This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Duck enteritis virus (DEV) is a kind of enveloped, large DNA virus who belongs to α-herpesvirus. Most of the research about DEV mainly focus on etiology [1–8], pathogenesis [9–13], epidemiology, and diagnosis [14–23]. All of the waterfowls are apt to suffer from this disease which could cause considerable mortality and morbidity [24–26]. As a prevalent pathogen spreading in waterfowl, it causes acute fever and septic disease in some cases. But in the chronic cases, DEV contributes to latent infections in the TG (trigeminal ganglia) after establishing a primary infection. Using TG as a base, reactivation of the virus may lead to disease outbreaks [24]. In common with other members of α-herpesvirus family, DEV possesses the ability to establish latency in the sensory ganglia and lymphoid tissues [27]. The innate immune system plays an essential role in defending the host against viral infection. They could detect the presence of pathogens and initiate relevant mechanisms to eliminate potentially infectious threats. This protective process will occur following the intruding nucleic acid recognition initiated by germline-encoded molecules termed PRRs (pattern recognition receptors) [28, 29], which could trigger a range of signaling cascades and subsequent host gene activation [30]. PRRs recognize conserved features of viruses and other microorganisms. They were investigated and known as PAMPs (pathogen-associated molecular patterns), which include microbial nucleic acids, proteins, and carbohydrates. PAMPs own key molecular characteristics shared by classes of pathogens are usually absent from healthy cells [31].
In the case of double-stranded DNA viruses like DEV, the situation of immunization reacting is a little more complicated than those of RNA viruses, partly because their constitute elements are the same with host DNAs and the deficiency of triphosphorylated groups in their 5
Interferon type I and type II are important components of the host antiviral innate immune system which both induce ISG (IFN-stimulated gene) expression through JAK- (Janus kinase-) dependent phosphorylation of signal transducer and activator of transcription STAT1 and STAT2. They have strong and broad-spectrum antiviral effects, so they are also known as “antiviral interferon.” Among birds, interferons of chickens and ducks are the most studied [39, 40]. IFN-β, which belongs to the interferon type I family, is a primarily immunosuppressive factor to inhibit virus clearance during viral infection [41], whereby promoting the occurrence of chronic viral infection [42]. At the same time, IFN (interferon) has a strong inhibitory effect on a variety of viruses by inducing the synthesis of antiviral proteins or promoting the function of immune cells. Therefore, the ability of virus to escape or antagonize IFN reaction to a certain extent determines the fate of virus and host in the future. Almost all the viruses, both DNA virus and RNA virus, have developed multifarious strategies to interfere with the synthesis of IFNs or IFN receptor signaling pathway, including reducing the expression of type I IFN receptor mRNA, blocking the posttranslation modification, degrading the IFN receptor, and utilizing the virus bait protein to bind to type I interferon to prevent the receptor from recognizing interferon and inhibiting JAK/STAT signal, further regulating the antiviral function of ISG products [43, 44].
The characteristics of some genes from DEV had been reported [45–64]. However, the function of VP16 of duck enteritis virus encoded by the UL48 gene was hardly studied. In contrast to DEV, the function of another tegument protein VP16 from HSV-1 was well elucidated [65–68]. The transcriptional expression of IFN-β is regulated by the transcriptional enhancer bound to its promoter, which includes the regulatory region of IRF3/IRF7, AP-1 (activating protein 1), and the regulatory region of NF-κB. Intriguingly, in spite of IRF3 deficiency in chicken, poultries may employ IRF7 to reconstitute corresponding IFN signaling to respond to both DNA and RNA viral infections [69]. Therefore, in this study, for the first time we identified that VP16 could directly interact with duck IRF7 whereby the VP16 of DEV plays a vital role in antagonizing the innate immune system, assisting DEV virus to counteract this antiviral activity.
2. Materials and Methods
2.1. Virus, Cells, and Reagents
The DEV strain was provided by the Institute of Preventive Veterinary Medicine, Sichuan Agricultural University [70]. The virus titer was measured as the 50% tissue culture infective dose (TCID50) according to previously described methods [71]. Duck embryo fibroblasts (DEFs) used in this study were isolated from 10-day-old duck embryo. And the DEF was cultured in minimum essential medium (MEM) supplemented with 10% newborn calf serum (Gibco) and incubated at 37°C with 5% CO2 in an incubator. HEK 293T cells (ATCC) were grown in Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% fetal bovine serum (FBS) and incubated at 37°C in a 5% CO2 humidified cabinet the same as DEF. Poly (I:C) (pIC) and poly (dA:dT) were purchased from InvivoGen (San Diego, USA).
2.2. RNA Isolation and cDNA Preparation
Total RNA was isolated using RNAiso Plus Reagent (TaKaRa) according to the manufacturer’s instructions. Genomic DNA was then removed, and reverse transcription was performed using a PrimeScript™ RT Reagent Kit (Perfect Real Time, TaKaRa) according to the manufacturer’s instructions.
2.3. Plasmids
To construct pCAGGS-VP16-HA, pCAGGS-VP16 (aa1-200)-HA, pCAGGS-VP16 (aa1-390)-HA, and pCAGGS-duIRF1-Flag plasmids, DEV UL48 (GenBank: NC_013036) [72] and duck IRF1 (GenBank: NC_006127) sequences were amplified from cDNA extracted from DEV-infected DEFs with PCR primers (Table 1) and were integrated into the pCAGGS vector using a one-step cloning kit (Vazyme). Results and conclusion of sequence analysis demonstrated that recombinant plasmids have sequences in line with data from GenBank. pCAGGS-duIRF7-Flag, pCAGGS-duSTING-Flag, pCAGGS-duTBK1-Flag, pCAGGS-ducGAS-Flag, and duIFN-β-Luc were kindly provided by Chen. pRL-TK as internal control plasmid was purchased from Promega.
Table 1
Primers used in this research.
| Primers | Forward (5 | Reverse (5 |
|---|---|---|
| pCAGGS-UL48-HA | CATCATTTTGGCAAAGAATTCGCCACCATGGATACATTTGATGAACT | TACGCCAAGCTTGGGCTGCAGCTAAGCGTAATCTGGAACATCGTATGGGTAATTATCTGGCGAGAACAACG |
| pCAGGS-duIRF1-Flag | CATCATTTTGGCAAAGAATTCGCCACCATGCCCGTCTCCAGAATGCG | TACGCCAAGCTTGGGCTGCAGCTACTTATCGTCGTCATCCTTGTAATCTTACAAGCCACAGGAGATGG |
| duIFN-β (rt-qPCR) | TCTACAGAGCCTTGCCTGCAT | TGTCGGTGTCCAAAAGGATGT |
| duMx (rt-qPCR) | TGCTGTCCTTCATGACTTCG | GCTTTGCTGAGCCGATTAAC |
| duOASL (rt-qPCR) | TCTTCCTCAGCTGCTTCTCC | ACTTCGATGGACTCGCTGTT |
| duβ-actin (rt-qPCR) | GATCACAGCCCTGGCACC | CGGATTCATCATACTCCTGCTT |
| duIFN-β (rt-qPCR) | TCTACAGAGCCTTGCCTGCAT | TGTCGGTGTCCAAAAGGATGT |
| duMx (rt-qPCR) | TGCTGTCCTTCATGACTTCG | GCTTTGCTGAGCCGATTAAC |
| duOASL (rt-qPCR) | TCTTCCTCAGCTGCTTCTCC | ACTTCGATGGACTCGCTGTT |
2.4. Subcellular Localization
The procedure was performed as described previously with slight modification [73]. When the HEK293T cells seeded on coverslips grew into 90% confluence, plasmids pCAGGS-UL48-HA and pCAGGS-duIRF7-Flag were cotransfected using TransIn™ EL Transfection Reagent. 48 hours after transfection, discarding the cell culture and washing the cells with PBST (phosphate-buffered saline with Tween 20) three times, the cells were fixed in albumin in PBST for 24 hours at 4°C and incubated with rabbit-anti-HA or mouse-anti-Flag for 2 hours at 37°C. Following washing with PBST three times, the cells were then incubated with secondary antibodies, namely, Alexa Fluor 488 Goat anti-rabbit and Alexa Fluor 568 Goat anti-mouse, both of which diluted in PBST.
