Cadmium Complexed with β2-Microglubulin, Albumin and Lipocalin-2 rather than Metallothionein Cause Megalin:Cubilin Dependent Toxicity of the Renal Proximal Tubule

Abstract

Supposedly, Cd2+-MT is steadily released into the bloodstream as the cells undergo necrosis, either through normal cell turnover or as a result of Cd2+ injury, and redistributes to the kidney. Since intravenously injected Cd2+-MT in mice is quickly cleared from the plasma by the kidneys [6], this protein fraction in the circulation is thought to be of great importance for Cd2+ shuttling from the liver to the kidney during long-term exposure [7,8,9]. [...]megalin:cubilin represents a high-capacity receptor for endocytosis that prevents protein loss from the body into the urine [21]. [...]50 µmol/L CdCl2 (24 h) decreased cell viability to 0% (n = 4) in both high and low passage cells, indicating that the mechanisms of CdCl2 toxicity differ from Cd2+-MT toxicity and also proving that the totality of excess free Cd2+ has been removed from Cd2+-MT (see Section 4.2). Since in vivo relevant concentrations of Cd2+-MT in plasma [11,12] and primary filtrate, which are in the low nanomolar range (Table 1), are unlikely to cause PT toxicity because megalin:cubilin affinity for MT is too low, alternative candidate Cd2+-protein ligands for megalin:cubilin were investigated, i.e., β2M, Lcn2, Tf, Alb and α1M [15,17]. [...]Lcn2 has a higher expected primary filtrate concentration of ~650 nmol/L and a KD for megalin binding that is similar to Tf (see Table 1).

1. Introduction

Cadmium (Cd²⁺) pollution is increasing in the environment worldwide due to industrial activities and because it cannot be further degraded. Compared to other transition metals, Cd²⁺ and Cd²⁺ compounds are relatively water soluble, more bio-available, and therefore tend to bio-accumulate [1]. Chronic Cd²⁺ exposure, mainly from contaminated dietary sources and cigarette smoking [2], leads to Cd²⁺ accumulation in the human body, especially in the kidneys where renal tubular damage is probably the most critical health effect.

Following absorption in the intestine and/or lungs, Cd²⁺ in the blood initially binds largely to albumin and other thiol-containing high-molecular (HMWP) and low-molecular weight proteins (LMWP) in the plasma, including metallothioneins (MT), as well as to blood cells [2]. MT, a cysteine-rich metal-binding protein, binds both physiological Zn²⁺ ions and toxic Cd²⁺ ions through the thiol group of its cysteine residues with very high affinity (K_D for Cd²⁺ ~10⁻¹⁴ mol/L) [3].

In the literature, a presumed model prevails wherein blood Cd²⁺ is taken up by hepatocytes [4] or Kupffer cells [5] in which free cytosolic Cd²⁺ is thought to induce synthesis of MT to bind and detoxify Cd²⁺. Supposedly, Cd²⁺-MT is steadily released into the bloodstream as the cells undergo necrosis, either through normal cell turnover or as a result of Cd²⁺ injury, and redistributes to the kidney. Since intravenously injected Cd²⁺-MT in mice is quickly cleared from the plasma by the kidneys [6], this protein fraction in the circulation is thought to be of great importance for Cd²⁺ shuttling from the liver to the kidney during long-term exposure [7,8,9]. Although some experimental evidence exists from animal studies that Cd²⁺ redistributes from the liver to the kidney during chronic exposure to high Cd²⁺ concentrations, this is not the case for low environmentally relevant blood concentrations [9], which in humans range between 0.03 and 0.5 µg/L (~0.3–5 nmol/L) (reviewed in reference [10]). In fact, the plasma Cd²⁺-MT concentrations following intravenous injections exceeded physiological MT concentrations by >2000-fold [11,12]. With a molecular mass (MM) of ~3.5–14 kDa, (Cd²⁺)-MT easily crosses the glomerular barrier (cut-off ~80 kDa) and is thought to be completely endocytosed from the ultrafiltrate in the S1-segment of the proximal tubule (PT) [13,14], by the multiligand, endocytic-membrane receptor complex megalin:cubilin [15]. Endocytosed Cd²⁺-MT is trafficked to acidic late endosomes and lysosomes where the protein moiety is degraded and Cd²⁺ is extruded via divalent metal transporter 1 (DMT1) into the cytosol to develop toxicity [16].

Megalin:cubilin also binds and retrieves other filtered proteins, such as the LMWP β2-microglobulin (β2M; MM ~11 kDa) neutrophil gelatinase-associated lipocalin (NGAL)/lipocalin-2 (Lcn2; MM ~22–25 kDa), and α1-microglobulin (α1M; MM ~27 kDa), as well as the HMWP albumin (Alb; MM ~67 kDa) and transferrin (Tf; MM ~76 kDa) (reviewed in reference [15]). In contrast to LMWP, which are freely filtered and are present in similar concentrations in plasma and ultrafiltrate, only lower concentrations of HMWP will be found in the ultrafiltrate based on their estimated glomerular sieving coefficients (reviewed in reference [17]). Furthermore, the aforementioned proteins also bind divalent metal ions, including Cd²⁺, with K_D values of ~10⁻⁶ mol/L and maximally two binding sites [18,19,20].

Hence, megalin:cubilin represents a high-capacity receptor for endocytosis that prevents protein loss from the body into the urine [21]. Although the affinity of megalin:cubilin to most of its protein ligands is high (K_D varies between 20–600 nmol/L) (reviewed in reference [17]), its affinity to MT is in the high micromolar range [22,23], which practically excludes MT uptake by the PT, taking into account that plasma (and ultrafiltrate) concentrations of MT measured are in the high picomolar to low nanomolar range [11,12]. This has been overlooked in the literature so far and indicates that Cd²⁺-MT is not the primary source of complexed Cd²⁺ responsible for damaging the kidney PT.

