Phylogenetic analysis of Rhizoctonia solani subgroups associated with web blight symptoms on common bean based on ITS-5.8S rDNA

Abstract

Sixty-eight Rhizoctonia solani isolates (31 AG-1, 37 of AG-2-2) associated with web blight (WB) of common bean, Phaseolus vulgaris, were examined for sequence variations in the ITS-5.8S rDNA region. The isolates were collected in bean-growing lowland and mountainous regions in Central and South America. Sequences of these isolates were aligned with other known R. solani sequences from the NCBI GenBank and distance and parsimony analysis were used to obtain phylogenetic trees. WB isolates of AG-1 formed two clades separated from known AG-1 subgroups. WB isolates of AG-2-2 formed one clade separated from known AG-2-2 subgroups. Other isolates belonged to AG-1 IA and AG-1 IB. Based on phylogenetic analysis, we confirmed that at least five genetically different subgroups incite WB of common beans. Three new subgroups of R. solani have been identified and designated as AG-1 IE, AG-1 IF and AG-2-2 WB. DNA sequences of these isolates provided needed information to design taxon-specific primers that can be employed in ecological/epidemiological studies and seed health tests. [PUBLICATION ABSTRACT]

J Gen Plant Pathol (2008) 74:3240 DOI 10.1007/s10327-007-0060-6

FUNGAL DISEASES

Phylogenetic analysis of Rhizoctonia solani subgroups associated with web blight symptoms on common bean basedon ITS-5.8S rDNA

G. Godoy-Lutz S. Kuninaga J. R. Steadman K. Powers

Received: 10 September 2006 / Accepted: 30 May 2007 / Published online: 5 December 2007 The Phytopathological Society of Japan and Springer 2007

Abstract Sixty-eight Rhizoctonia solani isolates (31 AG-1, 37 of AG-2-2) associated with web blight (WB) of common bean, Phaseolus vulgaris, were examined for sequence variations in the ITS-5.8S rDNA region. The isolates were collected in bean-growing lowland and mountainous regions in Central and South America. Sequences of these isolates were aligned with other knownR. solani sequences from the NCBI GenBank and distance and parsimony analysis were used to obtain phylogenetic trees. WB isolates of AG-1 formed two clades separated from known AG-1 subgroups. WB isolates of AG-2-2 formed one clade separated from known AG-2-2 subgroups. Other isolates belonged to AG-1 IA and AG-1 IB. Based on phylogenetic analysis, we conrmed that at least ve genetically different subgroups incite WB of common beans. Three new subgroups of R. solani have been identied and designated as AG-1 IE, AG-1 IF and AG-2-2 WB. DNA sequences of these isolates provided needed information to design taxon-specic primers that can be employed in ecological/epidemiological studies and seed health tests.

Keywords Web blight Rhizoctonia solani subgroups Thanatephorus cucumeris ITS rDNA region Phaseolus vulgaris

Introduction

Common bean (Phaseolus vulgaris L.) is the most important legume food crop in Latin America and the Caribbean. Over 7 million hectares are planted annually in the region to feed more than 500 million people (FAO 2004). Web blight (WB) is one of the most destructive foliage diseases of common bean in these regions and is also becoming important in eastern Africa where beans are grown (Choto et al. 1993; Masangano and Miles 2004). WB not only reduces yield but also discolors the seed which lowers market value (Godoy-Lutz et al. 1996a). Economic losses have been estimated at US$ 7.1 million in one season in El Salvador and at 19% of the bean production acreage in Honduras during 1 year (Choto et al. 1993). Cultural and chemical control strategies have not effectively reduced disease severity or contained the spread of WB. Breeding for WB resistance has been hindered by limited information on the genetics of the pathogen and disease resistance mechanisms (Beebe et al. 1991; Cardenas 1989). Currently no resistant commercial bean varieties are available.

WB is caused by Rhizoctonia solani Khn and its teleomorph Thanatephorus cucumeris (Frank) Donk.R. solani is a species with diverse morphology, pathogenicity and physiology attributed to hyphal recognition involved in the self-nonself afnities known as anastomosis groupings or AG (Cubeta and Vilgalys 1997; Ogoshi 1987). Further subdivision of AGs has been based on differences in cultural appearance, pathogenicity, thiamine

G. Godoy-Lutz Instituto Dominicano de Investigaciones Agropecuarias y Forestales, IDIAF, Santo Domingo, Dominican Republic

S. Kuninaga Health Sciences University of Hokkaido, Ishikari-Tobetsu, Hokkaido 061-0293, Japan

J. R. Steadman (&) K. Powers University of Nebraska-Lincoln, 406 Plant Sciences Hall, Lincoln, NE 68583-0722, USAe-mail: [email protected]

123

J Gen Plant Pathol (2008) 74:3240 33

requirements, fatty acids, protein zymograms and DNA markers (Kuninaga et al. 1997; Liu and Sinclair. 1993; Macnish et al. 1993; Ogoshi 1987; Sneh et al. 1991). Currently, there are 14 AGs, and numerous subgroups have been reported (Carling 1996; Carling et al. 2002; Schneider et al. 1997).