2.5. Western Blot, Coimmunoprecipitation
The procedure was performed as described previously with slight modification [74]. The DEV VP16 was expressed efficiently in duck embryo fibroblasts (DEFs) and human embryonic kidney (HEK) 293T cells. For western blot detection, cells were lysed in RIPA lysis buffer (Beyotime, China) with 1 mM phenyl methane sulfonyl fluoride (PMSF) for 40 minutes at around 4°C. Lysed cells were centrifuged at 14000 revolutions per minute (RPM) for 5 minutes and were combined with 10x sodium dodecyl sulfate (SDS) loading buffer, boiled for 10 minutes at 100°C, and separated by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Afterwards, the separated proteins were electroblotted onto polyvinylidene difluoride (PVDF) membranes (Millipore, USA) and subjected to immunoblotting with a primary antibody against Flag (CST, America), HA (CST, America), or VP16 (Sichuan Agricultural University), a secondary antibody against mouse or rabbit. For coimmunoprecipitation, protein of interest was well expressed in HEK293T cells and revolved as above. Before SDS-PAGE, we added corresponding primary antibody (MBL, America) up to 1 μg/μL, incubating in a 4°C refrigerator, fixing on a turntable for about 8 hours. Then, 1/10 volume of lysed cells of protein A+G (Beyotime, China) mingled in this processed cellular samples, incubating for another 5 hours at the same circumstance as above. After washing three times with phosphate-buffered saline (PBS) supplemented with Tween (PBST), the samples were boiled in 10x sodium dodecyl sulfate (SDS) loading buffer by SDS-PAGE.
2.6. Dual-Luciferase Reporter Assay
DEFs made from 10-day duck embryo were seeded in 24-well plates as described previously [74, 75]. Cells were cotransfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions with 500 ng/well of the specific expression plasmids or an empty vector together with 500 ng/well reporter plasmid IFN-β-Luc until cells grow into 70~80% density, as well as 50 ng/well of the pRL-TK as an internal control vector (Promega). At 24 h post transfection, cells were treated or not treated with 25 μg/mL poly (I:C) or poly (dA:dT). These cells were stimulated with poly (I:C) or poly (dA:dT) for over 24 h and harvested by phosphate-buffered saline (PBS). Firefly luciferase activity was measured by the dual-luciferase assay system (Promega) according to the manufacturer’s directions; then, corresponding data were processed by GraphPad Prism 7.00.
2.7. Real-Time Quantitative PCR
The procedure was performed as described previously with slight modification [76]. Briefly, total cellular RNA was extracted using RNAiso Plus Reagent (TaKaRa) according to the manufacturer’s instructions. Then, the RNA was reverse transcribed into cDNA by means of PrimeScript™ RT Reagent Kit. The threshold cycle (Ct) values were normalized to the housekeeping gene β-actin. The relative expression levels of IFN-β, Mx, and OASL were determined using β-actin as an endogenous control as well as comparative Ct (−2ΔΔin) method and a real-time thermocycler (CFX96 Bio-Rad, Hercules, CA, USA). Real-time qPCR primers were designed as Table 1.
2.8. Statistical Analysis
Student’s
3. Results
3.1. DEV Could Inhibit the Activation of Duck IFN-β Promoter through the cGAS-STING-Mediated DNA Sensing Pathway as well as at the IRF Level
To explore the effect of DEV infection on IFN-β production in vitro, DEFs (duck embryo fibroblasts) were inoculated with DEV (duck enteritis virus). They were infected with DEV for 4, 12, and 24 hours, respectively, and then duck IFN-β mRNA levels were analyzed by rt-qPCR (real-time quantitative PCR). The DEFs exhibited slight responses at 12 hours postinfection, while that became lower at 24 hours (Figure 1(a)). Therefore, we put forward a hypothesis that the DNA sensing pathway was able to recognize DEV, but the reaction may be suppressed during the later phase of DEV replication. In consideration of cGAS acting as the most effective cytosolic exogenous DNA sensing in most DNA viruses [77], I ventured a guess whether DEV is involved in the cGAS-STING-mediated pathway. By using Dual-Luciferase Reporter Gene System, I found that DEV could inhibit duck IFN-β promoter activity that was upregulated by ectopic expression of duck cGAS and STING (Figure 1(b)). In response to cellular stimulation, activation of IRF7 is achieved by phosphorylation of IRF7. Upon phosphorylation from TBK1 activated by STING, IRF7 dimerizes and translocates to the nuclei, acting as a transcription factor. The dipolymer complex of IRF7 can then bind to the IRF7 receptor sites within the IFN-β promoter region, eventually activating the transcription of the IFN-β gene [69]. Therefore, I verified whether DEV could inhibit IRF7-stimulated IFN-β promoter activity. The results showed that DEV was able to diminish IFN-β promoter activity at IRF7 level (Figure 1(c)).
[figures omitted; refer to PDF]
3.2. DEV VP16 Repressed Activation of duIFN-β and Interferon-Stimulated Genes (ISGs) Induced by Poly (I:C) or Poly (dA:dT)
To test whether DEV VP16 could repress activation of duIFN-β, rt-qPCR was performed to measure mRNA accumulation of duIFN-β, duMx, duOASL. As shown in Figures 2(a) and 2(c), the mRNA levels of duIFN-β, duMx, and duOASL induced by poly (I:C)—a double-stranded RNA (dsRNA) analog—were significantly higher than those transfected with pCAGGS-UL48-HA. Moreover, the mRNA levels of duMx and duOASL activated by poly (dA:dT)—a double-stranded DNA analog—were downregulated, too (Figure 2(d)). At the same time, the expression of VP16 was identified by western blot (Figure 2(e)). Additionally, VP16 inhibited IFN-β mRNA transcription in a dose-dependent manner (Figure 2(a)); the expression of VP16 protein was confirmed by western blot analysis (Figure 2(a)). The data from Dual-Luciferase Reporter Gene System also showed that ectopic expression of VP16 significantly inhibited poly (I:C)-induced activation of the IFN-β promoter (Figure 2(b)), similar to the results of rt-qPCR.
[figures omitted; refer to PDF]
3.3. DEV VP16 Could Inhibit cGAS-STING-Mediated Pathway at the IRF7 Level rather than IRF1
In order to identify where VP16 protein hinders IFN-β production during the cGAS-STING pathway, we utilized different stimuli to induce the IFN-β promoter activity in DEFs. In the past research, duck STING and IRF7 were confirmed to have the capacity to induce IFN-β production pathway [78, 79]. We overexpressed duck STING, cGAS, TBK1, IRF7, and IRF1 in DEFs and analyzed the activity of IFN-β promoter reporter in the presence of VP16 protein or not. As a result, ectopic expression of cGAS and STING significantly stimulated the IFN-β promoter activity in DEF while this activation was suppressed by the existence of VP16 (Figure 3(a)). Similarly, when we transfected the downstream immunologic factors including TBK1, IRF7, IFN-β promoter activity was upregulated and VP16 could also inhibit their activation ability for IFN-β promoter (Figures 3(b) and 3(c)). Interestingly, the duck IRF1 was able to activate IFN-β promoter activity as other counterparts did, but its function was not dampened by the overexpression of VP16 (Figure 3(d)). A sketch map of IFN-β pathway mediated by cGAS is shown (Figure 4).
