues and loss of RAP1 sensitizes breast cancer cells to tumor necrosis factor (TNF)α-induced apoptosis,¹⁰ suggesting the pleiotropic roles of RAP1. In our study, we first showed that RAP1 levels were higher in CRC tissues than in normal mucosa, and importantly, its correlation with distant metastasis. In addition, we uncovered that CRC patients with high RAP1 were predicted to have a poor survival time, indicating that RAP1 could be recognized as a marker for survival prediction. We further reported that knockdown of RAP1 did not affect the proliferation or colony formation but greatly decreased cell migration, which was consistent with a previous report on breast cancer.¹⁰

To reveal the mechanism of RAP1-regulated cell migration, we performed gene expression array and we noticed that the genes significantly changed by RAP1 knockdown were associated with several pathways. Our results of microarray screening were in accordance with previous studies showing that RAP1 functions as a transcriptional regulator and affects metabolic process.^8,9,32 Importantly, we found that RAP1 knockdown decreased the levels of Vimentin, and the expression of Vimentin was significantly correlated with that of RAP1 in CRC tissue, suggesting that the expression of Vimentin was regulated by RAP1. However, ChIP-seq analysis revealed that RAP1 did not bind to the promoter sequence of Vimentin gene, implying that RAP1 may regulate the expression of Vimentin through indirect approaches (data not shown). Vimentin has been appreciated for its role in cell adhesion and migration by affecting the localization and activity of surface molecules.^{16,25,27,28,33} Vimentin is recruited by the filopodia and podosomes of macrophages during the early phase of cell spreading and migration.³⁴ In our study, knockdown of RAP1 greatly decreased the enrichment of F-actin in the leading edge of HCT116 and SW480 cells, which is very likely to be the result of reduced Vimentin and the cause of inhibited cell migration.

We found that overexpression of RAP1 increased Vimentin, and knockdown of Vimentin compromised RAP1-enhanced cell migration, revealing that RAP1-regulated cell migration is associated with Vimentin. Consistent with previous studies in other types of cancer,^{17–19,21,22,24} Vimentin is also associated with poor prognosis in CRC. Since the effect of RAP1 on cell migration was affected by Vimentin, we hypothesized that the prognostic value of RAP1 was also affected by Vimentin. Patients with RAP1−/Vim− had the best survival time, but patients with RAP1+/Vim+ had the worst survival time. In addition, as we expected, the survival time of patients with RAP1+/Vim− was longer than that of patients with RAP1+/Vim+, which is in accordance with the result of cell migration, indicating that Vimentin plays a crucial role in the effect of RAP1 on both cancer progression and prognostic value; however, the specific mechanism needs more study.

In conclusion, our findings suggest that RAP1 promotes colorectal cell migration through the regulation of Vimentin and RAP1 may act as a potential target for the diagnosis and therapy of CRC.

Declaration of conflicting interests

The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Funding

This study was supported by the National Natural Science Foundation of China (Grant Numbers 81230046 and 81301747) and the National 973 Program of China (2015CB553906).