At least three AGs of R. solani have been reported to be associated with WB of common bean (Cardenas 1989; Galvez et al. 1989). Evidence of intraspecic variation was shown when WB isolates from common bean were characterized by hyphal anastomosis, cultural characteristics and virulence (Godoy-Lutz et al. 1996b) and by PCRRFLP of the internal transcribed spacer region (ITS) and5.8S subunit of the nuclear ribosomal DNA repeat (rDNA) (Godoy-Lutz et al. 2003). These WB isolates were characterized as AG-1 or AG-2 and had ve different ITSRFLP proles, three within AG-1 and two within AG-2. Most of the AG-1 isolates did not clearly t the ITS-RFLP proles for subgroups reported at the time, therefore pending further study, the isolates were assigned to subgroup AG-1 IB on the basis of host pathogenicity. Isolates in AG-2 were assigned to AG-2-2 IV or to AG-2 unknown.

More insight on the taxonomic and phylogenetic relationships among the WB isolates, as well as diagnostic tools for rapid and reliable subgroup-specic identication are needed to reduce the detrimental impact of the disease through effective disease resistance screening methods and management practices. Sequence analysis of the ITS-5.8S rDNA region has been used as a suitable molecular tool for identication of R. solani subgroups (Carling et al. 2002; Hyakumachi et al. 1998; Kuninaga et al. 1997; Priyatmojo et al. 2001; Salazar et al. 2000). Therefore, this study was conducted to (1) ascertain the extent of intraspecic variation of WB isolates from common bean in the LAC region by sequencing the entire ITS-5.8S rDNA region and compare the sequences to known R. solani AG subgroup sequences available in the NCBI GenBank database, and(2) develop specic primers to identify subgroups.

Materials and methods

Isolates

Sixty-eight isolates of R. solani obtained from survey collections of symptomatic Phaseolus species were selected for this study (Table 1). Most of these isolates were assigned to AG-1 and AG-2 in previous studies (Godoy-Lutz et al. 1996b, 2003). Isolates were maintained on sterile sugarbeet seeds at 4C before transferring them to water agar (Difco, Detroit, MI, USA) and potato dextrose agar (Difco) for growth and DNA extraction.

DNA extraction and PCR conditions

Each isolate was grown on 25 ml of liquid V8 medium (100 ml V8 juice, 1.5 g CaCO3 and 400 cc of demineralized water) in a deep sterile Petri dish. Cultures were maintained at 24C without shaking for 4872 h until mycelia reached the edge of plate. Mycelia mats were harvested by ltration, lyophilized and the ground powder kept at -20C. Total genomic DNA was extracted following the procedure of Skroch and Nienhuis (1995). The procedure involves extraction with a buffer solution of potassium ethylxanthagenate, followed by a series of steps of centrifugation, precipitation and purication to give a nal concentration of 10 ng DNA per ll 19 TrisEDTA buffer (Godoy-Lutz et al. 2003).

Amplication of the nuclear rDNA region of ITS including 5.8S rDNA was performed using primers ITS 4 and ITS 5 (White et al. 1990). The PCR amplication reactions were performed by adding 1 ll of 100 dilution DNA to 50 ll of reaction mixture: ultra pure water, 109 Taq buffer (Promega, Madison, WI, USA) [500 mM KCl/100 mM TrisHCl, pH 9.0 (at 25C)/1.0% Triton X-100/15 mM MgCl2], 100 mM dNTP, 20 ll M primers of ITS 4 and ITS 5, synthesized and supplied by Invitrogen (Carlsbad, CA, USA). Amplications were performed in a GeneE Thermal Cycler (Techne, Cambridge, UK) programmed for the following temperature prole: 1 min at 94C followed by 30 cycles of 40 s at 94C, 60 s at 55C, 60 s at 72C and a nal extension at 72C for 5 min. PCR products of 740 bp were electrophoresed in 1% Agarose Low EEO (Fisher Scientic, Pittsburgh, PA, USA) gel in Trisborate EDTA buffer at 105 V for 1 h and visualized by ethidium bromide staining on a UV transilluminator.

DNA sequencing and data analysis

For DNA sequencing, amplied products were further puried with Microcom YM-30 centrifugal lters (MilliporeAmicon Div., Bedford, MA, USA). The concentration of each product was estimated by gel electrophoresis with a low DNA mass ladder (Invitrogen) and diluted with ultra pure water to give a nal concentration of 20 ng/ll for sequencing. DNA samples were sequenced using both primer strands by an Applied Biosystems (Foster City, CA, USA) Model 3100 Genetic Analyzer at the DNA Sequencing Laboratory, Univ. of Arkansas for Medical Sciences, Little Rock, AR, USA. Sequence data for the complete ITS-5.8S rDNA of isolates of AG-1 and AG-2 was manually checked and edited to remove portions of the 18 S and 28 S rDNA using Chromas software (Technelysium Pty Ltd. (http://www.technelysium.com.au