[figures omitted; refer to PDF]
[figure omitted; refer to PDF]3.4. DEV VP16 Associated Directly with Duck IRF7 to Block the Activation of Duck IFN-β but Did Not Interact with Duck IRF1
The transcription of IFN-β can be dependent on the activation of IRF7 [78]. It may take the place of IRF3 in poultry to bind to distinct regulatory domains in the IFN-β promoter. To clarify what are the mechanisms when IFN-β is suppressed by DEV VP16 in vitro, contrasting the result of Figure 3(d) with the obvious inhibition result of IFN-β promoter activity induced by IRF7 (Figure 3(c)) promoted us to investigate the possibility of an interaction between these two proteins. HEK-293T cells were transfected with VP16-HA along with IRF7-Flag, and coimmunoprecipitation assay was performed with anti-hemagglutinin (anti-HA) and anti-Flag antibodies. We found that IRF7 protein was immunoprecipitated by VP16 (Figure 5(a)). To further verify the interaction between duck IRF7 and DEV VP16, we exerted immunofluorescence colocalization analysis, which revealed colocalization of IRF7 and VP16 proteins in HEK293T cells (Figure 5(b)). Meanwhile, the immunofluorescence subcellular colocalization analysis between IFR1 and VP16 revealed the IRF1 could not interact with VP16 in vitro (Figure 5(c)).
[figures omitted; refer to PDF]
3.5. The N-Terminal of VP16 Is Responsible for Inhibiting Poly (I:C)-Mediated Activation of duIFN-β Promoter
In order to further find the regions of VP16 that are involved in its inhibition in IFN-β pathway, we constructed a series of plasmids with truncated mutants of VP16, including VP16 (aa1-200), VP16 (aa1-390), VP16 (aa1-407), VP16 (aa110-407), and VP16 (aa110-475) (Figure 6(a)). In DEFs, stimulation of poly (I:C) significantly activated duIFN-β promoter, while overexpression of VP16-His blocked the IFN-β promoter’s activity, indicating that the presence of different small tags in the VP16 fusion proteins did not influence the inhibitory activity of VP16. At the same time, VP16 (aa1-200) and VP16 (aa1-407) proved to have the most effective inhibitory effect in IFN-β promoter, so that the functional region may retain within N-terminal. Intriguingly, our current results showed that the inhibitory effect of VP16 (aa1-390), VP16 (aa110-407), and VP16 (aa110-475) slightly weakened. Moreover, comparing VP16 (aa1-200) with VP16 (aa110-475) suggested that VP16 (aa1-200) is the most responsible truncated protein for inhibiting the IFN-β pathway. This phenomenon might relate to the transcription domain of VP16, howbeit we have not affirmed where the transcription domain is within the VP16 of DEV.
[figures omitted; refer to PDF]
4. Discussion
Various cell types can detect exogenous DNA like viral and synthetic dsDNA. In recent years, a growing number of cellular DNA sensors have been identified [37, 38, 80, 81], such as AIM2 (absent in melanoma 2), RNA polymerase III [82], IFI16 (IFN-γ-inducible protein 16) [83], cGAS (cyclic GMP-AMP synthase), and DAI/ZBP1 (DNA-dependent activator of IRFs/Z-DNA binding protein 1) [84]. Among these, cGAS has been considered to be a major cytosolic DNA sensor responding to DNA virus infection that induces an interferon response [77]. Albeit another nuclear DNA sensor IFI16 can also sense α-herpesvirus DNA in a way different from cGAS, followed by cellular innate immune responses, IFI16 is dispensable in activating the downstream STING/TBK-1/IRF3 pathway where cGAS playing an indispensable role is required in this signaling cascade [85]. In the immune system of poultry, RIG-1 (retinoic acid-inducible gene I) and IRF3 (IFN regulatory factor 3) are missing [86]. Interestingly, recent research concerning chicken IRF7 indicated that IRF7 took place of IRF3 in the cGAS-STING pathway [69]. Considering that HSV-1 VP16 plays an important role in immune suppression by binding to IRF3 and physically associating with CBP to dampen host antiviral signaling, therefore we venture to guess that DEV VP16 may suppress IFN-β activation at the IRF7 level [87]. In this research, our results reveal a novel role for DEV VP16 that it can overtly inhibit the IFN-β mRNA transcription induced by poly (I:C) or poly (dA:dT) and also dampen IFN-β promoter activity in DEF by directly binding to IRF7 followed by interruption of downstream antiviral signaling activation, thereby helping DEV retreat from IFN-β-mediated defense.
Duck enteritis virus is the kind of classic double-stranded DNA virus whose infections are usually lifelong and hard to eradicate. An efficient innate immune response against these viruses is critical, not only as the first line of host defense against viral infection but also for mounting more specific and robust adaptive immunity against the virus [88]. However, DNA virus has evolved multiple strategies to evade the host antiviral response for their infection and persistence. In the case of HSV-1, a well-studied α-herpesvirus, a repertoire of dozens of immunomodulatory viral proteins which interfere with antiviral signaling cascades has been identified, such as VP16 [87], ICP0 [89], VHS [90], Us11 [91], and ICP27 [92]. Among the immune evasion proteins of HSV-1, VP22 [93], VP24 [94], ICP27, VP11/12 [95], and UL24 [96] specially abrogate the type I IFN production through the cGAS-STING DNA sensing pathway. In the present study, we discovered that DEV is unable to stimulate strong type I IFN responses in vitro. At the same time, WT DEV stored in our laboratory could obviously suppress IFN-β promoter activity through the cGAS-STING pathway. Nevertheless, no research has reported whether the proteins of DEV could hinder type I IFN production. Here, in this research, for the first time we discovered that DEV tegument protein VP16 has a strong capacity to dampen the IFN-β activation through the cGAS-STING pathway. This tegument protein may take part in the lifelong chronic latent infection of ducks who are suffering from DEV.
IRF7 (IFN regulatory factor 7) highly homologous with IRF3 is strongly induced by type I IFN-mediated signaling, acting as one of the key transcription factors to induce type I IFN in a positive feedback loop [97]. TBK1 (TANK Binding Kinase 1) phosphorylates IRF7 in the cytoplasm, forming a homodimer which migrates into the nucleus where it activates the IFN-β promoter [98] (Figure 4). Therefore, a great variety of viral proteins targeting IRF7 directly or indirectly help viruses to hinder the host antiviral activity. KSHV (Kaposi’s sarcoma-associated herpesvirus) ORF45, for example, blocks phosphorylation and nuclear accumulation of IRF7 during viral infection [99]; EBV (Epstein-Barr virus) LF2, a tegument protein, interacts with the central inhibitory association domain of IRF7 to inhibit the dimerization of IRF7 [100]; HSV-1 (Herpes Simplex Virus type 1) ICP0 ring finger domain inhibits phosphorylation of IRF7 by targeting TBK1 and IKKε [89]. MDV (Marek’s disease virus) VP23 interacts with IRF7 competitively, disrupting the association between TBK1 and IRF7 [101]. In this study, we determined a novel role of DEV VP16 that it interacted with duck IRF7 but did not bind with IRF1, whereby dampening the following host antiviral activity.
In summary, for the first time, we demonstrate that DEV could succeed in escaping the cGAS-STNG-IRF7 signaling pathway in support of their long-time infection. What we can conclude from this study is that DEV VP16 encoded by the UL48 gene is an efficient immunomodulatory viral protein, especially acting as an IFN-β inhibitor. DEV VP16 counteracted cGAS-STING-mediated DNA sensing cascade and interacted with duck IRF7 rather than with duck IRF1 in vitro (Figure 4). Furthermore, a N-terminal domain (aa 1-200) of VP16 played an important role in inhibiting IFN-β promoter activity. Similarly, overexpression of truncated VP16 lacking N-terminal domain (aa 1-110) exerted a much more inferior inhibitory function compared to the one lacking C-terminal domain. We could have rescued a DEV VP16-deficient recombinant virus using BAC engineer through the deletion of the whole VP16 protein, but it was inefficient for this recombinant virus to replicate in cells. Its constricted replication feature consisted with a hypothesis that VP16 is essential for DEV, serving as an immune evasion factor, so that the pathogen can blend into the cellular environment. Mapping these host-virus interactions at a molecular level can provide clues for us to understand changes in species specificity and virulence of emerging pathogens and aid in the design of vaccine vectors. However, further investigations will be needed to explore if and how other counterparts of VP16 within DEV take part in immune evasion strategies.