In the present study we have determined the uptake and toxicity of Cd²⁺ complexed to LMWP β2M, α1M and Lcn2 and the HMWP Alb and Tf using a rat PT cell line (WKPT-0293 Cl.2) expressing megalin:cubilin. The data reiterate that Cd²⁺-MT is not toxic, even at concentrations that exceed the physiological MT concentrations in the ultrafiltrate by ~100-fold. Rather, Cd²⁺-β2M, Cd²⁺-Alb and Cd²⁺-Lcn2 are taken up by PT cells and cause toxicity at ultrafiltrate concentrations and therefore represent more likely candidates of Cd²⁺-protein complexes that damage the renal PT via megalin:cubilin-dependent endocytosis.

2. Results

The WKPT-0293 Cl.2 cell line, derived from the S1-segment of rat PT [24], is one of few renal PT cell lines to express megalin and cubilin (Figure 1) [23,25,26], which is lost at passage numbers exceeding 40. Real-time PCR confirmed loss of megalin mRNA in high passage (p > 100) compared to low passage (p ≤ 40 cells) (Figure 1A). Importantly, low passage cells also express higher cubilin (Cubn) mRNA levels than high passage cells (Figure 1A) since endocytosis of Tf, Alb and α1M requires cubilin binding and interaction with megalin to occur [27,28,29] (reviewed in reference [15]). In contrast, endocytosis of MT, Lcn2 and β2M is exclusively megalin-dependent. Interestingly, mRNA expression levels of megalin were higher than cubilin in low passage cells (Figure 1A), which is in agreement with their relative protein expression in rat PT [21]. Immunofluorescence staining using a commercial monoclonal antibody against whole megalin whose epitope has not yet been characterized (courtesy of Novus Biologicals) clearly shows staining in permeabilized low passage, but not in high passage cells (Figure 1B,C). No positive staining was detected in non-permeabilized low passage cells, which indicates that the antibody is directed against an intracellular epitope. Immunoblotting of cubilin in low and high passage cells (Figure 1D) confirmed cubilin protein expression in low, but not in high passage cells.

MT has been demonstrated to be a low affinity ligand of megalin in previous studies by surface plasmon resonance [22] or uptake of Alexa Fluor 488-coupled MT in WKPT-0293 Cl.2 cells [23]. As shown in Figure 2A, Cd²⁺-MT toxicity increased as a function of concentration in low passage cells but became only significantly different to high passage cells at the highest tested concentration of 10 µmol/L Cd²⁺-MT (≅ 70 µmol/L Cd²⁺) after 24 h exposure. In contrast, high passage cells did not show significant toxicity at all concentrations tested, further demonstrating the importance of megalin for Cd²⁺-MT endocytosis. Similarly, a high concentration of 7.14 µmol/L Cd²⁺-MT (≅ 50 µmol/L Cd²⁺), which was used in WKPT-0293 Cl.2 cells in previous studies [23], showed 59 ± 4 % cell viability (n = 5; p < 0.01) in low passage cells expressing megalin and 98 ± 13% cell viability in megalin-deficient high passage cells (n = 4; p < 0.01) whereas no difference was observed for MT alone (Figure 2B). In contrast, 50 µmol/L CdCl₂ (24 h) decreased cell viability to 0% (n = 4) in both high and low passage cells, indicating that the mechanisms of CdCl₂ toxicity differ from Cd²⁺-MT toxicity and also proving that the totality of excess free Cd²⁺ has been removed from Cd²⁺-MT (see Section 4.2).

Since in vivo relevant concentrations of Cd²⁺-MT in plasma [11,12] and primary filtrate, which are in the low nanomolar range (Table 1), are unlikely to cause PT toxicity because megalin:cubilin affinity for MT is too low, alternative candidate Cd²⁺-protein ligands for megalin:cubilin were investigated, i.e., β2M, Lcn2, Tf, Alb and α1M [15,17]. Similarly to MT, the concentration of the cubilin ligand Tf in the primary filtrate is in the low nanomolar range at 2 nmol/L and binds megalin with high affinity (Table 1). In contrast, β2M, Alb and α1M are present in the primary filtrate at ~100, 50 and 92 nmol/L, respectively (Table 1). Whereas β2M and Alb have known K_D for megalin and cubilin, respectively, at high nanomolar concentrations (Table 1), the K_D of α1M for cubilin is unknown [15]. Finally, Lcn2 has a higher expected primary filtrate concentration of ~650 nmol/L and a K_D for megalin binding that is similar to Tf (see Table 1).

To mimic the Cd²⁺-protein concentrations measured in the filtrate (to which PT cells are exposed to), low passage cells were also incubated for 24 h with 100 nmol/L of β2M, and Alb or α1M as apo-proteins or as Cd²⁺ complexes, and MTT absorbance was measured (Figure 3A). MT at the same concentration was included for comparison. Similarly as shown in Figure 2A, Cd²⁺-MT was not toxic (although its filtrate concentration is ~100-fold lower). In contrast, Cd²⁺-β2M significantly decreased cell viability (59 ± 6%; n = 4; Figure 3A). A concentration of Tf at the approximately expected filtrate concentration (5 nmol/L Cd²⁺-Tf with 10 nmol/L Cd²⁺ assuming 2 Cd²⁺-binding sites [18]) did not reduce cell viability of low passage WKPT-0293 Cl.2 cells. Even at 100 nmol/L Cd²⁺-Tf showed no significant decrease of cell viability (90 ± 13% cell viability; n = 8), indicating that it is not likely to cause toxicity in vivo. Interestingly, Cd²⁺-Alb (assuming 1 Cd²⁺-binding site [19]) significantly decreased cell viability (59 ± 8%; n = 7; Figure 3A). Yet 100 nmol/L Cd²⁺-α1M did not induce significant toxicity in low passage cells (82 ± 14% cell viability; n = 9). At 100 nmol/L, Cd²⁺-Lcn2 was not toxic (103 ± 7% of cell viability; n = 5; Figure 3B). However, Cd²⁺-Lcn2 at 1 µmol/L, a concentration close to that in the primary filtrate (Table 1) also showed significant toxicity in low passage cells (64 ± 4%; n = 6; Figure 3B).Viability of high passage cells was unaffected by Cd²⁺-β2M, Cd²⁺-Alb or Cd²⁺-Lcn2, when tested under the same conditions.