Web End =http://www.technelysium.com.au ). Sequences were

123

34 J Gen Plant Pathol (2008) 74:3240

Table 1 Isolates used in this study for phylogenetic analysis

Isolate name Host GenBank accession number

A4c Phaseolus vulgaris var. aborigineus AF308621 Salta, Argentina 2,430 J. R. Steadman 1995

A18c DQ452117 1996

A20c DQ452118 1,363 A28c AF308622

H32b P. vulgaris cv. Dorado AF308627 El Barro, Honduras 1,500 N. Escoto 1995

H33b DQ447880

H34b DQ447881

H38b DQ447879

H43c P. vulgaris cv. Dorado DQ452108 Lavanderos, Honduras 1,206 J. R. Steadman 1998

H2002 1c P. vulgaris var. aborigineus DQ452104 El Rancho, Honduras 1,350 J. R. Steadman 2002

H2002 2c DQ452105

H2002 3c DQ452106

H2002 4c DQ452107

MGB1c P. vulgaris var. aborigineus DQ452098 Yuscarn, Honduras 1,524 J. R. Steadman 2001

MGB12e DQ447884

Los Limonesa P. vulgaris cv. Amadeus 77 DQ447861 Los Limones, Honduras 750 J. Venegas 2003

Jamastrna P. vulgaris cv. Amadeus 77 DQ447860 Jamastrn, Honduras 700 J. Venegas 2003

CR1a P. vulgaris cv. MUS 181 DQ447863 Guatuso, Costa Rica 200 F. Saladin 1995 CR4a DQ447866

CR9c DQ452128

CR10c DQ452122

CR12c DQ452127

DR-BV1b P. vulgaris cv. PC-50 AF308625 San Juan Valley,Dominican Republic

DR-BV8b DQ447882

DR-BV22b AF308626

DR-BV40b DQ447878

DR-BV98b DQ447883

DR-EEALc AF308623

El Luceroc DQ452131

Caafstolec DQ452121

Jinova2c DQ452120

P.Corto45c DQ452124

Punta Canac DQ452126

Vallejueloc DQ452129

Barrancac P. vulgaris cv. PC-50 DQ452119 La Vega, Dom. Rep. 250 G. Godoy-Lutz 1994

Jimac DQ452123

Palmaritoc DQ452125

Solorimc DQ452130

DR-LV-1c P. vulgaris cv. Pompadour DQ452110 La Vega, Dom. Rep. 250 G. Godoy-Lutz 2003

Los Bancos-1c P. vulgaris cv. Pompadour DQ452109 Azua Valley, Dom. Rep. 400 G. Godoy-Lutz 2003

AL2002c P. vulgaris cv. PC-50 DQ452115 San Juan Valley, Dom. Rep. 400 G. Godoy-Lutz 2002

Cuba 1d P. vulgaris cv. unknown DQ447859 La Habana, Cuba 60 F. Saladin 1993

Cuba 2d AF308631

Origin Altitude (m asl)

Collector Year

400 G. Godoy-Lutz 1994

123

J Gen Plant Pathol (2008) 74:3240 35

Table 1 continued

Isolate name Host GenBank accession number

Origin Altitude (m asl)

Collector Year

P6a P. vulgaris cv. Barriles DQ447876 Caizn, Panam 800 G. Godoy-Lutz 1994

P10a DQ447864

P30a AF308628PR5a P. vulgaris cv. Arroyo Loro AF308629 La Isabela, Puerto Rico 128 J. Beaver 1998

PR45a DQ447877

PR-RS-12a P. vulgaris cv. unknown DQ447862 Aguado, Puerto Rico 128 R. Echavez-Badel 1996

N1a P. vulgaris cv. Dorado DQ447873 Carazo, Nicaragua 450 G. Godoy-Lutz 1994

N3a DQ447874

N9a DQ447875

MEX 1a P. vulgaris cv. unknown DQ447872 Coxtatla, Mexico 50 F. Saladin 1994

ES2a P. vulgaris cv. Dicta 31 DQ447867 La Libertad, El Salvador 20 G. Godoy-Lutz 1994

ES4a DQ447868

G5a P. vulgaris cv. MUS 181 DQ447870 Cuyuta, Guatemala 48 G. Godoy-Lutz 1994

G7a DQ447871

G10a DQ447869

E1-1c P. vulgaris cv. unknown DQ452099 Chimborazo, Ecuador 1,350 E. Peralta 2003

E2-1c P. vulgaris cv. Cargamanto DQ452100 Chimborazo, Ecuador 1,400 E. Peralta 2003

E3-3c P. vulgaris cv. Blanco Panamito DQ452101 Chimborazo, Ecuador 1,400 E. Peralta 2003 E8-1c P. vulgaris cv. Cargamanto DQ452102 Chimborazo, Ecuador 1,580 E. Peralta 2003

