Inhibitor of DNA binding‐1 (Id‐1) is a carcinogenic gene that has been increasingly researched in recent years. This gene can promote cell proliferation, induce the generation of blood vessel endothelia with tumors, and promote tumor growth and invasion. Its overexpression is closely correlated to the occurrence, development, and prognoses of many malignant tumors such as lung cancer, gastric cancer, pancreatic cancer, and cervical cancer. A previous study has suggested that the overexpression of Id‐1 is closely correlated to occurrence and development of colorectal cancer. However, there are no detailed reports on its corresponding proliferation in vitro and invasion experiments. In the present study, an interference sequence of Id‐1 was introduced into SW480 and HT‐29 colon cancer cells to determine changes in its proliferation and metastasis abilities in vitro before and after the gene was interfered, in order to explore the effect of inhibitor of DNA binding‐1 (Id‐1) on the proliferation and migration of human colon carcinoma cell line SW480 and HT‐29.
Human SW480 and HT‐29 colon cancer cells were stored at the Scientific Research Center of North University (Taiyuan, China). The monoclonal first antibody of Id‐1 was purchased from Millipore (Boston, MA). The multiclonal first antibody of GAPDH was purchased from Santa Cruz (Shanghai, China). The general RNA extraction reagent and RIPA reagent were purchased from Solarbio (Beijing, China). The distinctive siRNA of Id‐1 and the primer were designed and synthesized by Sangon Biotech. The PCR kit was purchased from Promega (Madison, WI). The sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS‐PAGE) standard indicator and reverse transcription kit were purchased from Fermentas (Shanghai, China). The enhanced chemiluminescence (ECL) reagent was purchased from Pierce (Shanghai, China). The Transwell chamber was purchased from Costar (Suzhou, China). The Matrigel was purchased from BD (Shanghai, China).
SW480 and HT‐29 cells transfected with Id‐1‐interference sequence were assigned to the experimental groups (inhibition groups 1 and 2), and SW480 and HT‐29 cells with blank interference sequence (blank groups) and blank load transfection (blank load groups) were assigned as the control groups. The monoclonal first antibody of Id‐1 was purchased from Millipore (Boston, MA).
SW480 and HT‐29 cells were normally cultivated in RPMI‐1640 medium (10% fetal calf serum, 100 μg/mL of streptomycin, and 100 U/mL of penicillin), and proliferated by 0.25% trypsin. Cells in the logarithmic phase were selected. In our study, about 2 weeks were needed for Id‐1‐interference sequence coculture (or transfection) with cancer cell before harvest for mRNA expression, protein expression, and cell proliferation study.
One day before transfection, 2.5 × 105 cells/well were inoculated in a six‐well culture plate. Cells were divided into two groups according to cell line, and each cell line group was further divided into three groups: SW480 cell line (inhibition group 1, blank group 1, and blank load group 1) and HT‐29 cell line (inhibition group 2, blank group 2, and blank load group 2). Transfection procedures were performed according to instructions for the Lipofectamine 2000.
Extraction was performed to determine the overall concentration of RNA. The forward primer was designed as 5′‐CTGAGGCACTGGCGAGGAGA‐3′, while the reverse primer was designed as 5′‐ACCACCCTGTTGCTGTAGCC‐3′. The reaction system was as follows: PCR buffer × 1, 0.2 mmol/L of dNTP, 200 ng of cDNA template, 1.25 U of Taq, 0.4 mol/L of random primer concentration, 1 μL of ribozyme inhibitor, and 25 μL of the total reaction volume. Next, proliferation was carried out according to the instructions of the kit: 1 μL of DNA was used as the template and deionized water was used as the negative blank template; the proliferation condition was 95°C initial denaturation for 2 minutes; 95°C for 10 seconds, annealing temperature for 15 seconds, 72°C extended for 45 seconds, a total of 35 cycles were performed; finally, 72°C extended for 10 minutes. The corresponding software (ABI 7500) was used to quantitatively determine the density. Results were obtained in ultraviolet rays, and Id‐1/GAPDH was used for quantitative determination.