Alb uptake by WKPT-0293 Cl.2 cells was confirmed by fluorescence microscopy of FITC-coupled Alb (100 nmol/L for 24 h). Interestingly, although low passage cells showed increased internalization of FITC-Alb (Figure 4), the difference to high passage cells was not as pronounced as megalin:cubilin expression (Figure 1) and toxicity in low passage cells (Figure 3A). This was also the case for β2M uptake.

3. Discussion

The current dogma of chronic Cd²⁺ nephrotoxicity assumes that (1) Cd²⁺ exposure results in initial accumulation of the metal ion in the liver, where it induces MT synthesis and binds to the protein; (2) as a result of normal cell turnover, or hepatic damage some of the Cd²⁺-MT is released into the blood; (3) Cd²⁺-MT in the circulation is rapidly cleared by the renal glomeruli and reabsorbed by the PT; (4) this translocation eventually leads to nephrotoxicity [4]. Thus MT is claimed to serve both as a storage and a transport protein for Cd²⁺ [33].

Yet, a thorough assessment of the literature clearly indicates that this model can no longer be accepted. Firstly, and most importantly, susceptibility of MT-null mice to chronic CdCl₂-induced nephrotoxicity indicates that renal PT injury is not mediated by the Cd²⁺-MT complex [34]. Secondly, renal uptake of ultrafiltrated Cd²⁺-MT was only observed with very high concentrations of parenterally applied acute Cd²⁺-MT injections varying between 0.7–2 µmol/L [35,36,37,38,39] and is an inappropriate model for the study of chronic Cd²⁺-induced nephrotoxicity [40]. Finally, the in vivo evidence for redistribution of liver Cd²⁺-MT to the kidney is based on experimental models that rely on excessive hepatic Cd²⁺ accumulation or exposure to hepatotoxic agents [7,41,42,43,44] and is not observed in mice subjected to chronic administration of Cd²⁺ via drinking water, which mimics chronic exposure from dietary sources [9].

Overall, in light of our reasoning and in context of a K_D of megalin:cubilin to MT in the high micromolar range [22,23], it was reasonable to assume that other filtered Cd²⁺-protein complexes may at least partly mediate chronic PT toxicity. Complex formation of Alb, β2M and Tf with Cd²⁺ and other divalent metal ions with a K_D of around 1 µmol/L and maximally two Cd²⁺ binding sites has been described [18,19,20]. We also investigated Lcn2 and α1M that are both filtered and ligands of megalin [31] and cubilin [29], respectively, for which no binding data to Cd²⁺ are available in the literature. Cd²⁺-β2M, Cd²⁺-Alb and Cd²⁺-Lcn2 at concentrations that are compatible with the ultrafiltrated concentrations of these proteins in vivo caused toxicity of low passage WKPT-0293 Cl.2 cells expressing megalin:cubilin and were internalized by the cells. It may be debated that these proteins exhibit relatively low affinities to Cd²⁺ compared to MT, indicating that at steady-state they will be maximally saturated by ~1% to form complexes with blood Cd²⁺ (with a concentration of 0.3–5 nM [10]) whereas MT in the circulation will be Cd²⁺-saturated (based on equivalent low nanomolar concentrations of MT and Cd²⁺ and a K_D for Cd²⁺ ~10⁻¹⁴ mol/L [3]). Yet the relatively high concentrations of β2M, Alb and Lcn2 in the primary filtrate compared to MT, their high binding affinity to megalin (Table 1) and the multiplicative effect of continuous glomerular filtration makes them more likely to contribute to chronic renal PT toxicity than Cd²⁺-MT whose concentration in the primary filtrate is at least 10⁵-times lower [11,12] than its affinity to megalin [22]. Of note, β2M is known as an early urinary biomarker of renal PT toxicity induced by chronic low Cd²⁺ exposure, because when its reabsorption via megalin:cubilin is disrupted [38,45,46] (reviewed in reference [47]), it is consequently excreted into the urine.

Strikingly, the difference in uptake of Alb and β2M between low and high passage cells was less pronounced than expected from the megalin:cubilin expression (Figure 1) and toxicity data, suggesting that other entry pathways for these (Cd²⁺) protein complexes could contribute to endocytosis without leading to toxicity, such as transcytosis [48].

