This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Polycystic ovary syndrome (PCOS), first identified in 1935 by Stein and Leventhal, is a female endocrine disorder characterized by hyperandrogenism, ovulatory dysfunction, and polycystic ovarian morphology that affects 17.8% of women of reproductive age [1–3]. PCOS causes a series of major systemic complications, including infertility, obesity, glucose metabolic disorders, cardiovascular disease, and body-mind problems, which impair female health [4–6]. Among these complications, infertility is one of the most challenging problems for reproductive women, accounting for 80% of anovulatory infertility cases in women with PCOS [7]. The etiology of PCOS remains unclear. Follicular growth is disrupted as a result of ovarian hyperandrogenism and distorted intraovarian paracrine signaling in women with PCOS, which makes follicle arrest at secondary follicle stage, and the size of follicles stays in the range of 2-9 mm [8]. The follicular microenvironment plays a crucial role in folliculogenesis. During folliculogenesis, oocytes receive important signaling and nutrition only through communication with the cumulus cells around them. Through this communication, oocytes and cumulus cells complete folliculogenesis, oocyte maturation, and ovulation [9–12]. Therefore, microcommunication plays a critical role in oocyte maturation.
Gap junctional intercellular communication (GJIC) has been reported to participate in many normal physiological and pathological processes. Gap junctions (GJs) are essential channels linking adjacent cells and allow for the exchange of molecules, nutrients, and signaling molecules between cells [13, 14]. GJs encoded by connexins (Cxs) are a family of approximately 20 proteins that form gap junction channels that allow intercellular communication [15, 16]. GJA1, also called connexin 43 (Cx 43), was documented to play a crucial role in forming communication channels that couple developing follicles to cumulus cells, assisting in communication between cumulus cells and oocytes. Studies have reported that folliculogenesis was arrested when GJA1 was knocked out in the mouse ovary, and the follicles stayed in the primary stage and developed incompetent oocytes [17]. And inhibiting expression level of GJA1 in granulosa cells in rats can cause inhibition of progesterone production [18]. With GJA1, oocytes obtain nutrients, ions, and signals from somatic cells around them to support oocyte maturation, regulate pH, and maintain meiotic arrest [19, 20].
However, no studies have identified a role for GJA1 in oocytes and cumulus cells in follicles of women with PCOS. Our previous study showed that GJA1 was significantly differentially expressed between human oocytes with without PCOS [21]. In our study, we found that GJA1 expression was lower in PCOS oocytes at the GV stage than in healthy oocytes through single-cell RNA sequencing. To investigate the importance of GJA1 in the folliculogenesis arrest in PCOS, we further studied GJA1 in oocytes from women with PCOS.
2. Materials and Methods
2.1. Study Population
We recruited 16 women, including 8 women with PCOS and 8 without PCOS. All participants were undergoing assisted reproductive technology (ART) at Anhui First People’s Hospital in Anhui, China, and were willing to donate oocytes. The study protocol was approved by the Research Ethics Committee of Anhui First People’s Hospital (No. 2014008) and conducted in accordance with approved institutional guidelines. All participants gave written informed consent. PCOS patients were confirmed to have at least two of the three Rotterdam 2003 criteria for diagnosing PCOS: hyperandrogenism, oligoovulation and/or anovulation, and polycystic ovaries [22]. We excluded patients with Cushing’s syndrome, congenital adrenal hyperplasia, and androgen-secreting tumors. Participant demographic and clinical characteristics, such as age, BMI, and LH, FSH, estradiol (E2), and progesterone levels, were recorded (Table 1).