Total protein was extracted from the RIPA lysate to determine the quantity. Then, 50 μg of protein was placed in 5× buffer (4:1), a 100°C water bath was performed three times for 5 minutes each time, SDS‐PAGE was conducted, and protein was transferred onto a polyvinylidene fluoride (PVDF) membrane. The PVDF was removed, and 5% skimmed milk powder was added. The confining liquid was discarded, the specific primary antibody was added (Id‐1, 1:1500; GAPDH, 1:150), and incubated at −4°C overnight. Then, Tris‐Buffered Saline and Tween 20 (TBST) was added three times in 10 minutes, the specific secondary antibody was added (1:1500), incubated at 37°C for 1 hour. Next, TBST was added again three times in 10 minutes. ECL was adopted to detect bands, and Id‐1/GAPDH was used for quantitative determination.
Cells in the logarithmic phase were normally digested and inoculated in 96‐well plate at 1 × 104 cells/well (200 μL/well). Duplicate wells were set. Cells were inoculated in the medium at 37°C with 5% CO2. Cell lines were surveyed in three duplicate wells with three random types of cells daily. Then, 20 μL of MTT (5 g/L) was added into every well. Cells were cultivated for another 4 hours. The supernatant was discarded, and 150 μL of dimethyl sulfoxide was added into each well. Cells were shaken for 10 minutes for complete crystallization. The optical density of 492 nm (OD value) was surveyed using the enzyme‐linked immunosorbent assay meter for the successive 7 days. Then, the growth curves for SW480 and HT‐29 cells were drawn.
Three groups of cells in the logarithmic phase were normally digested and washed by RPMI 1640 medium without fetal calf serum for cell suspension. Three groups of 200‐μL cell suspensions were added into the upper chamber of the Transwell chamber, and 600 μL of the aforesaid medium was added into the lower chamber, and cells were cultivated for 24 hours. The Transwell chamber was taken out, and the remaining cells were wiped using a cotton swab. Hematoxylin and eosin staining was carried out, and the number of cells that passed through the membrane as migrating cells was counted. The Matrigel matrix was laid on the polycarbonate membrane of the upper Transwell chamber. The rest of the procedures were the same as those aforementioned. The number of cells that passed through Matrigel matrix was used to evaluate the invasion ability of cells. These were observed under a microscope.
SPSS 17.0 statistics software was used, and measurement data were presented as mean ± SD. Single‐factor analysis of variance was adopted for comparison among many groups. Dunnett's t‐test was adopted for comparisons between two groups. P < 0.05 was considered statistically significant.
In the inhibition group 1, the mRNA expression level of Id‐1 (0.14 ± 0.02) was significantly lower than that in the blank group 1 (1.27 ± 0.03) and blank load group 1 (1.25 ± 0.06) (P < 0.01), the protein expression level of Id‐1 (0.25 ± 0.02) was significantly lower than in the blank group 1 (1.18 ± 0.03) and blank load group 1 (1.16 ± 0.04) (P < 0.01). In the inhibition group 2, the mRNA expression level of Id‐1 (0.18 ± 0.01) was significantly lower than that in the blank group 2 (1.29 ± 0.02) and blank load group 2 (1.28 ± 0.02) (P < 0.01) (Figure ), the protein expression level of Id‐1 (0.21 ± 0.03) was significantly lower than that in the blank group 2 (0.99 ± 0.04) and blank load group 2 (1.11 ± 0.02) (P < 0.01) (Figure ).”
The OD values of the SW480 and HT‐29 cell lines did not significantly differ, and the growth curves basically overlapped after cultivation for the successive 1 or 2 days. From the third day, proliferation began to decrease in the inhibition groups. From the fourth day, inhibition of growth in the inhibition groups was obvious, and the OD value significantly decreased, compared to the blank groups and blank load groups. The growth curves of cells in corresponding blank groups and blank load groups were basically close to each other, and there was not much difference in proliferation ability, as shown in Table , Figures and .
Migration and invasion experiment of all groups| Group | Number of migrating cells (n) | Number of invading cells (n) |
| Blank group 1 | 201 ± 12 | 121 ± 17 |
| Blank load group 1 | 206 ± 15 | 126 ± 14 |
| Inhibition group 1 | 75 ± 12a | 51 ± 10a |
| Blank group 2 | 204 ± 11 | 124 ± 15 |
| Blank load group 2 | 207 ± 13 | 128 ± 11 |
| Inhibition group 2 | 70 ± 13a | 47 ± 11a |
The Transwell chamber migration and Matrigel invasion experiments revealed that the number of cells that passed through the membrane/matrix in the two inhibition groups significantly decreased compared to the corresponding blank groups and blank load groups (P < 0.001). Furthermore, there was no significant difference in the number of cells that passed through the membrane/matrix between the blank groups and blank load groups (P > 0.001), as shown in Figure .