From the current data Cd²⁺-MT is unlikely to be endocytosed in the PT, and because only 0.02–03% of filtered proteins, including MT, are excreted with the urine, [49] more distal nephron segments must be involved in MT retrieval. Indeed, the renal medulla accumulates significant amounts of both Cd²⁺ and Cd²⁺-MT in humans, and concentrations of both Cd²⁺ compounds can reach ~50% of the levels found in the cortex [50,51]. MT was detected by immunohistochemistry in distal nephron segments of rodent and human kidney [52,53,54], and the expression of MT was induced by exposure to Cd²⁺ [53,54]. A high-affinity receptor for MT has been identified in the distal nephron, the Lcn2 receptor (Lcn2-R/SLC22a17/BOCT [brain organic cation transporter]). Lcn2-R is expressed apically in the distal convoluted tubule (DCT) and collecting duct (CD), mainly inner medullary [55]. Chinese hamster ovary cells transiently expressing Lcn2-R and cultured mouse DCT cell line endogenously expressing Lcn2-R internalized sub-micromolar concentrations of fluorescence-labelled MT (K_D ~100 nmol/L), Tf or Alb whose uptake was prevented by picomolar Lcn2 concentrations, which indicated that the Lcn2-R mediates uptake of these proteins [55]. Exposure of both cell lines expressing Lcn2-R to 700 nM Cd²⁺-MT induced cell death that could be reduced by Lcn2 [55], which indicates that Cd²⁺-MT is a high-affinity ligand of Lcn2-R that mediates endocytosis and toxicity of Cd²⁺-MT in the distal nephron. Hence, although Cd²⁺-MT may not be directly involved in Cd²⁺-induced PT damage, it is likely responsible for renal DCT/CD/medulla Cd²⁺ uptake and toxicity. Considering that up to 90% of the primary renal fluid is reabsorbed by the PT and Henle loop and about 1% is excreted as urine (reviewed in references [56,57]), luminal Cd²⁺-MT concentrations in the distal nephron may increase up to 500 nmol/L (cf. [11,12]), which is in the range of the binding affinity of the Lcn2-R for MT [55]. Investigation of distal nephron damage has been neglected so far, and only rare evidence for chronic Cd²⁺ toxicity of the distal portions of the nephron has been obtained, both in experimental animals [58,59] and Cd²⁺-exposed workers [60].

In summary, at relevant concentrations present in the primary filtrate, renal PT cells do not succumb to Cd²⁺ toxicity by Cd²⁺-MT uptake. Rather, megalin:cubilin endocytosis of other Cd²⁺-complexed ligands, namely Cd²⁺-β2M, Cd²⁺-Alb and/or Cd²⁺-Lcn2, damages the PT.

4. Materials and Methods 4.1. Materials

Metallothionein-1 (MT) was obtained from Enzo Life Sciences, Lörrach, Germany (cat. # ALX-202-072-M001). β2-microglobulin (β2M, cat. # M4890), apo-transferrin (Tf, cat. # T2252), albumin (Alb, cat. # A6414), Chelex 100 (cat. # C7901) and 2,3-dihydroxybenzoic acid (DHBA; cat. # 126209) were obtained from Sigma-Aldrich, Taufkirchen, Germany. α1-microglobulin (α1M, cat. # ab96149) was purchased from Abcam, Berlin, Germany. Recombinant mouse NGAL/lipocalin-2 (Lcn2) (cat. # 1857-LC) was from R&D Systems, Abingdon, United Kingdom. All protein ligands had a purity of ≥95%–99% according to the suppliers, were lyophilized proteins and reconstituted in phosphate buffered saline (PBS). All other chemicals were from commercial sources and of analytical grade.

4.2. Methods

4.2.1. Cell Culture

An immortalized cell line from the S1 segment of rat PT (WKPT-0293 Cl.2) [24] was cultured in serum-containing medium (SCM), essentially as previously described [61] with the addition of 2.5 µg/mL plasmocin (InvivoGen, Toulouse, France) in 25 cm² standard tissue culture flasks (Sarstedt, Nümbrecht, Germany) at 37 °C in a humidified incubator with 5% CO₂. Cells were passaged twice a week upon reaching confluency. Low passage cells are defined as p31-40 and high passage cells as p > 100.

4.2.2. Coupling of Cd²⁺-Protein Complexes

Cd²⁺-coupled proteins (MT, Tf, Alb, β2M, α1M) were prepared exactly, as described previously [62], by mixing protein solutions with a 10-fold molar excess of CdCl₂ solution. Briefly, MT (1 mmol/L in 10 mmol/L Tris/HCl pH 7.4) was mixed 1:1 with 10 mmol/L CdCl₂ solution, unbound metal ions were removed with a 2:1 excess of Chelex 100 followed by centrifugation. The resulting supernatant was retained and contained 0.5 mmol/L MT complexed to 3.5 mmol/L Cd²⁺, assuming 7 Cd²⁺ ions per molecule of MT [3]. Tf, Alb, β2M or α1M (0.1 mmol/L) were complexed accordingly using a 1 mmol/L CdCl₂ solution.

For complexation of Lcn2 with CdCl₂, 0.5 mmol/L DHBA (in 100 mmol/L Tris/HCl, pH 8.0) and 5 mmol/L CdCl₂ solutions were mixed 1:1 at RT for 1 h. The mixture was diluted 1:1 with 50 µmol/L Lcn2 dissolved in PBS and stirred for an additional hour. Unbound Cd²⁺ was removed with Chelex 100, as described above.

4.2.3. Cell Viability Assay of WKPT-0293 Cl.2 Cells

To compensate for different cell doubling times, 12.5 × 10³ low-passage or 7.5 × 10³ high-passage WKPT-0293 Cl.2 cells were seeded per well in 24-well plates and cultured for 24 h to obtain ~30–50% confluence. Cells were then exposed to proteins or Cd²⁺-complexed proteins in modified serum-free medium (SFM_mod; DMEM/F12, 1.2 mg/mL NaHCO₃, 100 U/mL penicillin G, 100 µg/mL streptomycin sulfate, 4 µg/mL dexamethasone) for 24 h. After treatments, cell viability was determined by the MTT assay, as previously described [61].