E8-2c DQ452103

EB3c P. vulgaris cv. Jima DQ452111 San Miguel, Ecuador 2,102 J. R. Steadman 2003

EB4c DQ452112

EB5c DQ452113

EB6c DQ452114

EB7c DQ452116

a AG-1-IE

b AG-1-IF

c AG-2-2 WB

d AG-1-IA

e AG-1-IB

aligned using Clustal W (Thompson et al. 1994). AdditionalR. solani ITS-5.8S rDNA gene sequences of known R. solani AG-1- IA, -IB, -IC, and -ID and of AG-2-2, IIIB, IV, and LP isolates from the NCBI GenBank were included. These isolates were AG-1 IA (AB000010, AB000016 and AB000017), AG-1 IB (AB000025, AB000038 and AB000039), AG-1 IC (AB000029 and AB000035), AG-1 ID (AB122126 and AB122128), AG-2-2 IIIB (AB054854, AB054855 and AB054858), AG-2-2 IV (AB000014, AB054859 and AB054865) and AG-2-2 LP (AB054866, AJ238163 and AJ238170).

Alignment statistics and genetic distances among sequences were estimated by a pairwise comparison p-difference model with the program MEGA Version 3.0 (Kumar et al. 2004). Data were analyzed by distance and parsimony methods with PAUP* Version 4.02 beta (Swofford 2002).

Maximum parsimony (MP) analysis was performed with the heuristic search with simple taxon addition sequences, TBR branch swapping and MAXTREES unrestricted. All nucleotide substitutions were equally weighted and unordered. Alignment gaps were treated as missing data. Distance matrix analysis was conducted with the neighbor-joining (NJ) algorithm and the JukesCantor genetic distance model, omitting all sites with gaps. Condence intervals in tree topologies were estimated by bootstrap analysis with 1,000 replicates. Only nodes with bootstraps values over 50% were considered to be signicant. For both analyses, trees were rooted using isolates R9 (AG-2-2 IV GenBank accession AB054863) as the outgroup for AG-1 trees and SHIBA IB (AG-1 IB GenBank accession AB000039) as the outgroup for AG-2 trees. The resulting trees were visualized with the program Treeview X (Page 1996).

123

36 J Gen Plant Pathol (2008) 74:3240

Fig. 1 Strict consensus of 234 equally parsimonious trees based on ITS rDNA sequence data from 31 web blight isolates of AG-1 and other selected AG-1 subgroup isolates of Rhizoctonia solani. The tree length is 241 steps, CI = 0.896, and RI = 0.972. The tree is rooted to isolate R9 (AG-2-2IV). Number above branches indicates bootstrap percentiles from 1,000 replicates

Specic primers development and testing

New primers were developed on the basis of the sequence differences in the ITS1 and ITS2 regions among the WB isolates. Sequences used for primer development are listed in the NCBI GenBank database as AF308629 and AF308626 for AG-1 isolates PR-5 and DR-BV22, respectively, and AF308623, AF308621, and AF308622 for AG-2 isolates DR-EEAL, A4 and A28, respectively. The specic primers were developed at the Health Sciences University of Hokkaido, Hokkaido, Japan. The PCR protocol to amplify the ITS-5.8S rDNA region has been described above. The primers were tested at different amplication temperatures ranging from 55 to 65C and 3035 cycles. The specicity of these primers was also tested in PCR reactions against another set of 48 WB isolates from our collection and other R. solani isolates from rice, soybean and sugarbeet (Carling et al. 2002; Jones et al. 1989; Kuninaga et al. 1997) maintained in S. Kuninagas collection at the Health Sciences University of Hokkaido, Hokkaido, Japan. Other fungal species Sclerotinia sclerotiorum strain 158, Pythium ultimum strain 288 and Fusarium graminearum (G. Yuen, University of

Nebraska-Lincoln, Lincoln, NE, USA) were also used as controls.

Results

Sequence and genetic tree analysis

The initial PCR amplication of DNA of WB isolates using universal primers ITS 4 and ITS 5 generated a fragment *740 bp long for each isolate. Alignment of the sequences of the full ITS-5.8S rDNA region of 68 WB isolates and sequences of 18 known R. solani AG subgroup isolates in the NCBI GenBank revealed differences in the ITS1 and ITS2 regions but similarities in the 155 bp 5.8S gene. Because the WB isolates were previously separated into AG-1 and AG-2-2, sequences were aligned as two separate groups. For the AG-1 alignment, there were 571 sites conserved, 128 polymorphic sites and 43 parsimony-informative sites. Phylogenetic analysis by NJ and parsimony methods supported very similar phylogenetic trees with bootstrap values of 100%. NJ (not shown) and parsimony trees (Fig. 1) conrmed separation of the WB