Table 1
Clinical characteristics and outcome of patients with and without PCOS.
| Non-PCOS ( |
PCOS ( |
||
|---|---|---|---|
| Age (year) | 0.7035 | ||
| BMI (kg/m2) | 0.7804 | ||
| AFC | >24.000 | <0.001 (0.000) | |
| FSH (mIU/mL) | 0.7820 | ||
| LH (mIU/mL) | <0.001 (0.000) | ||
| LH/FSH | <0.001 (0.000) | ||
| Insulin (IU) | 0.8541 | ||
| Testosterone (nmol/L) | <0.001 (0.000) | ||
| Androstenedione (nmol/L) | 0.1611 | ||
| SHBG (nmol/L) | 0.1177 |
BMI: body mass index; FSH: follicle-stimulating hormone; LH: luteinizing hormone, AFC: antral follicle; SHBG: sex hormone-binding globulin.
2.2. Isolation of Oocytes
Ovarian stimulation for all participants was carried out according to the standard protocol. Cumulus cell-oocyte complexes (COCs) were isolated via ultrasound-guided vaginal puncture and washed in phosphate-buffered saline (PBS). Oocytes were selected from COCs and categorized based on the oocyte maturation stage: GV (oocyte maturation arrested in the prophase of meiosis), MI (metaphase I, first meiotic metaphase), and MII (metaphase II, second meiotic metaphase). Oocytes were prepared for use in RNA-seq experiments, and the remaining samples were prepared for quantitative reverse-transcriptase polymerase chain reaction (qRT-PCR) and immunofluorescence.
2.3. RNA Extraction and Real-Time PCR
RNA was extracted from single oocytes and converted into cDNA according to the Smart-seq2 protocol [23]. RNA was isolated from single oocytes using oligo-Dt30VN primers and dNTPs at 72°C and then reverse transcribed into cDNA. After the first-strand reaction, cDNA was amplified and purified twice by using AMPure XP beads and 80% ethyl alcohol. Significantly differentially expressed genes were confirmed by qRT-PCR (quantitative reverse-transcriptase polymerase chain reaction) (208054, QIAGEN, Germany).
The sequences of the primers for GJA1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) used in this study are shown in Table 2. GAPDH was used to normalize the gene expression of GJA1. qRT-PCR was performed in a total reaction volume of 25 μL, including 1 μL cDNA (1 ng/μL), 10 μL 2x SYBR green PCR master mix, 0.1 μL QN ROX reference dye, 1 μL forward primer (10 mmol/L), 1 μL reverse primer (10 mmol/L), and 6.9 μL RNase-free water. The PCR initial activation was achieved by heating the samples to 95°C for 2 min, followed by a total of 40 cycles of denaturation at 95°C (5 s) and 60°C (30 s).
Table 2
Primers used for qRT-PCR.
| cDNA | Sense primer (5 |
Antisense primer (5 |
|---|---|---|
| GJA1 | CAATCTCTCATGTGCGCTTCT | GGCAACCTTGAGTTCTTCCTCT |
| GAPDH | ACCCGCCCTATCTCAACTACC | AGGACACCATAATGACAGCCT |
GJA1: Gap junction alpha 1 protein; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.
2.4. Immunofluorescence
Oocytes that were extracted from COCs were washed with PBS three times and then fixed for 10 min at room temperature in 4% paraformaldehyde. The oocytes were washed in 0.5% Triton-100 three times and treated with 0.5% Triton X-100 at room temperature for 40 min. Then, the oocytes were washed in 3% normal goat serum three times and blocked with 3% normal goat serum for 60 min. After that, the oocytes were washed once and then incubated with primary antibody (1 : 50 dilution, mouse anti-GJA1 monoclonal antibody) at 4°C overnight.
Then, the oocytes were washed with 3% normal goat serum three times. Subsequently, the oocytes were washed once and then incubated with goat anti-mouse immunoglobulin G fluorescein second antibody (1 : 100 dilution) for 1 h at room temperature. The oocytes were washed with 3% normal goat serum three times. After washing, the DNA in the cells was labeled with propidium iodide (PI) (1 : 2000 dilution) for 10 min. Finally, the oocytes were placed in a drop of 3% normal goat serum and observed under a fluorescence microscope.