4.2.4. Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was isolated from confluent WKPT-0293 Cl.2 cells using High Pure RNA Isolation Kit (Roche) according to the manufacturer’s instructions and 1 μg of total RNA was reverse transcribed into cDNA using First Strand cDNA Synthesis Kit (Thermo Scientific, Schwerte, Germany). Quantitative real-time PCR was carried out using Takyon Rox SYBR MasterMix dTTP Blue (Eurogentec, Cologne, Germany) on a StepOnePlus cycler (Applied Biosystems, Schwerte, Germany). The cycling conditions were 3 min at 95 °C, followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. Primer sequences are given in Table 2. Gapdh was used as a housekeeping gene. For analysis of relative changes, data was analyzed according to the ΔΔC_T method [63].

4.2.5. Immunofluorescence Staining of Megalin

Low and high passage WKPT-0293 Cl.2 cells were grown on coverslips until they reached ~80% confluence. Immunofluorescence of megalin staining was performed as described previously [16]. Briefly, cells were fixed in 4% paraformaldehyde/PBS, permeabilized with 0.1% Triton X-100/PBS, blocked in 1% bovine serum albumin/PBS, incubated with primary mouse LRP2 antibody (1:200, cat. # NB110-96417, Novus Biologicals, Wiesbaden, Germany) followed by secondary donkey anti-mouse antibody conjugated to Alexa488 (1:500 cat. # 715-545-202, Dianova, Hamburg, Germany) together with the nuclear dye Hoechst 33342 (0.8 µg/mL). Coverslips were mounted onto glass slides with DAKO fluorescence mounting medium.

4.2.6. Immunoblotting

SDS-PAGE and immunodetection of cubilin were performed essentially as described elsewhere [23]. For detection of β-actin, protein samples were separated by 10% SDS-PAGE. Antibodies: sheep anti-cubilin (cat. # AF3700, R&D Systems, Abingdon, United Kingdom), 1.0 µg/mL; mouse anti-β-actin (cat. # A5316, Sigma-Aldrich, Taufkirchen, Germany), 1:20,000.

4.2.7. Detection of Alb and β2M Uptake

Low and high passage WKPT-0293 Cl.2 cells on coverslips (~50% confluence) were incubated with 100 nmol/L FITC-labeled Alb (cat. # A23015, Thermo Scientific, Schwerte, Germany) or 100 nmol/L β2M (cat. # ab175031, Abcam, Berlin, Germany) in SFM_mod for 24 h. Subsequently, cells were washed and fixed as described above. Alb treated cells were mounted without additional immunostaining. β2M exposed cells were permeabilized and stained according to the above described protocol, using a primary β2M antibody (1:500, cat. # ab175031, Abcam, Berlin, Germany) and secondary goat anti-rabbit antibody conjugated to Alexa488 (1:500, cat. # A-11008, Invitrogen, Schwerte, Germany).

4.2.8. Fluorescence Imaging

Cell were imaged on a Zeiss Axiovert 200M equipped with an Fluar 40x, 1.3 NA oil immersion objective (Zeiss, Oberkochen, Germany), a CoolSnap ES camera (Roper Scientific, Planegg, Germany) and a Sola SM II light engine (Lumencor, Tübingen, Germany) using Visiview imaging software (V 3.3.0.6, Visitron Systems GmbH, Puchheim, Germany). 3–6 representative areas on each coverslip were chosen for acquisition of brightfield images and whole cell z-stacks with a step size of 800 nm for fluorescent labels. Images were analyzed and quantified using Fiji [65]. To this end, regions of interest (ROI) were drawn around each cell from which background was subtracted. The z-stack slice with the highest mean intensity for each ROI was selected for further analysis.

4.2.9. Statistics

Unless otherwise indicated, the experiments were repeated at least three times with independent cultures. Bar diagrams showing means ± SEM are used for parametric data sets, unless otherwise indicated. Figures with non-parametric data are shown as box and whisker plots, presenting 25 and 75 percentiles, mean values (square symbol), median (horizontal line) and 1.5× outliers (whiskers). Scatter plots show single data points of color-coded repetitions. Statistical comparison between 2 groups was performed using Student’s unpaired t-test or Mann-Whitney-test in cases of parametric or nonparametric distribution, respectively. If more than two conditions were compared, either one-way ANOVA with Bonferroni post-hoc test (parametric) or Kruskal-Wallis with subsequent Dunn’s post-hoc test were applied using Graph-Pad Prism, San Diego, CA, USA. When one group within a specific data set showed a non-parametric distribution, the whole data set was considered as non-parametric. Results with p < 0.05 were considered to be statistically significant.

Ligand	Receptor	KD (nmol/L)	Reference	Concentration in Glomerular Filtrate (nmol/L) *
MT	Megalin	100,000	[22]	0.5–5
β2M	Megalin	420	[30]	100
Lcn2	Megalin	60	[31]	650
Tf	Cubilin	20	[27]	2
Alb	Cubilin	630	[28]	53
α1M	Cubilin	n.d.	Ø	92

* Calculations are based on estimated glomerular sieving coefficients of plasma proteins [32].

Gene	Forward Primer (5′-3′)	Reverse Primer (5′-3′)
Rat megalin/Lrp2 (NM_030827.1) a	TGGAATCTCCCTTGATCCTG	TGTTGCTGCCATCAGTCTTC
Rat cubilin/Cubn (NM_053332) a	GCACTGGCAATGAACTAGCA	TGATCCAGGAGCACTCTGTG
Rat Gapdh (NM_017008)	AGGGCTCATGACCACAGT	TGCAGGGATGATGTTCTG

a Primer sequences taken from Prabakaran et al. [64].

Author Contributions

Conceptualization, F.T.; Methodology, J.F., B.S., R.Z., I.P.Z.G. and W.-K.L.; Validation, J.F., R.Z., W.-K.L. and F.T.; Formal analysis, J.F., B.S., R.Z., I.P.Z.G. and W.-K.L.; Investigation, J.F., R.Z. and W.-K.L.; Writing-original draft preparation, J.F., B.S., R.Z., W.-K.L. and F.T.; Writing-review and editing, J.F., B.S., R.Z., W.-K.L., O.C.B. and F.T.; Visualization, J.F. and F.T.; Supervision, W.-K.L., O.C.B. and F.T.; Project administration, F.T. and O.C.B.; Funding acquisition, F.T. and O.C.B.