123

J Gen Plant Pathol (2008) 74:3240 37

Fig. 2 Strict consensus of 72 equally parsimonious trees based on ITS rDNA sequence data from 37 web blight isolates of AG-2-2 and other selected AG-2-2 subgroup isolates of Rhizoctonia solani. The tree length is 171 steps, CI = 0.899, and RI = 0.91. The tree is rooted to isolate Shiba-1 (AG-1-IB). Number above branches indicates bootstrap percentiles from 1,000 replicates

isolates in clades A and B and excluded both clades from known R. solani AG-1 subgroups AG-1 IA, IB, IC and ID. The heuristic search on the whole ITS rDNA region data matrix found 234 equally parsimonious trees that were 241 steps long CI = 0.896 and RI = 0.972. Only the strict consensus tree of the most parsimonious is shown. For the AG-2-2 sequence alignment, there were 551 sites conserved, 174 polymorphic sites and 120 parsimony-informative sites. Bootstraps values of 97 and 100% led to branch separation of clade A from known isolates of AG-2-2 IIIB, IV and LP in NJ (not shown) and MP analysis (Fig. 2). The heuristic search found 72 equally most parsimonious trees that were 171 steps long, CI = 0.899 and RI = 0.91. Only the strict consensus of the most parsimonious trees is shown. R. solani AG-2 is a heterogeneous group, which includes AG-2-1, -2-2 IIIB, -2-2 IV, -2-2 LP, -2-3, -2-4 and -2-BI (Carling et al. 2002). The phylogenetic tree, based on the rDNA-ITS region sequences, revealed that AG-2-2 WB isolates formed a clade that differed from the cluster of each of the other groups -2-1, -2-3, -2-4 and -2-BI (data not shown).

Sequence similarities of the ITS-5.8S rDNA region for the AG-1 and AG-2-2 alignments with the tester isolates are summarized in Table 2. Only two WB isolates, Cuba 1 and Cuba 2, have a 100% match with known isolates in

AG-1 IA. Sequences of the 68 WB isolates have been deposited in the NCBI GenBank database and the accession numbers are listed in Table 1.

Primer development and testing

PCR primers specic for clades A and B in AG-1 were named WB-A and WB-B, respectively, and clade A of AG-2-2 was named 2-2 WB. Products of primers were

Table 2 Sequence similarities of the ITS 5.8SrDNA region among WB isolates and selected Rhizoctonia solani AG tester isolates from the NCBI GenBank

Clades/isolates AG-1 subgroups

AG-1 IA Cs-Ka IB Shiba-1 IC RH-28 ID RCP-3

Clade A (IE) 9798 9293 9293 9192

Clade B (IF) 93 97 91 9596

Cuba 1and 2 (IA) 100 93 93 92

MGB 12 (IB) 92 98 91 95

AG-2-2 subgroups

AG-2-2 IIIB C-96 IV DC-10 LP G4

Clade A (WB) 9598 9698 9597

123

38 J Gen Plant Pathol (2008) 74:3240

Table 3 Primers developed for Rhizoctonia solani associated with web blight of common bean

AG-subgroup specicitya

Primer name

Product size (bp)

AG-1 IE WB-A A-AF CCTTAATTTGGCGGGAGGC A 58 540

A-AR GACTATTAGAAGCGGTTCA

AG-1 IF WB-B B-BF GTTGGTTTGGAGTCGGTGT G 58 510

B-BR GGACTATTAGAAGCGGTTCG

AG-2-2 WB 2-2-WB 2-2WB-F GAGCATGTGCAC(R = A/G)CCTTG 60 500

2-2WB-R GGAACCAAGCA(Y = C/T)AACACC

a Proposed new subgroups based on this study

Primer pair Sequences Annealing temp(C)

amplied using 4080 ng of genomic DNA at optimal annealing temperatures of 58C for WB-A and WB-B and 60C for 2-2 WB. Amplied products were 540, 510 and 500 bp, respectively (Table 3). These conditions were optimal for obtaining strong amplications without nonspecic products. Genomic DNA from unrelated fungal species was not amplied with any of the primers tested.

Discussion

Sequence alignment and phylogenetic analysis of the ITS-5.8S rDNA region of 68 isolates of R. solani from common bean with WB symptoms differentiated two clades in AG-1 and one in AG 2-2. Sequence data subjected to analysis by distance and character state methods conrmed that WB isolates previously characterized as AG-1 IB, (WB subgroup) (Godoy-Lutz et al. 1996b, 2003), were genetically distinct from AG-1 IA, IB, IC and ID and supported their separation into two different subgroups named AG-1 IE and AG-1 IF. Sequence similarities of the ITS-5.8S rDNA region for AG-1 and AG-2-2 alignments with tester isolates from the NCBI GenBank were within the expected range for isolates of different subgroups in an AG (Kuninaga et al. 1997). Isolates of both subgroups, AG-1 IE and AG-1 IF, cause similar symptoms on common bean but can be clearly distinguished by the size of their sclerotia and culture pigmentation. Isolates of AG-1 IE grown on PDA develop sclerotia ranging in size from 5 to 20 mm, single or aggregated, and isolates of AG-1 IF develop sclerotia of \1 mm scattered on the culture surface. All AG-1 IF isolates develop dark brown pigmentation in cultures, whereas AG-1 IE isolates do not (Godoy-Lutz et al. 2003).