Authors’ Contributions
Yang Li and Mingshu Wang contributed equally to this work.
Acknowledgments
I sincerely appreciate Dr. Shun Chen for providing me with pCAGGS-duIRF7, pCAGGS-duSTING, pCAGGS-duTBK1, and pCAGGS-ducGAS plasmids. Most importantly, I would like to express my gratitude to my supervisor, Prof. Mingshu Wang, who is a responsible teacher. This work was supported by grants from the National Natural Science Foundation of China (31872476), the China Agricultural Research System (CARS-42-17), the Sichuan Veterinary Medicine and Drug Innovation Group of China Agricultural Research System (SCCXTD-2020-18), and the Integration and Demonstration of Key Technologies for Goose Industrial Chain in Sichuan Province (2018NZ0005).
[1] C. Zhao, T. He, Y. Xu, M. Wang, A. Cheng, X. X. Zhao, D. Zhu, S. Chen, M. Liu, Q. Yang, R. Jia, X. Chen, Y. wu, S. Zhang, Y. Liu, Y. Yu, L. Zhang, "Molecular characterization and antiapoptotic function analysis of the duck plague virus Us5 gene," Scientific Reports, vol. 9 no. 1,DOI: 10.1038/s41598-019-41311-0, 2019.
[2] M. Lin, R. Jia, M. Wang, X. Gao, D. Zhu, S. Chen, Z. Yin, Y. Wang, X. Chen, A. Cheng, "The transcription analysis of duck enteritis virus UL49.5 gene using real-time quantitative reverse transcription PCR," Virus Genes, vol. 47 no. 2, pp. 298-304, DOI: 10.1007/s11262-013-0949-4, 2013.
[3] J. Xiang, A. Cheng, M. Wang, S. Zhang, D. Zhu, R. Jia, S. Chen, Y. Zhou, X. Wang, X. Chen, "Computational identification of microRNAs in Anatid herpesvirus 1 genome," Virology Journal, vol. 9 no. 1, article 93,DOI: 10.1186/1743-422X-9-93, 2012.
[4] H. Chang, A. Cheng, M. Wang, R. Jia, D. Zhu, Q. Luo, Z. Chen, Y. Zhou, F. Liu, X. Chen, "Immunofluorescence analysis of duck plague virus gE protein on DPV-infected ducks," Virology Journal, vol. 8 no. 1, article 19,DOI: 10.1186/1743-422X-8-19, 2011.
[5] S. Chanjuan, C. Anchun, W. Mingshu, X. Chao, J. Renyong, C. Xiaoyue, Z. Dekang, L. Qihui, C. Hengmin, Z. Yi, W. Yin, X. Zhiwen, C. Zhengli, W. Xiaoyu, "Expression and distribution of the duck enteritis virus UL51 protein in experimentally infected ducks," Avian Diseases, vol. 54 no. 2, pp. 939-947, DOI: 10.1637/9172-112109-ResNote.1, 2010.
[6] J. Xiang, G. Ma, S. Zhang, A. Cheng, M. Wang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Expression and intracellular localization of duck enteritis virus pUL38 protein," Virology Journal, vol. 7 no. 1, article 162,DOI: 10.1186/1743-422X-7-162, 2010.
[7] A. M. Shen, G. P. Ma, A. C. Cheng, M. S. Wang, D. D. Luo, L. T. Lu, T. Zhou, D. K. Zhu, Q. H. Luo, R. Y. Jia, Z. L. Chen, Y. Zhou, X. Y. Chen, "Transcription phase, protein characteristics of DEV UL45 and prokaryotic expression, antibody preparation of the UL45 des-transmembrane domain," Virology Journal, vol. 7 no. 1, article 232,DOI: 10.1186/1743-422X-7-232, 2010.
[8] Y. Guo, A. Cheng, M. Wang, Y. Zhou, "Purification of anatid herpesvirus 1 particles by tangential-flow ultrafiltration and sucrose gradient ultracentrifugation," Journal of Virological Methods, vol. 161 no. 1,DOI: 10.1016/j.jviromet.2008.12.017, 2009.
[9] G. P. Yuan, A. C. Cheng, M. S. Wang, F. Liu, X. Y. Han, Y. H. Liao, C. Xu, "Electron microscopic studies of the morphogenesis of duck enteritis virus," Avian Diseases, vol. 49 no. 1, pp. 50-55, DOI: 10.1637/7237-071004R, 2005.
[10] Y. Guiping, C. Anchun, W. Mingshu, H. Xiaoying, Z. Yi, L. Fei, "Preliminary study on duck enteritis virus-induced lymphocyte apoptosis in vivo," Avian Diseases, vol. 51 no. 2, pp. 546-549, DOI: 10.1637/0005-2086(2007)51[546:PSODEV]2.0.CO;2, 2007.
[11] Y. Guo, C. Shen, A. Cheng, M. Wang, N. Zhang, S. Chen, Y. Zhou, "Anatid herpesvirus 1 CH virulent strain induces syncytium and apoptosis in duck embryo fibroblast cultures," Veterinary Microbiology, vol. 138 no. 3-4, pp. 258-265, DOI: 10.1016/j.vetmic.2009.04.006, 2009.
[12] Q. Xuefeng, Y. Xiaoyan, C. Anchun, W. Mingshu, Z. Dekang, J. Renyong, "Quantitative analysis of virulent duck enteritis virus loads in experimentally infected ducklings," Avian Diseases, vol. 52 no. 2, pp. 338-344, DOI: 10.1637/8120-100207-ResNote.1, 2008.
[13] X. Qi, X. Yang, A. Cheng, M. Wang, D. Zhu, R. Jia, Q. Luo, X. Chen, "Intestinal mucosal immune response against virulent duck enteritis virus infection in ducklings," Research in Veterinary Science, vol. 87 no. 2, pp. 218-225, DOI: 10.1016/j.rvsc.2009.02.009, 2009.
[14] K. Sun, X. Li, J. Jiang, A. Cheng, M. Wang, D. Zhu, R. Jia, S. Chen, Y. Zhou, X. Chen, X. Wang, "Distribution characteristics of DNA vaccine encoded with glycoprotein C from Anatid herpesvirus 1 with chitosan and liposome as deliver carrier in ducks," Virology Journal, vol. 10 no. 1, article 89,DOI: 10.1186/1743-422X-10-89, 2013.
[15] Q. He, A. Cheng, M. Wang, D. Zhu, Y. Zhou, R. Jia, S. Chen, Z. Chen, X. Chen, "Recombinant UL16 antigen-based indirect ELISA for serodiagnosis of duck viral enteritis," Journal of Virological Methods, vol. 189 no. 1, pp. 105-109, DOI: 10.1016/j.jviromet.2013.01.007, 2013.
[16] Y. Wu, A. Cheng, M. Wang, S. Zhang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Serologic detection of duck enteritis virus using an indirect ELISA based on recombinant UL55 protein," Avian Diseases, vol. 55 no. 4, pp. 626-632, DOI: 10.1637/9766-042111-Reg.1, 2011.
[17] Q. Zou, K. Sun, A. Cheng, M. Wang, C. Xu, D. Zhu, R. Jia, Q. Luo, Y. Zhou, Z. Chen, X. Chen, "Detection of anatid herpesvirus 1 gC gene by TaqMan™ fluorescent quantitative real-time PCR with specific primers and probe," Virology Journal, vol. 7 no. 1,DOI: 10.1186/1743-422X-7-37, 2010.