Funding

This research is funded by a collaborative grant Conacyt-BMBF (BMBF # 01DN16039; Conacyt # 267755) between research groups in Germany (J.F., B.S., R.Z., W.-K.L. and F.T.) and Mexico (I.P.Z.G. and O.C.B.), the DFG (TH345; F.T.), Intramural Research Funding Program at Witten/Herdecke University (IFF2018-52; W.-K.L.), and ZBAF (F.T.).

Conflicts of Interest

The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).

References

1. World Health Organization (WHO). Exposure to Cadmium: A Major Public Health Concern. 2010. Available online: https://www.who.int/ipcs/assessment/public_health/cadmium/en/ (accessed on 1 March 2019).

2. Thévenod, F.; Lee, W.K. Toxicology of cadmium and its damage to mammalian organs. Metal. Ions Life Sci. 2013, 11, 415-490.

3. Freisinger, E.; Vasak, M. Cadmium in metallothioneins. Met. Ions Life Sci. 2013, 11, 339-371.

4. Liu, J.; Goyer, R.A.; Waalkes, M.P. Toxic effects of metals. In Casarett & Doull's Toxicology: The Basic Science of Poisons, 7th ed.; Klaasen, C.D., Ed.; McGraw -Hill: New York, NY, USA, 2008; pp. 931-979.

5. Sabolic, I.; Breljak, D.; Skarica, M.; Herak-Kramberger, C.M. Role of metallothionein in cadmium traffic and toxicity in kidneys and other mammalian organs. Biometals 2010, 23, 897-926.

6. Nordberg, M.; Nordberg, G.F. Distribution of metallothionein-bound cadmium and cadmium chloride in mice: Preliminary studies. Environ. Health Perspect. 1975, 12, 103-108.

7. Dudley, R.E.; Gammal, L.M.; Klaassen, C.D. Cadmium-induced hepatic and renal injury in chronically exposed rats: Likely role of hepatic cadmium-metallothionein in nephrotoxicity. Toxicol Appl. Pharmacol. 1985, 77, 414-426.

8. Nomiyama, K.; Nomiyama, H.; Kameda, N. Plasma cadmium-metallothionein, a biological exposure index for cadmium-induced renal dysfunction, based on the mechanism of its action. Toxicology 1998, 129, 157-168.

9. Thijssen, S.; Maringwa, J.; Faes, C.; Lambrichts, I.; Van Kerkhove, E. Chronic exposure of mice to environmentally relevant, low doses of cadmium leads to early renal damage, not predicted by blood or urine cadmium levels. Toxicology 2007, 229, 145-156.

10. Klotz, K.; Weistenhofer, W.; Drexler, H. Determination of cadmium in biological samples. Met. Ions Life Sci. 2013, 11, 85-98.

11. Milnerowicz, H.; Bizon, A. Determination of metallothionein in biological fluids using enzyme-linked immunoassay with commercial antibody. Acta Biochim. Pol. 2010, 57, 99-104.

12. Akintola, D.F.; Sampson, B.; Fleck, A. Development of an enzyme-linked immunosorbent assay for human metallothionein-1 in plasma and urine. J. Lab. Clin. Med. 1995, 126, 119-127.

13. Thévenod, F. Nephrotoxicity and the proximal tubule. Insights from cadmium. Nephron Physiol. 2003, 93, 87-93.

14. Schuh, C.D.; Polesel, M.; Platonova, E.; Haenni, D.; Gassama, A.; Tokonami, N.; Ghazi, S.; Bugarski, M.; Devuyst, O.; Ziegler, U.; et al. Combined structural and functional imaging of the kidney reveals major axial differences in proximal tubule endocytosis. J. Am. Soc. Nephrol. 2018, 29, 2696-2712.

15. Christensen, E.I.; Birn, H.; Storm, T.; Weyer, K.; Nielsen, R. Endocytic receptors in the renal proximal tubule. Physiology 2012, 27, 223-236.

16. Abouhamed, M.; Wolff, N.A.; Lee, W.K.; Smith, C.P.; Thévenod, F. Knockdown of endosomal/lysosomal divalent metal transporter 1 by rna interference prevents cadmium-metallothionein-1 cytotoxicity in renal proximal tubule cells. Am. J. Physiol. Renal Physiol. 2007, 293, F705-F712.

17. Thévenod, F.; Wolff, N.A. Iron transport in the kidney: Implications for physiology and cadmium nephrotoxicity. Met. Integr. Biometal Sci. 2016, 8, 17-42.

18. Harris, W.R.; Madsen, L.J. Equilibrium studies on the binding of cadmium(ii) to human serum transferrin. Biochemistry 1988, 27, 284-288.

19. Goumakos, W.; Laussac, J.P.; Sarkar, B. Binding of cadmium(ii) and zinc(ii) to human and dog serum albumins. An equilibrium dialysis and 113cd-nmr study. Biochem. Cell Biol. 1991, 69, 809-820.

20. Eakin, C.M.; Knight, J.D.; Morgan, C.J.; Gelfand, M.A.; Miranker, A.D. Formation of a copper specific binding site in non-native states of beta-2-microglobulin. Biochemistry 2002, 41, 10646-10656.

21. Christensen, E.I.; Birn, H. Megalin and cubilin: Synergistic endocytic receptors in renal proximal tubule. Am. J. Physiol. Renal Physiol. 2001, 280, F562-F573.