2.5. Gene Expression Analysis and Statistics
Differential gene expression was considered significant if the adjusted
3. Results
3.1. Clinical and Biochemical Characteristics of Patients
The clinical characteristics of the 16 participants were analyzed and are shown in Table 1. There was no statistically significant difference in age or BMI, but patients with PCOS had increased LH (
3.2. qRT-PCR Analysis
We randomly selected 43 oocytes, which were divided into the GV, MI, and MII groups according to the oocyte maturation stage (Table 3). The qRT-PCR results showed higher gene expression of GJA1 in oocytes without PCOS at the GV stage compared with that of oocytes with PCOS, which corresponded to the results of single-cell RNA-seq in a previous article (Figure 1). However, there were no significant differences in gene expression at the MII stages between oocytes with or without PCOS.
Table 3
Numbers of oocyte at different stages analyzed by qRT-RNA and immunofluorescence.
| GV | MI | MII | Immunofluorescence | |
|---|---|---|---|---|
| Normal | 6 | 6 | 4 | 5 |
| PCOS | 6 | 7 | 4 | 5 |
GV: germinal vesicle, oocyte maturation arrested in the prophase of meiosis; MI: metaphase I, first meiotic metaphase; MII: metaphase II, second meiotic metaphase.
[figure omitted; refer to PDF]3.3. Immunofluorescence Analysis
To detect the expression pattern of GJA1 in oocytes, immunofluorescence analysis was performed (Figure 2). The results showed a positive fluorescence signal for GJA1 in oocytes both with and without PCOS at stage GV. Moreover, the expression level of GJA1 in oocytes from women with PCOS was much weaker compared with that of oocytes from women without PCOS.
[figures omitted; refer to PDF]
4. Discussion
In this study, we found that GJA1 was negatively expressed at both the gene and protein levels in oocytes with PCOS compared with non-PCOS oocytes, which was consistent with the outcomes of our previous study. These data suggest that GJA1 downregulation may be involved in folliculogenesis arrest in women with PCOS, which causes anovulatory infertility in these women. Androstenedione may play a role in the expression level of GJA1 both in rat polycystic ovary [18]. Our study also suggested that the gene expression of GJA1 was not different between oocytes from women with or without PCOS at the late stage of oogenesis after ART. This result indicates that ART may improve maturation capacity by regulating gap junctions.
Oocytes in follicles are tightly surrounded by cumulus cells and cannot directly obtain signals and nutrition from the microenvironment of the ovary. Therefore, cellular interaction between oocytes and somatic cells plays an indispensable role in oocyte growth and maturation and folliculogenesis [24–26]. One study showed that mice with disrupted GJs failed to undergo oocyte meiotic maturation and were infertile [17]. Gap junction intercellular interactions are maintained between somatic cells and oocytes during the early stage of oogenesis and are blocked by GJA1 phosphorylation when oocyte meiosis begins as the last stage [27, 28]. GJs provide nucleotides, amino acids, and energy substrates that the growing oocyte is unable to obtain itself from neighboring cells [29]. Several studies have suggested that deletion of Gja1 in granulose cells of mice prevents oocyte development [17, 30]. In addition, cumulus cells also help to maintain a stable intracellular pH in oocytes through gap junction channels, which is a fundamental homeostatic process for the survival and proliferation of oocytes [31]. Communication with granulosa cells also promotes chromatin structure remodeling during the final phase of bovine oocyte differentiation and acquisition of meiotic competence [32].
At the last stage of folliculogenesis, MAPK is stimulated by LH through the ERK-MAPK signaling pathway and promotes GJA1 phosphorylation [33]. With GJA1 phosphorylation, the gap junction is lost, which decreases the concentration of cGMP (cyclic guanosine monophosphate) in oocytes and promotes the process of meiosis [34–36]. cAMP (cyclic adenosine monophosphate), a second messenger, has been known to induce oocyte meiotic processes. cGMP inhibits the hydrolysis of cAMP in oocytes, and so a low concentration of cGMP induces the hydrolysis of cAMP, which promotes the meiotic process and oocyte maturation.