[18] Y. Wen, A. Cheng, M. Wang, H. Ge, C. Shen, S. Liu, J. Xiang, R. Jia, D. Zhu, X. Chen, B. Lian, H. Chang, Y. Zhou, "A thymidine kinase recombinant protein-based ELISA for detecting antibodies to duck plague virus," Virology Journal, vol. 7 no. 1,DOI: 10.1186/1743-422X-7-77, 2010.
[19] L. Lu, A. Cheng, M. Wang, J. Jiang, D. Zhu, R. Jia, Q. Luo, F. Liu, Z. Chen, X. Chen, J. Yang, "Polyclonal antibody against the DPV UL46M protein can be a diagnostic candidate," Virology journal, vol. 7 no. 1, article 83,DOI: 10.1186/1743-422X-7-83, 2010.
[20] S. Zhang, G. Ma, J. Xiang, A. Cheng, M. Wang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Expressing gK gene of duck enteritis virus guided by bioinformatics and its applied prospect in diagnosis," Virology Journal, vol. 7, article 168,DOI: 10.1186/1743-422x-7-168, 2010.
[21] C. Shen, A. Cheng, M. Wang, K. Sun, R. Jia, T. Sun, N. Zhang, D. Zhu, Q. Luo, Y. Zhou, X. Chen, "Development and evaluation of an immunochromatographic strip test based on the recombinant UL51 protein for detecting antibody against duck enteritis virus," Virology Journal, vol. 7 no. 1, article 268,DOI: 10.1186/1743-422x-7-268, 2010.
[22] Y. Guo, A. Cheng, M. Wang, C. Shen, R. Jia, S. Chen, N. Zhang, "Development of TaqMan® MGB fluorescent real-time PCR assay for the detection of anatid herpesvirus 1," Virology Journal, vol. 6 no. 1, article 71,DOI: 10.1186/1743-422X-6-71, 2009.
[23] R. Jia, A. Cheng, M. Wang, X. Qi, D. Zhu, H. Ge, Q. Luo, F. Liu, Y. Guo, X. Chen, "Development and evaluation of an antigen-capture ELISA for detection of the UL24 antigen of the duck enteritis virus, based on a polyclonal antibody against the UL24 expression protein," Journal of Virological Methods, vol. 161 no. 1, pp. 38-43, DOI: 10.1016/j.jviromet.2009.05.011, 2009.
[24] K. Dhama, N. Kumar, M. Saminathan, R. Tiwari, K. Karthik, M. A. Kumar, M. Palanivelu, M. Z. Shabbir, Y. S. Malik, R. K. Singh, "Duck virus enteritis (duck plague) - a comprehensive update," The Veterinary Quarterly, vol. 37 no. 1, pp. 57-80, DOI: 10.1080/01652176.2017.1298885, 2017.
[25] A. Cheng, Duck Plague, 2015.
[26] Y. C. Jing, Y. Wu, K. F. Sun, M. S. Wang, A. C. Cheng, S. Chen, R. Y. Jia, D. K. Zhu, M. F. Liu, Q. Yang, B. Jing, X. Chen, "Role of duck plague virus glycoprotein C in viral adsorption: absence of specific interactions with cell surface heparan sulfate," Journal of Integrative Agriculture, vol. 16 no. 5, pp. 1145-1152, DOI: 10.1016/S2095-3119(16)61550-2, 2017.
[27] S. Shawky, K. A. Schat, "Latency sites and reactivation of duck enteritis virus," Avian Diseases, vol. 46 no. 2, pp. 308-313, DOI: 10.1637/0005-2086(2002)046[0308:LSAROD]2.0.CO;2, 2002.
[28] H. Zhou, S. Chen, M. Wang, A. Cheng, "Interferons and their receptors in birds: a comparison of gene structure, phylogenetic analysis, and cross modulation," International Journal of Molecular Sciences, vol. 15 no. 11, pp. 21045-21068, DOI: 10.3390/ijms151121045, 2014.
[29] L. Unterholzner, J. F. Almine, "Camouflage and interception: how pathogens evade detection by intracellular nucleic acid sensors," Immunology, vol. 156 no. 3, pp. 217-227, DOI: 10.1111/imm.13030, 2019.
[30] Z. Abdullah, P. A. Knolle, "Scaling of immune responses against intracellular bacterial infection," The EMBO Journal, vol. 33 no. 20, pp. 2283-2294, DOI: 10.15252/embj.201489055, 2014.
[31] L. Sun, J. Wu, F. du, X. Chen, Z. J. Chen, "Cyclic GMP-AMP synthase is a cytosolic DNA sensor that activates the type I interferon pathway," Science, vol. 339 no. 6121, pp. 786-791, DOI: 10.1126/science.1232458, 2013.
[32] C. K. Holm, S. R. Paludan, K. A. Fitzgerald, "DNA recognition in immunity and disease," Current Opinion in Immunology, vol. 25 no. 1, pp. 13-18, DOI: 10.1016/j.coi.2012.12.006, 2013.
[33] P. Xia, S. Wang, P. Gao, G. Gao, Z. Fan, "DNA sensor cGAS-mediated immune recognition," Protein & Cell, vol. 7 no. 11, pp. 777-791, DOI: 10.1007/s13238-016-0320-3, 2016.
[34] M. Motwani, S. Pesiridis, K. A. Fitzgerald, "DNA sensing by the cGAS-STING pathway in health and disease," Nature Reviews Genetics, vol. 20 no. 11, pp. 657-674, DOI: 10.1038/s41576-019-0151-1, 2019.
[35] Y. K. Chan, M. U. Gack, "Viral evasion of intracellular DNA and RNA sensing," Nature Reviews Microbiology, vol. 14 no. 6, pp. 360-373, DOI: 10.1038/nrmicro.2016.45, 2016.
[36] N. Semenova, M. Bosnjak, B. Markelc, K. Znidar, M. Cemazar, L. Heller, "Multiple cytosolic DNA sensors bind plasmid DNA after transfection," Nucleic Acids Research, vol. 47 no. 19, pp. 10235-10246, DOI: 10.1093/nar/gkz768, 2019.
[37] L. Unterholzner, "The interferon response to intracellular DNA: why so many receptors?," Immunobiology, vol. 218 no. 11, pp. 1312-1321, DOI: 10.1016/j.imbio.2013.07.007, 2013.
[38] Q. Chen, L. Sun, Z. J. Chen, "Regulation and function of the cGAS-STING pathway of cytosolic DNA sensing," Nature Immunology, vol. 17 no. 10, pp. 1142-1149, DOI: 10.1038/ni.3558, 2016.
[39] A. Michalska, K. Blaszczyk, J. Wesoly, H. A. R. Bluyssen, "A positive feedback amplifier circuit that regulates interferon (IFN)-stimulated gene expression and controls type I and type II IFN responses," Frontiers in immunology, vol. 9,DOI: 10.3389/fimmu.2018.01135, 2018.
[40] M. R. W. Barber, J. R. Aldridge, R. G. Webster, K. E. Magor, "Association of RIG-I with innate immunity of ducks to influenza," Proceedings of the National Academy of Sciences of the United States of America, vol. 107 no. 13, pp. 5913-5918, DOI: 10.1073/pnas.1001755107, 2010.
[41] C. T. Ng, J. L. Mendoza, K. C. Garcia, M. B. A. Oldstone, "Alpha and beta type 1 interferon signaling: passage for diverse biologic outcomes," Cell, vol. 164 no. 3, pp. 349-352, DOI: 10.1016/j.cell.2015.12.027, 2016.
[42] L. M. Snell, T. L. McGaha, D. G. Brooks, "Type I interferon in chronic virus infection and cancer," Trends in Immunology, vol. 38 no. 8, pp. 542-557, DOI: 10.1016/j.it.2017.05.005, 2017.