22. Klassen, R.B.; Crenshaw, K.; Kozyraki, R.; Verroust, P.J.; Tio, L.; Atrian, S.; Allen, P.L.; Hammond, T.G. Megalin mediates renal uptake of heavy metal metallothionein complexes. Am. J. Physiol. Renal Physiol. 2004, 287, F393-F403.

23. Wolff, N.A.; Abouhamed, M.; Verroust, P.J.; Thévenod, F. Megalin-dependent internalization of cadmium-metallothionein and cytotoxicity in cultured renal proximal tubule cells. J. Pharmacol. Exp. Ther. 2006, 318, 782-791.

24. Woost, P.G.; Orosz, D.E.; Jin, W.; Frisa, P.S.; Jacobberger, J.W.; Douglas, J.G.; Hopfer, U. Immortalization and characterization of proximal tubule cells derived from kidneys of spontaneously hypertensive and normotensive rats. Kidney Int. 1996, 50, 125-134. [Green Version]

25. Nielsen, R.; Birn, H.; Moestrup, S.K.; Nielsen, M.; Verroust, P.; Christensen, E.I. Characterization of a kidney proximal tubule cell line, llc-pk1, expressing endocytotic active megalin. J. Am. Soc. Nephrol. 1998, 9, 1767-1776.

26. Zhai, X.Y.; Nielsen, R.; Birn, H.; Drumm, K.; Mildenberger, S.; Freudinger, R.; Moestrup, S.K.; Verroust, P.J.; Christensen, E.I.; Gekle, M. Cubilin- and megalin-mediated uptake of albumin in cultured proximal tubule cells of opossum kidney. Kidney Int. 2000, 58, 1523-1533. [Green Version]

27. Kozyraki, R.; Fyfe, J.; Verroust, P.J.; Jacobsen, C.; Dautry-Varsat, A.; Gburek, J.; Willnow, T.E.; Christensen, E.I.; Moestrup, S.K. Megalin-dependent cubilin-mediated endocytosis is a major pathway for the apical uptake of transferrin in polarized epithelia. Proc. Natl. Acad. Sci. USA 2001, 98, 12491-12496. [Green Version]

28. Birn, H.; Fyfe, J.C.; Jacobsen, C.; Mounier, F.; Verroust, P.J.; Orskov, H.; Willnow, T.E.; Moestrup, S.K.; Christensen, E.I. Cubilin is an albumin binding protein important for renal tubular albumin reabsorption. J. Clin. Invest. 2000, 105, 1353-1361. [Green Version]

29. Storm, T.; Emma, F.; Verroust, P.J.; Hertz, J.M.; Nielsen, R.; Christensen, E.I. A patient with cubilin deficiency. N. Engl. J. Med. 2011, 364, 89-91.

30. Leheste, J.R.; Rolinski, B.; Vorum, H.; Hilpert, J.; Nykjaer, A.; Jacobsen, C.; Aucouturier, P.; Moskaug, J.O.; Otto, A.; Christensen, E.I.; et al. Megalin knockout mice as an animal model of low molecular weight proteinuria. Am. J. Pathol. 1999, 155, 1361-1370.

31. Hvidberg, V.; Jacobsen, C.; Strong, R.K.; Cowland, J.B.; Moestrup, S.K.; Borregaard, N. The endocytic receptor megalin binds the iron transporting neutrophil-gelatinase-associated lipocalin with high affinity and mediates its cellular uptake. FEBS Lett. 2005, 579, 773-777.

32. Norden, A.G.; Lapsley, M.; Lee, P.J.; Pusey, C.D.; Scheinman, S.J.; Tam, F.W.; Thakker, R.V.; Unwin, R.J.; Wrong, O. Glomerular protein sieving and implications for renal failure in fanconi syndrome. Kidney Int. 2001, 60, 1885-1892.

33. Shaikh, Z.A. Metallothionein as a storage protein for cadmium: Its toxicological implications. Dev. Toxicol. Environ. Sci. 1982, 9, 69-76.

34. Liu, J.; Liu, Y.; Habeebu, S.S.; Klaassen, C.D. Susceptibility of mt-null mice to chronic cdcl2-induced nephrotoxicity indicates that renal injury is not mediated by the cdmt complex. Toxicol. Sci. 1998, 46, 197-203.

35. Cherian, M.G.; Shaikh, Z.A. Metabolism of intravenously injected cadmium-binding protein. Biochem. Biophys. Res. Commun. 1975, 65, 863-869.

36. Cherian, M.G.; Goyer, R.A.; Delaquerriere-Richardson, L. Cadmium-metallothionein-induced nephropathy. Toxicol. Appl. Pharmacol. 1976, 38, 399-408.

37. Foulkes, E.C. Renal tubular transport of cadmium-metallothionein. Toxicol. Appl. Pharmacol. 1978, 45, 505-512.

38. Bernard, A.M.; Ouled Amor, A.; Lauwerys, R.R. The effects of low doses of cadmium-metallothionein on the renal uptake of beta 2-microglobulin in rats. Toxicol. Appl. Pharmacol. 1987, 87, 440-445.

39. Tang, W.; Shaikh, Z.A. Renal cortical mitochondrial dysfunction upon cadmium metallothionein administration to sprague-dawley rats. J. Toxicol. Environ. Health A 2001, 63, 221-235.

40. Liu, J.; Habeebu, S.S.; Liu, Y.; Klaassen, C.D. Acute cdmt injection is not a good model to study chronic cd nephropathy: Comparison of chronic cdcl2 and cdmt exposure with acute cdmt injection in rats. Toxicol. Appl. Pharmacol. 1998, 153, 48-58.

41. Cain, K.; Griffiths, B. Transfer of liver cadmium to the kidney after aflatoxin induced liver damage. Biochem. Pharmacol. 1980, 29, 1852-1855.