In conclusion, GJA1 may play a critical role in the development of oogenesis arrest in women with PCOS through all of the oogenesis processes, including oogenesis and oocyte maturation. Our study may provide a clue to determining the etiology of PCOS.
Authors’ Contributions
XZG and WJJ designed the study and analyzed the data from RNA-seq. LQW and ZJH performed the RT-PCR and immunofluorescence analysis. LQW, ZJH, and KL collected the COC samples. XQ and WJX organized the clinical data of participants. LQW and ZJH made the charts. All authors read and approved the final manuscript. Qiwei Liu and Liang Kong contributed equally to this work.
Acknowledgments
This study was supported by a grant from Beijing Obstetrics and Gynecology Hospital, Capital Medical University (FCYY201813).
[1] I. F. Stein, M. L. Leventhal, "Amenorrhea associated with bilateral polycystic ovaries," American Journal of Obstetrics and Gynecology, vol. 29 no. 2, pp. 181-191, DOI: 10.1016/S0002-9378(15)30642-6, 1935.
[2] A. Hosseinkhani, N. Asadi, M. Pasalar, M. M. Zarshenas, "Traditional Persian medicine and management of metabolic dysfunction in polycystic ovary syndrome," Journal of Traditional and Complementary Medicine, vol. 8 no. 1, pp. 17-23, DOI: 10.1016/j.jtcme.2017.04.006, 2018.
[3] U. Branavan, K. Muneeswaran, W. S. S. Wijesundera, A. Senanayake, N. V. Chandrasekharan, C. N. Wijeyaratne, "Association of Kiss1 and GPR54 gene polymorphisms with polycystic ovary syndrome among Sri Lankan women," BioMed Research International, vol. 2019,DOI: 10.1155/2019/6235680, 2019.
[4] M. Çetin, P. Tunçdemir, K. Karaman, S. Yel, E. Karaman, M. Özgökçe, A. U. Kömüroğlu, "Cardiovascular evaluation and serum paraoxonase-1 levels in adolescents with polycystic ovary syndrome," Journal of Obstetrics and Gynaecology, vol. 40 no. 1, pp. 90-95, DOI: 10.1080/01443615.2019.1604643, 2019.
[5] A. M. Moore, R. E. Campbell, "Polycystic ovary syndrome: understanding the role of the brain," Frontiers in Neuroendocrinology, vol. 46,DOI: 10.1016/j.yfrne.2017.05.002, 2017.
[6] S. Tantanavipas, O. Vallibhakara, A. Sobhonslidsuk, S. Phongkitkarun, S. A. Vallibhakara, K. Promson, A. Sophonsritsuk, "Abdominal obesity as a predictive factor of nonalcoholic fatty liver disease assessed by ultrasonography and transient elastography in polycystic ovary syndrome and healthy women," BioMed Research International, vol. 2019,DOI: 10.1155/2019/9047324, 2019.
[7] A. H. Balen, L. C. Morley, M. Misso, S. Franks, R. S. Legro, C. N. Wijeyaratne, E. Stener-Victorin, B. C. J. M. Fauser, R. J. Norman, H. Teede, "The management of anovulatory infertility in women with polycystic ovary syndrome: an analysis of the evidence to support the development of global WHO guidance," Human Reproduction Update, vol. 22 no. 6, pp. 687-708, DOI: 10.1093/humupd/dmw025, 2016.
[8] P. Pigny, E. Merlen, Y. Robert, C. Cortet-Rudelli, C. Decanter, S. Jonard, D. Dewailly, "Elevated serum level of anti-mullerian hormone in patients with polycystic ovary syndrome: relationship to the ovarian follicle excess and to the follicular arrest," The Journal of Clinical Endocrinology and Metabolism, vol. 88 no. 12, pp. 5957-5962, DOI: 10.1210/jc.2003-030727, 2003.
[9] S. Jonard, D. Dewailly, "The follicular excess in polycystic ovaries, due to intra-ovarian hyperandrogenism, may be the main culprit for the follicular arrest," Human Reproduction Update, vol. 10 no. 2, pp. 107-117, DOI: 10.1093/humupd/dmh010, 2004.