[43] C. Xia, P. Anderson, B. Hahm, "Viral dedication to vigorous destruction of interferon receptors," Virology, vol. 522, pp. 19-26, DOI: 10.1016/j.virol.2018.06.017, 2018.
[44] K. Kubelkova, A. Macela, "Innate immune recognition: an issue more complex than expected," Frontiers in Cellular and Infection Microbiology, vol. 9,DOI: 10.3389/fcimb.2019.00241, 2019.
[45] D. Feng, M. Cui, R. Jia, S. Liu, M. Wang, D. Zhu, S. Chen, M. Liu, X. Zhao, Y. Wu, Q. Yang, Z. Yin, A. Cheng, "Co-localization of and interaction between duck enteritis virus glycoprotein H and L," BMC Veterinary Research, vol. 14 no. 1,DOI: 10.1186/s12917-018-1553-6, 2018.
[46] X. Gao, R. Jia, M. Wang, Q. Yang, S. Chen, M. Liu, Z. Yin, A. Cheng, "Duck enteritis virus (DEV) UL54 protein, a novel partner, interacts with DEV UL24 protein," Virology Journal, vol. 14 no. 1,DOI: 10.1186/s12985-017-0830-5, 2017.
[47] Y. Wu, Y. Li, M. Wang, K. Sun, R. Jia, S. Chen, D. Zhu, M. Liu, Q. Yang, X. Zhao, X. Chen, A. Cheng, "Preliminary study of the UL55 gene based on infectious Chinese virulent duck enteritis virus bacterial artificial chromosome clone," Virology Journal, vol. 14 no. 1, article 78,DOI: 10.1186/s12985-017-0748-y, 2017.
[48] X. Hu, M. Wang, S. Chen, R. Jia, D. Zhu, M. Liu, Q. Yang, K. Sun, X. Chen, A. Cheng, "The duck enteritis virus early protein, UL13, found in both nucleus and cytoplasm, influences viral replication in cell culture," Poultry Science, vol. 96 no. 8, pp. 2899-2907, DOI: 10.3382/ps/pex043, 2017.
[49] C. Liu, A. Cheng, M. Wang, S. Chen, R. Jia, D. Zhu, M. Liu, K. Sun, Q. Yang, X. Chen, "Characterization of nucleocytoplasmic shuttling and intracellular localization signals in duck enteritis virus UL54," Biochimie, vol. 127, pp. 86-94, DOI: 10.1016/j.biochi.2016.05.003, 2016.
[50] J. Gao, A. C. Cheng, M. S. Wang, R. Y. Jia, D. K. Zhu, S. Chen, M. F. Liu, F. Liu, Q. Yang, K. F. Sun, X. Y. Chen, "Identification and characterization of the duck enteritis virus (DEV) US2 gene," Genetics and Molecular Research, vol. 14 no. 4, pp. 13779-13790, DOI: 10.4238/2015.October.28.40, 2015.
[51] T. He, M. Wang, X. Cao, A. Cheng, Y. Wu, Q. Yang, M. Liu, D. Zhu, R. Jia, S. Chen, K. Sun, X. Zhao, X. Chen, "Molecular characterization of duck enteritis virus UL41 protein," Virology Journal, vol. 15 no. 1, article 12,DOI: 10.1186/s12985-018-0928-4, 2018.
[52] D. Zhang, M. Lai, A. Cheng, M. Wang, Y. Wu, Q. Yang, M. Liu, D. Zhu, R. Jia, S. Chen, K. Sun, X. Zhao, X. Chen, "Molecular characterization of the duck enteritis virus US10 protein," Virology Journal, vol. 14 no. 1, article 183,DOI: 10.1186/s12985-017-0841-2, 2017.
[53] C. Liu, A. Cheng, M. Wang, S. Chen, R. Jia, D. Zhu, M. Liu, K. Sun, Q. Yang, X. Chen, "Duck enteritis virus UL54 is an IE protein primarily located in the nucleus," Virology Journal, vol. 12 no. 1, article 198,DOI: 10.1186/s12985-015-0424-z, 2015.
[54] M. Lin, R. Jia, M. Wang, X. Gao, D. Zhu, S. Chen, M. Liu, Z. Yin, Y. Wang, X. Chen, A. Cheng, "Molecular characterization of duck enteritis virus CHv strain UL49.5 protein and its colocalization with glycoprotein M," Journal of Veterinary Science, vol. 15 no. 3, pp. 389-398, DOI: 10.4142/jvs.2014.15.3.389, 2014.
[55] K. F. Sun, A. C. Cheng, M. S. Wang, "Bioinformatic analysis and characteristics of glycoprotein C encoded by the newly identified UL44 gene of duck plague virus," Genetics and Molecular Research, vol. 13 no. 2, pp. 4505-4515, DOI: 10.4238/2014.June.17.2, 2014.
[56] A. CHENG, S. ZHANG, X. ZHANG, M. WANG, D. ZHU, R. JIA, X. CHEN, "Prokaryotic expression and characteristics of duck enteritis virus UL29 gene," Acta Virologica, vol. 56 no. 4, pp. 293-304, DOI: 10.4149/av_2012_04_293, 2012.
[57] Q. He, A. Cheng, M. Wang, J. Xiang, D. Zhu, Y. Zhou, R. Jia, S. Chen, Z. Chen, X. Chen, "Replication kinetics of duck enteritis virus UL16 gene in vitro," Virology Journal, vol. 9 no. 1, article 281,DOI: 10.1186/1743-422X-9-281, 2012.
[58] J. Xiang, S. Zhang, A. Cheng, M. Wang, H. Chang, C. Shen, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Expression and characterization of recombinant VP19c protein and N-terminal from duck enteritis virus," Virology Journal, vol. 8 no. 1, article 82,DOI: 10.1186/1743-422X-8-82, 2011.
[59] S. Zhang, J. Xiang, A. Cheng, M. Wang, Y. Wu, X. Yang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Characterization of duck enteritis virus UL53 gene and glycoprotein K," Virology Journal, vol. 8 no. 1, article 235,DOI: 10.1186/1743-422X-8-235, 2011.
[60] L. Li, A. Cheng, M. Wang, J. Xiang, X. Yang, S. Zhang, D. Zhu, R. Jia, Q. Luo, Y. Zhou, Z. Chen, X. Chen, "Expression and characterization of duck enteritis virus gI gene," Virology Journal, vol. 8 no. 1, article 241,DOI: 10.1186/1743-422X-8-241, 2011.
[61] Q. He, Q. Yang, A. Cheng, M. Wang, J. Xiang, D. Zhu, R. Jia, Q. Luo, Z. Chen, Y. Zhou, X. Chen, "Expression and characterization of UL16 gene from duck enteritis virus," Virology Journal, vol. 8 no. 1, article 413,DOI: 10.1186/1743-422X-8-413, 2011.
[62] W. Xie, A. Cheng, M. Wang, H. Chang, D. Zhu, Q. Luo, "Molecular cloning and characterization of the UL31 gene from duck enteritis virus," Molecular Biology Reports, vol. 37 no. 3, pp. 1495-1503, DOI: 10.1007/s11033-009-9546-y, 2010.
[63] W. Xie, A. Cheng, M. Wang, H. Chang, D. Zhu, Q. Luo, "Characterization of the duck plague virus UL35 gene," Intervirology, vol. 53 no. 6, pp. 408-416, DOI: 10.1159/000317291, 2010.
[64] B. Lian, C. Xu, A. Cheng, M. Wang, D. Zhu, Q. Luo, R. Jia, F. Bi, Z. Chen, Y. Zhou, Z. Yang, X. Chen, "Identification and characterization of duck plague virus glycoprotein C gene and gene product," Virology Journal, vol. 7 no. 1, article 349,DOI: 10.1186/1743-422X-7-349, 2010.