42. Tanaka, K.; Nomura, H.; Onosaka, S.; Min, K. Release of hepatic cadmium by carbon tetrachloride treatment. Toxicol. Appl. Pharmacol. 1981, 59, 535-539.

43. Tanaka, K. Effects of hepatic disorder on the fate of cadmium in rats. Dev. Toxicol. Environ. Sci. 1982, 9, 237-249.

44. Chan, H.M.; Zhu, L.F.; Zhong, R.; Grant, D.; Goyer, R.A.; Cherian, M.G. Nephrotoxicity in rats following liver transplantation from cadmium-exposed rats. Toxicol. Appl. Pharmacol. 1993, 123, 89-96.

45. Bernard, A.; Buchet, J.P.; Roels, H.; Masson, P.; Lauwerys, R. Renal excretion of proteins and enzymes in workers exposed to cadmium. Eur. J. Clin. Invest. 1979, 9, 11-22.

46. Bernard, A.; Viau, C.; Lauwerys, R. Renal handling of human beta 2-microglobulin in normal and cadmium-poisoned rats. Arch. Toxicol. 1983, 53, 49-57.

47. Prozialeck, W.C.; Edwards, J.R. Early biomarkers of cadmium exposure and nephrotoxicity. Biometals 2010, 23, 793-809.

48. Dickson, L.E.; Wagner, M.C.; Sandoval, R.M.; Molitoris, B.A. The proximal tubule and albuminuria: Really! J. Am. Soc. Nephrol. 2014, 25, 443-453.

49. Norden, A.G.; Sharratt, P.; Cutillas, P.R.; Cramer, R.; Gardner, S.C.; Unwin, R.J. Quantitative amino acid and proteomic analysis: Very low excretion of polypeptides >750 da in normal urine. Kidney Int. 2004, 66, 1994-2003.

50. Torra, M.; To-Figueras, J.; Brunet, M.; Rodamilans, M.; Corbella, J. Total and metallothionein-bound cadmium in the liver and the kidney of a population in barcelona (spain). Bull. Environ. Contam. Toxicol. 1994, 53, 509-515.

51. Yoshida, M.; Ohta, H.; Yamauchi, Y.; Seki, Y.; Sagi, M.; Yamazaki, K.; Sumi, Y. Age-dependent changes in metallothionein levels in liver and kidney of the japanese. Biol. Trace Elem. Res. 1998, 63, 167-175.

52. Garrett, S.H.; Sens, M.A.; Todd, J.H.; Somji, S.; Sens, D.A. Expression of mt-3 protein in the human kidney. Toxicol. Lett. 1999, 105, 207-214.

53. Nagamine, T.; Nakazato, K.; Suzuki, K.; Kusakabe, T.; Sakai, T.; Oikawa, M.; Satoh, T.; Kamiya, T.; Arakawa, K. Analysis of tissue cadmium distribution in chronic cadmium-exposed mice using in-air micro-pixe. Biol. Trace Elem. Res. 2007, 117, 115-126.

54. Wang, L.; Chen, D.; Wang, H.; Liu, Z. Effects of lead and/or cadmium on the expression of metallothionein in the kidney of rats. Biol. Trace Elem. Res. 2009, 129, 190-199.

55. Langelueddecke, C.; Roussa, E.; Fenton, R.A.; Wolff, N.A.; Lee, W.K.; Thévenod, F. Lipocalin-2 (24p3/neutrophil gelatinase-associated lipocalin (ngal)) receptor is expressed in distal nephron and mediates protein endocytosis. J. Biol. Chem. 2012, 287, 159-169.

56. Smith, H.W. The fate of sodium and water in the renal tubules. Bull. N. Y. Acad. Med. 1959, 35, 293-316.

57. Ullrich, K.J. Niere. In Kurzgefaßtes Lehrbuch der Physiologie; Keidel, W.D., Ed.; Georg Thieme Verlag: Stuttgart, Germany, 1975.

58. Girolami, J.P.; Bascands, J.L.; Pecher, C.; Cabos, G.; Moatti, J.P.; Mercier, J.F.; Haguenoer, J.M.; Manuel, Y. Renal kallikrein excretion as a distal nephrotoxicity marker during cadmium exposure in rats. Toxicology 1989, 55, 117-129.

59. Oner, G.; Senturk, U.K.; Izgut-Uysal, N. The role of cadmium in the peroxidative response of kidney to stress. Biol. Trace Elem. Res. 1995, 48, 111-117.

60. Lauwerys, R.; Bernard, A. Preclinical detection of nephrotoxicity: Description of the tests and appraisal of their health significance. Toxicol. Lett. 1989, 46, 13-29.

61. Lee, W.K.; Bork, U.; Gholamrezaei, F.; Thévenod, F. Cd(2+)-induced cytochrome c release in apoptotic proximal tubule cells: Role of mitochondrial permeability transition pore and ca(2+) uniporter. Am. J. Physiol. Renal Physiol. 2005, 288, F27-F39.

62. Erfurt, C.; Roussa, E.; Thevenod, F. Apoptosis by cd2+ or cdmt in proximal tubule cells: Different uptake routes and permissive role of endo/lysosomal cdmt uptake. Am. J. Physiol. Cell Physiol. 2003, 285, C1367-C1376.

63. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402-408.

64. Prabakaran, T.; Christensen, E.I.; Nielsen, R.; Verroust, P.J. Cubilin is expressed in rat and human glomerular podocytes. Nephrol. Dial. Transplant. 2012, 27, 3156-3159. [Green Version]

65. Abramoff, M.D.; Magalhães, P.J.; Ram, S.J. Image processing with imagej. Biophotonics Int. 2004, 11, 36-42.