[10] D. Das, S. Arur, "Conserved insulin signaling in the regulation of oocyte growth, development, and maturation," Molecular Reproduction and Development, vol. 84 no. 6, pp. 444-459, DOI: 10.1002/mrd.22806, 2017.
[11] D. Panidis, K. Tziomalos, E. Papadakis, E. Kandaraki, I. Katsikis, "The guidelines issued by the European Society for Human Reproduction and Embryology and the American Society for Reproductive Medicine regarding the induction of ovulation with metformin in patients with the polycystic ovary syndrome potentially require reconsideration," Hormones, vol. 12 no. 2, pp. 192-200, DOI: 10.14310/horm.2002.1403, 2013.
[12] B. Chermula, M. Brazert, D. Izycki, S. Ciesiolka, W. Kranc, P. Celichowski, K. Ozegowska, M. J. Nawrocki, M. Jankowski, M. Jeseta, P. Antosik, D. Bukowska, M. T. Skowronski, K. P. Brussow, M. Bruska, L. Pawelczyk, M. Zabel, M. Nowicki, B. Kempisty, "New gene markers of angiogenesis and blood vessels development in porcine ovarian granulosa cells during short-term primary culture in vitro," BioMed Research International, vol. 2019,DOI: 10.1155/2019/6545210, 2019.
[13] W. Nimlamool, R. M. Andrews, M. M. Falk, "Connexin43 phosphorylation by PKC and MAPK signals VEGF-mediated gap junction internalization," Molecular Biology of the Cell, vol. 26 no. 15, pp. 2755-2768, DOI: 10.1091/mbc.E14-06-1105, 2015.
[14] A. L. Harris, "Connexin channel permeability to cytoplasmic molecules," Progress in Biophysics and Molecular Biology, vol. 94 no. 1-2, pp. 120-143, DOI: 10.1016/j.pbiomolbio.2007.03.011, 2007.
[15] H. Cai, B. Liu, T. Yang, Y. Yang, J. Xu, Z. Wei, G. Deng, G. Ning, J. Li, J. Wen, W. Liu, Z. Ni, Y. Ma, M. Zhang, B. Zhou, G. Xia, H. Ouyang, C. Wang, "Involvement of PKC ε in FSH-induced connexin43 phosphorylation and oocyte maturation in mouse," Biology Open, vol. 7 no. 8,DOI: 10.1242/bio.034678, 2018.
[16] E. Winterhager, G. M. Kidder, "Gap junction connexins in female reproductive organs: implications for women's reproductive health," Human Reproduction Update, vol. 21 no. 3, pp. 340-352, DOI: 10.1093/humupd/dmv007, 2015.
[17] C. L. Ackert, J. E. I. Gittens, M. J. O'Brien, J. J. Eppig, G. M. Kidder, "Intercellular communication via connexin43 gap junctions is required for ovarian folliculogenesis in the mouse," Developmental Biology, vol. 233 no. 2, pp. 258-270, DOI: 10.1006/dbio.2001.0216, 2001.
[18] R. Talhouk, C. Tarraf, L. Kobrossy, A. Shaito, S. Bazzi, D. Bazzoun, M. El-Sabban, "Modulation of Cx43 and gap Junctional intercellular communication by androstenedione in rat polycystic ovary and granulosa cells in vitro," Journal of Reproduction & Infertility, vol. 13 no. 1, pp. 21-32, 2012.
[19] M. Zhang, Y. Q. Su, K. Sugiura, G. Xia, J. J. Eppig, "Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes," Science, vol. 330 no. 6002, pp. 366-369, DOI: 10.1126/science.1193573, 2010.
[20] L. M. Mehlmann, "Stops and starts in mammalian oocytes: recent advances in understanding the regulation of meiotic arrest and oocyte maturation," Reproduction, vol. 130 no. 6, pp. 791-799, DOI: 10.1530/rep.1.00793, 2005.