[65] R. L. Thompson, N. M. Sawtell, "Targeted promoter replacement reveals that herpes simplex virus type-1 and 2 specific VP16 promoters direct distinct rates of entry into the lytic program in sensory neurons in vivo," Frontiers in Microbiology, vol. 10,DOI: 10.3389/fmicb.2019.01624, 2019.
[66] Y. Wang, R. Wang, F. Li, Y. Wang, Z. Zhang, Q. Wang, Z. Ren, F. Jin, K. Kitazato, Y. Wang, "Heat-shock protein 90 α is involved in maintaining the stability of VP16 and VP16-mediated transactivation of α genes from herpes simplex virus-1," Molecular Medicine, vol. 24 no. 1,DOI: 10.1186/s10020-018-0066-x, 2018.
[67] H. S. Oh, D. M. Knipe, "Proteomic analysis of the herpes simplex virus 1 virion protein 16 transactivator protein in infected cells," Proteomics, vol. 15 no. 12, pp. 1957-1967, DOI: 10.1002/pmic.201500020, 2015.
[68] N. M. Sawtell, R. L. Thompson, "De novo herpes simplex virus VP16 expression gates a dynamic programmatic transition and sets the latent/lytic balance during acute infection in trigeminal ganglia," PLoS Pathogens, vol. 12 no. 9,DOI: 10.1371/journal.ppat.1005877, 2016.
[69] Y. Cheng, W. Zhu, C. Ding, Q. Niu, H. Wang, Y. Yan, J. Sun, "IRF7 is involved in both STING and MAVS mediating IFN- β signaling in IRF3-lacking chickens," The Journal of Immunology, vol. 203 no. 7, pp. 1930-1942, DOI: 10.4049/jimmunol.1900293, 2019.
[70] Y. Wu, A. Cheng, M. Wang, Q. Yang, D. Zhu, R. Jia, S. Chen, Y. Zhou, X. Wang, X. Chen, "Complete genomic sequence of chinese virulent duck enteritis virus," Journal of Virology, vol. 10, article 5965,DOI: 10.1128/jvi.00529-12, 2012.
[71] Y. You, T. Liu, M. Wang, A. Cheng, R. Jia, Q. Yang, Y. Wu, D. Zhu, S. Chen, M. Liu, X. X. Zhao, S. Zhang, Y. Liu, Y. Yu, L. Zhang, "Duck plague virus glycoprotein J is functional but slightly impaired in viral replication and cell-to-cell spread," Scientific Reports, vol. 8 no. 1, article 4069, 2018.
[72] Y. Wu, A. Cheng, M. Wang, D. Zhu, R. Jia, S. Chen, Y. Zhou, X. Chen, "Comparative genomic analysis of duck enteritis virus strains," Journal of Virology, vol. 86 no. 24, pp. 13841-13842, DOI: 10.1128/JVI.01517-12, 2012.
[73] M. Wang, D. Lin, S. Zhang, D. Zhu, R. Jia, X. Chen, A. Cheng, "Prokaryotic expression of the truncated duck enteritis virus UL27 gene and characteristics of UL27 gene and its truncated product," Acta Virologica, vol. 56 no. 4, pp. 323-328, DOI: 10.4149/av_2012_04_323, 2012.
[74] C. Liu, A. Cheng, M. Wang, S. Chen, R. Jia, D. Zhu, M. Liu, K. Sun, Q. Yang, Y. Wu, X. Zhao, X. Chen, "Regulation of viral gene expression by duck enteritis virus UL54," Scientific Reports, vol. 7 no. 1, article 1076, 2017.
[75] Y. Wu, A. Cheng, M. Wang, S. Zhang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Characterization of the duck enteritis virus UL55 protein," Virology Journal, vol. 8 no. 1, article 256,DOI: 10.1186/1743-422X-8-256, 2011.
[76] Y. Wu, A. Cheng, M. Wang, S. Zhang, D. Zhu, R. Jia, Q. Luo, Z. Chen, X. Chen, "Establishment of real-time reverse transcription PCR (qRT-PCR) and its application in transcriptional analysis of DEV UL55 gene in DEV CHv infected cell in vitro," Virology Journal, vol. 8, article 266, 2011.
[77] X. D. Li, J. Wu, D. Gao, H. Wang, L. Sun, Z. J. Chen, "Pivotal roles of cGAS-cGAMP signaling in antiviral defense and immune adjuvant effects," Science, vol. 341 no. 6152, pp. 1390-1394, DOI: 10.1126/science.1244040, 2013.
[78] S. Chen, T. Wang, P. Liu, C. Yang, M. Wang, R. Jia, D. Zhu, M. Liu, Q. Yang, Y. Wu, X. Zhao, A. Cheng, "Duck interferon regulatory factor 7 (IRF7) can control duck Tembusu virus (DTMUV) infection by triggering type I interferon production and its signal transduction pathway," Cytokine, vol. 113, pp. 31-38, DOI: 10.1016/j.cyto.2018.06.001, 2019.
[79] Y. Cheng, Y. Liu, S. Shi, Q. Niu, Z. Zhu, Z. Wang, J. Ma, H. Wang, Y. Yan, J. Sun, "Functional Characterization of Duck STING in IFN- β Induction and Anti-H9N2 Avian Influenza Viruses Infections," Frontiers in Immunology, vol. 10,DOI: 10.3389/fimmu.2019.02224, 2019.
[80] X. Li, M. Deng, A. S. Petrucelli, C. Zhu, J. Mo, L. Zhang, J. W. Tam, P. Ariel, B. Zhao, S. Zhang, H. Ke, P. Li, N. V. Dokholyan, J. A. Duncan, J. P. Y. Ting, "Viral DNA binding to NLRC3, an inhibitory nucleic acid sensor, unleashes STING, a cyclic dinucleotide receptor that activates type I interferon," Immunity, vol. 50 no. 3, pp. 591-599.e6, DOI: 10.1016/j.immuni.2019.02.009, 2019.
[81] M. H. Orzalli, M. Knipe, "Cellular sensing of viral DNA and viral evasion mechanisms," Annual Review of Microbiology, vol. 68 no. 1, pp. 477-492, DOI: 10.1146/annurev-micro-091313-103409, 2014.
[82] Y. H. Chiu, J. B. MacMillan, Z. J. Chen, "RNA polymerase III detects cytosolic DNA and induces type I interferons through the RIG-I pathway," Cell, vol. 138 no. 3, pp. 576-591, DOI: 10.1016/j.cell.2009.06.015, 2009.
[83] L. Unterholzner, S. E. Keating, M. Baran, K. A. Horan, S. B. Jensen, S. Sharma, C. M. Sirois, T. Jin, E. Latz, T. S. Xiao, K. A. Fitzgerald, S. R. Paludan, A. G. Bowie, "IFI16 is an innate immune sensor for intracellular DNA," Nature Immunology, vol. 11 no. 11, pp. 997-1004, DOI: 10.1038/ni.1932, 2010.
[84] A. Takaoka, Z. C. Wang, M. K. Choi, H. Yanai, H. Negishi, T. Ban, Y. Lu, M. Miyagishi, T. Kodama, K. Honda, Y. Ohba, T. Taniguchi, "DAI (DLM-1/ZBP1) is a cytosolic DNA sensor and an activator of innate immune response," Nature, vol. 448 no. 7152, pp. 501-505, DOI: 10.1038/nature06013, 2007.
[85] B. A. Diner, K. K. Lum, J. E. Toettcher, I. M. Cristea, "Viral DNA sensors IFI16 and cyclic GMP-AMP synthase possess distinct functions in regulating viral gene expression, immune defenses, and apoptotic responses during herpesvirus infection," MBio, vol. 7 no. 6,DOI: 10.1128/mbio.01553-16, 2016.