Id‐1 is one of the important members of the protein family of helix‐loop‐helix. It does not express or its expression is little in normal tissues, while it has a significant expression in malignant tumors and tumor cell lines in vitro. Through its specific binding with transcription factor of helix‐loop‐helix, Id‐1 inhibits its binding with target DNA and reversely activates corresponding target genes to regulate cell proliferation. Early studies have found that the functions of Id‐1 mainly manifested in regulation toward the differentiation of myocytes. However, in recent years, the overexpression of Id‐1 in more than 20 types of cancer cells has proven the conclusion that it can cause cancer in tissues of many types of cells.
Cell proliferation is realized mainly through cell division, of which the cycle is regulated by many factors. The regulation of Rb protein plays an important role in the cycle of cell division. Phosphorylated Rb protein is dissociated with E2F, while the dissociated E2F can induce tumor cells to enter the process of proliferation. Studies have shown that the overexpression of Id‐1 is beneficial for the proliferation of various types of tumor cells, and its mechanism is mainly to regulate the activity of Rb protein through different kinds of signaling pathways. A study conducted by Lee et al reported that the positive expression regulation of Id‐1 can be combined with Ets and inhibit the activity of P16INK4ɑ, while the latter can promote the phosphorylation of Rb protein. Id‐1 can also form heterodimers to inhibit E2A from activating p21 through specific binding with E2A, while the latter can activate CDK2 to phosphorylate Rb protein and guarantee the successful procession of the G1/S phase. In addition, it has been found in bone cell cancer that Id‐1 activates cell growth and promotes cell proliferation by activating the MAPK of Raf‐1. Furthermore, it has been found in gastric cancer and pancreatic cancer cells that the Id‐reverse target‐nuclear factor κB (NF‐κB) pathway is activated to promote the expression of Bcl‐2, inhibit the TNF‐ɑ pathway, decrease the expression level of caspase‐3, and inhibit tumor cell death. In this present study, an interference sequence of Id‐1 was introduced into SW480 and HT‐29 colon cancer cells, and it was found through MTT detection that proliferation began to decrease in the inhibition groups from the third day, and the growth inhibition in the inhibition groups was obvious from the fourth day. This reveals that the proliferation ability of cells significantly decreased in the inhibition groups, proving that Id‐1 can promote colon cancer cell proliferation.
The biological behaviors of malignant tumors are correlated to the invasion and metastasis of tumors, which are mainly in three modes: direct invasion, lymph node, and hematogenous metastasis. The process of direct invasion includes the decrease of adhesion of tumor cells and the degradation of the basement membrane and extracellular matrix. Previous studies on this aspect have proven that through promoting the expression of genes such MMP‐2 and MMP‐9, Id‐1 can promote damage to structures of the basement membrane and accelerate the infiltration of tumors in colorectal cancer tissues. Furthermore, Id‐1 can induce the proliferation of endothelial cells in blood vessels and promote the formation of blood capillaries and lymphatic microvessels through increasing expression of vascular endothelial growth factor (VEGF), providing the necessary material foundation for the infiltration and metastasis of tumors. The results of the Transwell chamber and Matrigel experiments revealed that the migration and invasion abilities of SW480 and HT‐29 human colonic cancer cells with the interfering sequence of Id‐1 were significantly lower than that in the blank groups and blank load groups, proving that the overexpression of Id‐1 could promote the invasion and metastasis of tumors. In addition, it was also found in studies on cell lines of prostate cancer that Id‐1 could regulate the expression of MMP‐9, increase the expression of VEGF through inducing the transcription of growth factors of endothelia of blood vessels, and activate the secretion of MMP‐9; promoting the formation and metastasis of the blood capillaries of tumors, which supports conclusions of this experiment. According to our study, the inhibition of Id‐1 and decreased number of cells were associated with each other. Maybe both the inhibition of Id‐1 and decreased number of cells play a role in the decreased migration and invasion abilities. The specific association still needs further research.
In summary, Id‐1 promotes the proliferation and metastasis of SW480 and HT‐29 human colonic cancer cells, but its concrete mechanism requires further research, which is our main research orientation in the future.
We would like to acknowledge the helpful comments on this paper received from our reviewers.
All authors declare no conflict of interest.
© 2019. This work is published under http://creativecommons.org/licenses/by-nc-nd/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.