[21] Q. Liu, Y. Li, Y. Feng, C. Liu, J. Ma, Y. Li, H. Xiang, Y. Ji, Y. Cao, X. Tong, Z. Xue, "Single-cell analysis of differences in transcriptomic profiles of oocytes and cumulus cells at GV, MI, MII stages from PCOS patients," Scientific Reports, vol. 6,DOI: 10.1038/srep39638, 2016.
[22] The Rotterdam ESHRE/ASRM-sponsored PCOS consensus workshop group, "Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome (PCOS)," Human Reproduction, vol. 19 no. 1, pp. 41-47, DOI: 10.1093/humrep/deh098, 2004.
[23] S. Picelli, O. R. Faridani, A. K. Bjorklund, G. Winberg, S. Sagasser, R. Sandberg, "Full-length RNA-seq from single cells using smart-seq2," Nature Protocols, vol. 9 no. 1, pp. 171-181, DOI: 10.1038/nprot.2014.006, 2014.
[24] G. M. Kidder, A. A. Mhawi, "Gap junctions and ovarian folliculogenesis," Reproduction, vol. 123 no. 5, pp. 613-620, DOI: 10.1530/rep.0.1230613, 2002.
[25] E. Gershon, V. Plaks, N. Dekel, "Gap junctions in the ovary: expression, localization and function," Molecular and Cellular Endocrinology, vol. 282 no. 1-2, pp. 18-25, DOI: 10.1016/j.mce.2007.11.001, 2008.
[26] X. Zhao, F. du, X. Liu, Q. Ruan, Z. Wu, C. Lei, Y. Deng, C. Luo, J. Jiang, D. Shi, F. Lu, "Brain-derived neurotrophic factor (BDNF) is expressed in buffalo ( Bubalus bubalis ) ovarian follicles and promotes oocyte maturation and early embryonic development," Theriogenology, vol. 130, pp. 79-88, DOI: 10.1016/j.theriogenology.2019.02.020, 2019.
[27] H. Zhang, Q. Wei, Z. Gao, C. Ma, Z. Yang, H. Zhao, C. Liu, J. Liu, X. Zhao, B. Ma, "G protein-coupled receptor 30 mediates meiosis resumption and gap junction communications downregulation in goat cumulus-oocyte complexes by 17 β -estradiol," The Journal of Steroid Biochemistry and Molecular Biology, vol. 187, pp. 58-67, DOI: 10.1016/j.jsbmb.2018.11.001, 2019.
[28] C. M. H. Combelles, M. J. Carabatsos, T. R. Kumar, M. M. Matzuk, D. F. Albertini, "Hormonal control of somatic cell oocyte interactions during ovarian follicle development," Molecular Reproduction and Development, vol. 69 no. 3, pp. 347-355, DOI: 10.1002/mrd.20128, 2004.
[29] H. E. Corbett, C. D. Dubé, S. Slow, M. Lever, J. M. Trasler, J. M. Baltz, "Uptake of betaine into mouse cumulus-oocyte complexes via the SLC7A6 isoform of y+L transporter," Biology of Reproduction, vol. 90 no. 4,DOI: 10.1095/biolreprod.113.116939, 2014.
[30] J. E. Gittens, G. M. Kidder, "Differential contributions of connexin37 and connexin43 to oogenesis revealed in chimeric reaggregated mouse ovaries," Journal of Cell Science, vol. 118, pp. 5071-5078, DOI: 10.1242/jcs.02624, 2005.
[31] G. FitzHarris, J. M. Baltz, "Regulation of intracellular pH during oocyte growth and maturation in mammals," Reproduction, vol. 138 no. 4, pp. 619-627, DOI: 10.1530/REP-09-0112, 2009.