WB isolates, which were previously assigned to either AG-2-2 IV or AG-2 unknown on the basis of PCR-RFLP, were separated as a clade from the known subgroups AG-2-2 LP, IIIB and IV on the basis of the entire ITS-5.8S rDNA region analysis. High bootstrap values at branches in both topologies supported their separation. Even though these

isolates had greater polymorphism than did the WB isolates in AG-1, we made no attempt to further subdivide them and placed them all in clade A. The WB isolates in clade A of AG-2-2 are named AG-2-2 WB. The AG-2-2 WB isolates are phenotypically indistinguishable from other AG-2-2 subgroup isolates.

Our data corroborate work by Liu and Sinclair (1993) who proposed further subdivision of the traditional three subgroups of AG-1 (AG-1 IA, IB and IC) to six which include ISD ID, IE and IF. Their proposal was supported by restriction maps of the ITS-5.8S rDNA and isozyme analysis of 61 isolates of R. solani mostly from rice and soybean hosts. Even though we have named the WB isolates as AG-1 IE and IF they may not be related to Liu and Sinclairs isolates because those ITS-5.8S rDNA sequences are not currently available in sequence repository databases for comparison. Subsequently, by using sequence analysis and a specic primer set, we have conrmed that the new subgroup AG-1 IE agrees with the independent group, ISD ID (consisting of ve isolates from R. K. Joness culture collection) proposed by Liu and Sinclair (1993). These isolates were recovered from soybean [Glycine max (L.) Merr] from Louisiana and Texas, USA. This nding suggests that isolates belonging to AG-1 IE also occur in the USA.

WB isolates Jamastrn and Los Limones displayed polymorphism as evidenced by the length of the tree branches. These isolates are phenotypically indistinguishable from WB isolates of AG-1 IE, but they were collected nine years later than the other isolates. Similarly, WB isolate MGB12, collected in 2001, was placed in the AG-1 IB subgroup based on sequence similarities, but it was also indistinguishable from WB isolates of AG-1 IE.

Whether the sequence polymorphism or intragroup variability of these isolates is indicative of the emergence of new genotypes over time is beyond the scope of this study but warrants further examination. Isolates of AG-1 are predominantly heterothallic, and their population structure is most likely derived from outbreeding (Cubeta

123

J Gen Plant Pathol (2008) 74:3240 39

and Vilgalys 1997). Field populations of R. solani AG-1 IA, causal agent of sheath blight of rice, have been examined in Texas and India. Most of these isolates appear as genetically homogenous groups, but there was also evidence of sexual recombination resulting in new geno-types (Linde et al. 2005; Rosewich et al. 1999). Occurrence of the sexual stage in eld populations of AG-1 isolates causing WB of common bean has been documented in many countries in Latin America and the Caribbean (Cardenas 1989; Echandi 1965; Godoy-Lutz et al. 1996b). Perhaps a similar mechanism may be operating to generate new genotypes in eld populations of AG-1 IE and IF. There is evidence that a small amount of recombination may have signicant effects on population structure of fungi (Milgroom 1996; Zhan et al. 1998).

Most WB isolates within subgroups AG-1 IE, AG-1 IF and AG-2-2 WB had identical sequences at the ITS-5.8S rDNA region even though they were collected from either rainforest mountains or commercial elds in geographically separated countries and from different Phaseolus host gene pools. This nding is consistent with the widespread distribution of similar genotypes in the region. Examining other loci in the WB isolate genome would verify this wide distribution. Long-distance dispersal of R. solani clonal isolates has been documented for AG-1, AG-3 and AG-8 (Balali et al. 1996; Macnish et al. 1993; Rosewich et al. 1999). Contaminated machinery, seed and irrigation water are dispersal mechanisms that have inuenced the distribution of isolates in those subgroups (Linde et al. 2005; Rosewich et al. 1999). Spread of pathogens via contaminated seed is known to occur in common bean (Galvez et al. 1989). Developing countries, such as those located in the LAC region often lack seed certication programs for seed distribution and considerable informal market exchange of commercial varieties and/or landraces occurs (Beaver et al. 2003; Martinez 2004). Virulent WB isolates of AG-1 were commonly isolated from asymptomatic common bean seeds harvested from elds in the Dominican Republic and Puerto Rico (Echvez-Badel et al. 2000; Godoy-Lutz et al. 1996a; Takegami et al. 2004), indicating that seed was a suitable ecological niche for the spread and survival of these isolates. Isolates of AG-2 were also isolated from seeds but less frequently.

Besides seedborne spread, microsclerotia produced by WB isolates of AG-1 IF can function as airborne propagules often initiated by rain-splash, facilitating inoculum distribution and pathogen spread. WB epidemics caused by microsclerotia-producing isolates have been reported for soybean and lima bean (Weber 1939; Yang et al. 1990). In lima bean, abundant microsclerotia had a signicant airborne phase aided by wind and rain, with running water also contributing to the local spread of these survival structures of the fungus.