[86] D. Santhakumar, D. Rubbenstroth, L. Martinez-Sobrido, M. Munir, "Avian interferons and their antiviral effectors," Frontiers in Immunology, vol. 8,DOI: 10.3389/fimmu.2017.00049, 2017.
[87] J. Xing, L. Ni, S. Wang, K. Wang, R. Lin, C. Zheng, "Herpes simplex virus 1-encoded tegument protein VP16 abrogates the production of beta interferon (IFN) by inhibiting NF- κ B activation and blocking IFN regulatory factor 3 to recruit its coactivator CBP," Journal of Virology, vol. 87 no. 17, pp. 9788-9801, DOI: 10.1128/JVI.01440-13, 2013.
[88] Z. Ma, G. Ni, B. Damania, "Innate sensing of DNA virus genomes," Annual Review of Virology, vol. 5 no. 1, pp. 341-362, DOI: 10.1146/annurev-virology-092917-043244, 2018.
[89] R. Lin, R. S. Noyce, S. E. Collins, R. D. Everett, K. L. Mossman, "The herpes simplex virus ICP0 RING finger domain inhibits IRF3- and IRF7-mediated activation of interferon-stimulated genes," Journal of Virology, vol. 78 no. 4, pp. 1675-1684, DOI: 10.1128/jvi.78.4.1675-1684.2004, 2004.
[90] C. Su, C. Zheng, "Herpes simplex virus 1 abrogates the cGAS/STING-mediated cytosolic DNA-sensing pathway via its virion host shutoff protein, UL41," Journal of Virology, vol. 91 no. 6,DOI: 10.1128/JVI.02414-16, 2017.
[91] J. Xing, S. Wang, R. Lin, K. L. Mossman, C. Zheng, "Herpes simplex virus 1 tegument protein US11 downmodulates the RLR signaling pathway via direct interaction with RIG-I and MDA-5," Journal of Virology, vol. 86 no. 7, pp. 3528-3540, DOI: 10.1128/JVI.06713-11, 2012.
[92] M. H. Christensen, S. B. Jensen, J. J. Miettinen, S. Luecke, T. Prabakaran, L. S. Reinert, T. Mettenleiter, Z. J. Chen, D. M. Knipe, R. M. Sandri-Goldin, L. W. Enquist, R. Hartmann, T. H. Mogensen, S. A. Rice, T. A. Nyman, S. Matikainen, S. R. Paludan, "HSV-1 ICP27 targets the TBK1-activated STING signalsome to inhibit virus-induced type I IFN expression," The EMBO Journal, vol. 35 no. 13, pp. 1385-1399, DOI: 10.15252/embj.201593458, 2016.
[93] J. Huang, H. You, C. Su, Y. Li, S. Chen, C. Zheng, "Herpes simplex virus 1 tegument protein VP22 abrogates cGAS/STING-mediated antiviral innate immunity," Journal of Virology, vol. 92 no. 15,DOI: 10.1128/JVI.00841-18, 2018.
[94] D. Zhang, C. Su, C. Zheng, "Herpes simplex virus 1 serine protease VP24 blocks the DNA-sensing signal pathway by abrogating activation of interferon regulatory factor 3," Journal of Virology, vol. 90 no. 12, pp. 5824-5829, DOI: 10.1128/JVI.00186-16, 2016.
[95] T. Deschamps, M. Kalamvoki, "Evasion of the STING DNA-sensing pathway by VP11/12 of herpes simplex virus 1," Journal of Virology, vol. 91 no. 16,DOI: 10.1128/JVI.00535-17, 2017.
[96] H. Xu, C. Su, A. Pearson, C. H. Mody, C. Zheng, "Herpes simplex virus 1 UL24 abrogates the DNA sensing signal pathway by inhibiting NF- κ B activation," Journal of Virology, vol. 91 no. 7,DOI: 10.1128/JVI.00025-17, 2017.
[97] K. Honda, T. Taniguchi, "IRFs: master regulators of signalling by toll-like receptors and cytosolic pattern-recognition receptors," Nature Reviews Immunology, vol. 6 no. 9, pp. 644-658, DOI: 10.1038/nri1900, 2006.
[98] L. Wang, J. Zhao, J. Ren, K. H. Hall, J. P. Moorman, Z. Q. Yao, S. Ning, "Protein phosphatase 1 abrogates IRF7-mediated type I IFN response in antiviral immunity," European Journal of Immunology, vol. 46 no. 10, pp. 2409-2419, DOI: 10.1002/eji.201646491, 2016.
[99] F. X. Zhu, S. M. King, E. J. Smith, D. E. Levy, Y. Yuan, "A Kaposi’s sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation," Proceedings of the National Academy of Sciences of the United States of America, vol. 99 no. 8, pp. 5573-5578, DOI: 10.1073/pnas.082420599, 2002.
[100] L. Wu, E. Fossum, C. H. Joo, K. S. Inn, Y. C. Shin, E. Johannsen, L. M. Hutt-Fletcher, J. Hass, J. U. Jung, "Epstein-Barr virus LF2: an antagonist to type I interferon," Journal of Virology, vol. 83 no. 2, pp. 1140-1146, DOI: 10.1128/JVI.00602-08, 2009.
[101] L. Gao, K. Li, Y. Zhang, Y. Liu, C. Liu, Y. Zhang, Y. Gao, X. Qi, H. Cui, Y. Wang, X. Wang, "Inhibition of DNA-sensing pathway by Marek’s disease virus VP23 protein through suppression of interferon regulatory factor 7 activation," Journal of Virology, vol. 93 no. 4,DOI: 10.1128/JVI.01934-18, 2019.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2020 Yang Li et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. http://creativecommons.org/licenses/by/4.0/
Abstract
Duck enteritis virus (DEV) can successfully evade the host innate immune responses and establish a lifelong latent infection in the infected host. However, the study about how DEV escapes host innate immunity is still deficient up to now. In this study, for the first time, we identified a viral protein VP16 by which DEV can obviously downregulate the production of IFN-β in duck embryo fibroblast (DEF). Our results showed that ectopic expression of VP16 decreased duck IFN-β (duIFN-β) promoter activation and significantly inhibited the mRNA transcription of IFN-β. Further study showed that VP16 can also obviously inhibit the mRNA transcription of interferon-stimulated genes (ISGs), such as myxovirus resistance protein (Mx) and interferon-induced oligoadenylate synthetase-like (OASL). Furthermore, we found that this anti-interferon activity of VP16 depended on its N-terminus (aa1-200). Coexpression analysis revealed that VP16 selectively blocked duIFN-β promoter activity at the duIRF7 level rather than duIRF1. Based on the results of coimmunoprecipitation analysis (co-IP) and indirect immunofluorescence assay (IFA), VP16 was able to bind to duck IRF7 (duIRF7) directly, but did not interact with duck IRF1 (duIRF1) in vitro.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Jia, Renyong 1 ; Yang, Qiao 1 ; Chen, Shun 1
; Zhu, Dekang 2 ; Liu, Mafeng 1
; Zhao, Xinxin 1 ; Zhang, Shaqiu 1 ; Huang, Juan 1 ; Ou, Xumin 1 ; Mao, Sai 1 ; Yu, Yanling 1 ; Zhang, Ling 1 ; Liu, Yunya 1 ; Pan, Leichang 3 ; Tian, Bin 3 ; Mujeeb Ur Rehman 3 ; Chen, Xiaoyue 2 1 Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Wenjiang 611130, China; Avian Disease Research Center, College of Veterinary Medicine of Sichuan Agricultural University, Wenjiang 611130, China; Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Wenjiang 611130, China
2 Avian Disease Research Center, College of Veterinary Medicine of Sichuan Agricultural University, Wenjiang 611130, China; Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Wenjiang 611130, China
3 Institute of Preventive Veterinary Medicine, Sichuan Agricultural University, Wenjiang 611130, China; Key Laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Wenjiang 611130, China