[32] V. Lodde, F. Franciosi, I. Tessaro, S. C. Modina, A. M. Luciano, "Role of gap junction-mediated communications in regulating large-scale chromatin configuration remodeling and embryonic developmental competence acquisition in fully grown bovine oocyte," Journal of Assisted Reproduction and Genetics, vol. 30 no. 9, pp. 1219-1226, DOI: 10.1007/s10815-013-0061-7, 2013.
[33] M. R. Maduro, "The signaling pathways guiding PCOS," Reproductive Sciences, vol. 25 no. 7, pp. 965-966, DOI: 10.1177/1933719118781469, 2018.
[34] J. Y. Park, Y. Q. Su, M. Ariga, E. Law, S. L. Jin, M. Conti, "EGF-like growth factors as mediators of LH action in the ovulatory follicle," Science, vol. 303 no. 5658, pp. 682-684, DOI: 10.1126/science.1092463, 2004.
[35] R. Prochazka, M. Blaha, L. Němcová, "Significance of epidermal growth factor receptor signaling for acquisition of meiotic and developmental competence in mammalian oocytes," Biology of Reproduction, vol. 97 no. 4, pp. 537-549, DOI: 10.1093/biolre/iox112, 2017.
[36] T. Shinohara, Y. Ohta, N. Kawate, M. Takahashi, N. Sakagami, T. Inaba, H. Tamada, "Treatment with the MAPK kinase inhibitor U0126 during the first two hours of in vitro maturation improves bovine oocyte developmental competence," Reproduction in Domestic Animals, vol. 53 no. 1, pp. 270-273, DOI: 10.1111/rda.13096, 2018.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2020 Qiwei Liu et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. http://creativecommons.org/licenses/by/4.0/
Abstract
Polycystic ovary syndrome (PCOS) is a common female endocrine system disease that affects 17.8% of women of reproductive age and leads to infertility, obesity, glucose metabolic disorders, cardiovascular disease, and body-mind problems. However, the etiology of PCOS remains unclear. Follicular growth is disrupted as a result of ovarian hyperandrogenism and distorted intraovarian paracrine signaling in women with PCOS. Microcommunication between oocytes and cumulus cells plays a critical role in folliculogenesis. Gap junction alpha 1 (GJA1) plays a crucial role in the developing follicles by forming communication channels between cumulus cells and oocytes, but this has not yet been reported in women with PCOS. Therefore, we aimed to study the role of GJA1 in the microcommunication between oocytes and cumulus cells in women with PCOS. In our study, cumulus cell-oocyte complexes (COCs) from women were isolated via ultrasound-guided vaginal puncture, and oocytes were selected from COCs and categorized based on 3 oocyte maturation stages. Then, RT-qPCR and immunofluorescence analysis were performed to detect both the gene expression and protein of GJA1 in oocytes from women with and without PCOS. There was no statistically significant difference in age and BMI (body mass index), but patients with PCOS had a higher ratio of basic LH/FSH (luteinizing hormone/follicle-stimulating hormone), androstenedione, and total ovarian volume. The qRT-PCR results showed higher gene expression of GJA1 in oocytes without PCOS at the germinal vesicle (GV) stage compared with that of oocytes from women with PCOS. Immunofluorescence analysis showed that the expression level of GJA1 in oocytes from women with PCOS was very weak compared with that of oocytes from women without PCOS. In conclusion, GJA1 may play a critical role in the development of oogenesis arrest in women with PCOS throughout the oogenesis processes, including oogenesis and oocyte maturation.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Kong, Liang 1 ; Zhang, Junhui 2 ; Xu, Qian 1 ; Wang, Jingxue 1
; Xue, Zhigang 3
; Wang, Jinjuan 1
1 Department of Gynecological Minimal Invasive Center, Beijing Obstetrics and Gynecology Hospital, Capital Medical University, Beijing 100010, China
2 Anhui Province Key Laboratory of Reproductive Health and Genetics, Anhui Medical University, Hefei, 230032 Anhui, China
3 Translational Center for Stem Cell Research, Tongji Hospital, Department of Regenerative Medicine, Tongji University School of Medicine, Shanghai, China