R. solani AG-2 isolates represent a highly heterogeneous assemblage of isolates divided into at least six subsets (equivalent to subgroups), including the recent addition of the bridging subgroup AG-2BI (Carling et al. 2002). Thus it was surprising to nd WB isolates sharing the same ITS-5.8S rDNA sequence from geographically separated areas. Previous to this work, only two WB isolates of AG-2, H13 (GenBank accession AB 054860) and D-G02 (GenBank accession AB 054861) have been characterized as belonging to AG-2-2 IV based on sequence analysis of the same region (Carling et al. 2002). Genotyping with other markers should help determine whether the population structure of WB isolates of AG-2-2 WB is clonal or out-crossed and whether contaminated seed has been an efcient dispersal mechanism over time and space.

The contribution of basidiospores to long-range dispersal has not been established; however, short-range dispersal by basidiospores has been reported in the LAC region where WB is endemic (Cardenas 1989; Godoy-Lutz et al. 1996b).

In this study we conrmed that WB of common bean is caused by the genetically distinct subgroups of Rhizoctonia solani (teleomorph Thanatephorus cucumeris): AG-1 IA, AG-1 IB, and newly described AG-1 IE, AG-1 IF and AG-2-2 WB. The variable genetic composition of the WB pathogen may have affected the dynamics of the host pathogen relationships because its genetic exibility allows for adaptation to variable ecological niches including the long-distance introduction of new genotypes into the region. Our work has shown the need for epidemiological studies to complement molecular studies.

The availability of molecular tools such as specic primer sets should facilitate seed health monitoring and identication of the subgroups associated with the disease in areas with high risk for WB epidemics. Knowledge of the genetic variation of the WB pathogen should be used to re-examine management practices and breeding strategies currently used in the region.

Acknowledgments We thank Dr. R. K. Jones, University of Texas A&M University for supplying the strains of R. solani. Dr. Roy French, USDA, ARS, Lincoln, NE, for analysis in PAUP and Ms. Becky Higgins for technical support. We acknowledge the support of the Bean/Cowpea CRSP (USAID contract no. DAN-1310-G-SS-6008-00). A contribution of the University of Nebraska Agricultural Research Division, Lincoln, NE 68583, Journal Series No. 15028.

References

Balali GR, Whisson DL, Scott ES, Neate SM (1996) DNA ngerprinting probe specic to isolates of Rhizoctonia solani AG-3. Mycol Res 100:467470

Beaver JS, Rosas JC, Myers J, Acosta J, Kelly JD, Nchimbi-Msolla S, Misangu R, Bokosi J, Temple S, Arnaud-Santana E, Coyne DP (2003) Contributions of the Bean/Cowpea CRSP to cultivar and

123

40 J Gen Plant Pathol (2008) 74:3240

germplasm development in common bean. Field Crops Res 82:87102Beebe SE, Pastor Corrales MA (1991) Breeding for disease resistance. In: van Schoonhoven A, Voysest O (eds) Common beans research for crop improvement. CAB International, Wallingford, UK and CIAT, Cali, Colombia, pp 561617 Cardenas MR (1989) Web blight of beans (Phaseolus vulgaris L.) incited by Thanatephorus cucumeris (Frank) Donk in Colombia. Ph.D. thesis, Cornell University, Ithaca, NY, USA Carling D (1996) Grouping in Rhizoctonia solani by hyphal anastomosis reaction. In: Sneh B, Jabaji-Hare S, Neate S, Dijst G (eds) Rhizoctonia species: taxonomy, molecular biology, ecology, pathology and disease control. Kluwer Academic Publishers, Dordrecht, pp 3747Carling DE, Kuninaga S, Brainard KA (2002) Hyphal anastomosis reactions, rDNA-internal transcribed spacer sequences, and virulence levels among subsets of Rhizoctonia solani anastomosis group-2 (AG-2) and AG-BI. Phytopathology 92:4350 Choto C, RubioW, Montenegro T, Viana A, Ayala J, Solis J (1993)

Diagnstico y monitoreo de limitantes biticas en el cultivo del frjol CDT. Izalco en postrera de 1993. CENTA-PROFRIJOL, San SalvadorCubeta MA, Vilgalys R (1997) Population biology of the Rhizoctonia solani complex. Phytopathology 87:480484 Echandi E (1965) Basidiospore infection by Pellicularia lamentosa

(=Corticium microsclerotia), the incitant of web blight of common bean. Phytopathology 55:698699 Echvez-Badel R, Gomez-Galue J, Alameda-Lozada M (2000)

Characterization of Rhizoctonia spp. isolates collected from Phaseolus vulgaris in Puerto Rico. J Agric Univ P R 84:7986 Food and Agriculture Organization. Production yearbook (2004)

FAO, Rome, Italy

Galvez GE, Mora B, Pastor Corrales MA (1989) Web blight. In:

Schwartz HF, Pastor Corrales MA (eds) Bean production problems in the tropics. CIAT, Cali, pp 195259 Godoy-Lutz G, Arias J, Steadman JR, Eskridge KM (1996a) Role of natural seed infection by the web blight pathogen in common bean seed damage, seedling emergence, and early disease development. Plant Dis 80:887890Godoy-Lutz G, Arias J, Saladin F, Steadman JR, Carling DE (1996b)

Characterization of isolates of R. solani that cause web blight of common beans in Central America and the Caribbean with implications for disease management. Ann Rep Bean Improv Coop 39:154155Godoy-Lutz G, Steadman JR, Higgins B, Powers K (2003) Genetic variation among isolates of the web blight pathogen of common bean based on PCR-RFLP of the ITS-rDNA region. Plant Dis 87:766771Hyakumachi M, Mushida T, Ogiso Y, Toda T, Kageyama K, Tsuge T

(1998) Characterization of a new cultural type LP of Rhizoctonia solani AG-2-2 isolated from warm-season turfgrasses, and its genetic differentiation from other cultural types. Plant Pathol 47:19Jones RK, Belmar SB (1989) Characterization and pathogenicity of

Rhizoctonia spp. isolated from rice, soybean, and other crops grown in rotation with rice in Texas. Plant Dis 73:10041010 Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform 5:150163Kuninaga S, Natsuaki T, Takeuchi T, Yokosawa R (1997) Sequence variation of the rDNA ITS regions within and between anastomosis groups in Rhizoctonia solani. Curr Genet 32:237243 Linde CC, Zala M, David Paulraj RS, McDonald BA, Gnanamanickam SS (2005) Population structure of the rice sheath blight pathogen Rhizoctonia solani AG-1 IA from India. Eur J Plant Pathol 112:113121

Liu ZL, Sinclair JB (1993) Differentiation of intraspecic groups within anastomosis group 1 of Rhizoctonia solani using ribosomal DNA internal transcribed spacer and izozyme comparisons. Can J Plant Pathol 15:272280

MacNish GC, Carling DE, Brainard KA (1993) Characterization of

Rhizoctonia solani AG-8 from bare patches by pectic isozyme (zymogram) and anastomosis techniques. Phytopathology 83:922927 Martinez LR (2004) An integrated assessment of dry beans subsector en Central America. MSc thesis, Dept of Agricultural Economics, Michigan State University, East Lansing, MI, USA Masangano C, Miles C (2004) Factors inuencing farmers adoption of kalima bean (Phaseolus vulgaris L.) variety in Malawi. J Subs Agric 24:117129 Milgroom MG (1996) Recombination and the multilocus structure of fungal populations. Ann Rev Phytopathol 34:457477 Ogoshi A (1987) Ecology and pathogenicity of anastomosis and intraspecic groups of Rhizoctonia solani Khn. Ann Rev Phytopathol 25:125143Page RDM (1996) TREEVIEW: an application to display phylogenetic trees on personal computers. Comput Appl Biosci 12:357 358Priyatmojo A, Escopalao VE, Tangonan NG, Pascual CB, Suga H,

Kageyama K, Hyakumachi M (2001) Characterization of a new subgroup of Rhizoctonia solani anastomosis group 1 (AG-1-ID), causal agent of a new necrotic leaf spot on coffee. Phytopathology 91:10541061Rosewich UL, Pettway RE, McDonald BA, Kistler HC (1999) High levels of gene ow and heterozygote excess characterize Rhizoctonia solani AG-1 IA (Thanatephorus cucumeris) from Texas. Fungal Gen Biol 28:148159Salazar O, Schneider JHM, Julian MC, Keijer J, Rubio V (2000)

Phylogenetic subgrouping of cultural types Rhizoctonia solani AG 2-2 based on ribosomal ITS sequences. Mycologia 92:505 509Schneider JHM, Salazar O, Rubio V, Keijer J (1997) Identication of

Rhizoctonia solani associated with eld grown tulips using ITSrDNA polymorphism and pectic zymograms. Eur J Plant Pathol 103:607622Skroch P, Nienhuis J (1995) Impact of scoring error and reproducibility of RAPD data on RAPD based estimates of genetic distance. Theor Appl Genet 91:10861091Sneh B, Burpee L, Ogoshi A (1991) Identication of Rhizoctonia species. APS, St PaulSwofford DL (2002) PAUP*: phylogenetic analysis using parsimony

(*and other methods), Version 4.0 beta, Sinauer, Sunderland, MA, USATakegami JC, Beaver JS, Godoy-Lutz G, Echvez-Badel R, Steadman

JR (2004) Inheritance of web blight resistance in common bean. J Agric Univ P R 88:4554Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of the progressive multiple sequence alignment through sequence weighting, positions-specic gap penalties and weight matrix choice. Nucleic Acids Res 22:46734680 Weber GF (1939) Web blight, a disease of beans caused by Corticium microsclerotia. Phytopathology 27:559575White TJ, Bruns TD, Lee S, Taylor J (1990) Amplication and direct sequencing of fungal ribosomal RNA for phylogenetics. In: Innis MA, Geland DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic Press, San Diego, pp 315322Yang XB, Berggren GT, Snow JP (1990) Types of Rhizoctonia foliar blight on soybean in Louisiana. Plant Dis 74:501504Zhan J, Mundt CC, McDonald BA (1998) Measuring immigration and sexual reproduction in eld populations of Mycosphaerella graminicola. Phytopathology 88:13301337

123