Lung cancer is a malignant tumor that grows in bronchi, trachea, bronchioles, or alveolar tissues. At present, lung cancer is one of the malignant tumors with the highest morbidity and mortality in China. According to basic clinical types, lung cancer can be mainly divided into lung adenocarcinoma (LUAD), lung squamous cell carcinoma (LUSC), large cell undifferentiated carcinoma (LCUC), and small cell lung cancer (SCLC). Among these, LUAD, LUSC, and LCUC belong to the non‐small cell lung cancer (NSCLC), which accounts for almost 80% of all lung cancers. Despite the advances in the diagnosis and therapeutic strategies, the five‐year overall survival still remains less than 15% in NSCLC.
The tripartite motif (TRIM) family proteins are the E3 ubiquitin ligases with a RING domain, which can mediate the ubiquitination of target proteins. And it has been reported that the TRIM family proteins are involved in the tumorigenesis of many tumors. A recent paper showed that TRIM14 was highly expressed in glioblastoma, and decreased TRIM14 inhibited cell migration and invasion of glioblastoma cells by inducing the poly‐ubiquitination of ZEB2 for proteasomal degradation. Another paper reported that TRIM47 was elevated in colorectal cancer (CRC) tumor tissues, and promoted cell growth and metastasis of CRC cells. In mechanism, TRIM47 interacted with SMAD4, and induced the poly‐ubiquitination of SMAD4 for proteasomal degradation in CRC cells.
In the present study, TRIM26 was found down‐regulated in both of NSCLC tumor tissues and cell lines, and low expression of TRIM26 predicted a poor prognosis for the overall survival of NSCLC patients. In contrast, overexpression of TRIM26 markedly inhibited cell growth of NSCLC cells by suppressing PI3K/AKT pathway. In mechanism, overexpressed TRIM26 stabilized PTEN protein in NSCLC cells. Our present study indicated that TRIM26 could be as a novel target for the treatment of NSCLC in the future.
The human normal bronchial epithelial cell line HBE, NSCLC cell lines (A549, H358, H1299, and H1792) and HEK293T cell line were purchased from ATCC (American Type Culture Collection, Manassas, USA). HBE and NSCLC cell lines were cultured in Gibico RPMI 1640 medium with 10% fetal bovine serum and 1% penicillin/streptomycin. HEK293T cells were cultured in Gibico DMEM medium with high glucose. The primary NSCLC tissues and individual normal para‐cancerous tissues were provided by the Affiliated Huaian No.1 People's Hospital of Nanjing Medical University. The collection and use of human NSCLC tissues were approved by the Institutional Review Board of the Affiliated Huaian No.1 People's Hospital of Nanjing Medical University. Cycloheximide (CHX) was purchased from Sigma‐Aldrich (St. Louis, MO).
The quantitative real‐time polymerase chain reaction (qRT‐PCR) analysis was performed as previously described. The primers used were as follows: TRIM26, forward 5′‐AAGTTGTGCGAGCGACAC‐3′ and reverse 5′‐CTCAGGTGGTTCAGGATTTT‐3′; Cyclin D1, forward 5′‐GCGAGGAACAGAAGTGCG‐3′ and reverse 5′‐TGGAGTTGTCGGTGTAGATGC‐3′; Cyclin D3, forward 5′‐TTTCCTGGCCTTCATTCTG‐3′ and reverse 5′‐ATCATGGATGGCGGGTAC‐3′; p27, forward 5′‐GGCTCCGGCTAACTCTGA‐3′ and reverse 5′‐TCTTCTGTTCTGTTGGCTCTTT‐3′; Cyclin A, forward 5′‐TGGAGTTGTGCTGGCTAC ‐3′ and reverse 5′‐CCTCCTGTACTGCCCATT‐3′; Cyclin E, forward 5′‐GGATGTTGACTGCCTTGA‐3′ and reverse 5′‐CACCACTGATACCCTGAAA‐3′; CDK4, forward 5′‐AGTTCGTGAGGTGGCTTTA−3′ and reverse 5′‐GGGTGCCTTGTCCAGATA‐3′; PTEN, forward 5′‐ACCATAACCCACCACAGC‐3′ and reverse 5′‐CAGTTCGTCCCTTTCCAG‐3′; GAPDH, forward 5′‐GCACCGTCAAGGCTGAGAAC‐3′ and reverse 5′‐TGGTGAAGACGCCAGTGGA‐3′.
The immunoblotting analysis was carried out as described previously. Anti‐TRIM26 antibody was purchased from Santa Cruz Biotechnology. Anti‐GAPDH, p‐AKT (Ser473), AKT, p‐PI3K p85 (Tyr458), PI3K p85, and PTEN antibodies were purchased from CST (Cell Signaling Technology, Danvers, MA). Anti‐Myc and Flag tag antibodies were purchased from MBL (Medical & Biological Laboratories, Tokyo, Japan).
The full length of human TRIM26 gene was obtained by polymerase chain reaction (PCR), and then TRIM26 gene was cloned into pcDNA3.1 vector with a Myc tag. Plasmids were transiently transfected into HEK293T cells by using Lipofectamine2000 reagent according to the manufacturer's instruction. The primers used for TRIM26 amplification were as follows: forward, 5′‐ATGGCCACGTCAGCCCCACTACGGA‐3′, reverse, 5′‐TCAGGGTCTTAGCAGGAGGCGTGTT‐3′.
The full length of human TRIM26 gene was generated by PCR, and then cloned into PLVX, a lentiviral vector (Addgene). The viral particles were generated as manufacturer's instructions as described previously.
A549 and H1792 cells were stably infected with lentivirus‐derived PLVX‐NC or PLVX‐TRIM26. Then, infected cells were seeded in the 96‐well plate at a density of 2000 cells per well, followed by Cell Counting Kit‐8 (CCK‐8) assay at indicated times according to the manufacturer's instructions (Bimake).
The CHX chase assay was performed as previously described. H1792 cells were transfected with Myc‐TRIM26 or empty vector plasmids for 24 hours. Then, transfected cells were incubated with 50 μg/mL CHX for indicated time, followed by immunoblotting.
Whole cell lysates of H1792 cells were prepared for co‐immunoprecipitation as described previously. They were incubated with the anti‐PTEN antibody overnight and then mixed with protein A/G‐Sepharose beads for 4 hours. After extensive washing, the beads were boiled and analyzed by immunoblotting.
In the experiments, the student's t test was used for comparisons of two groups. All statistical tests were two‐sided. In this study, p value less than 0.05 is considered statistically significant.
Firstly, 20 pairs of NSCLC tumor tissues were collected and prepared for qRT‐PCR to detect TRIM26 expression. As shown in Figure A,B, the mRNA levels of TRIM26 were lower in NSCLC tumor tissues than in normal para‐cancerous tissues. To further confirm it, five representative NSCLC tumor tissues were prepared for immunoblotting, and the results showed that TRIM26 protein was also lowly expressed in NSCLC (Figure C). Subsequently, to evaluate whether the expression level of TRIM26 was associated with the overall survival of NSCLC patients, the Kaplan‐Meier (KM) plotter based on the Pan‐Cancer RNA‐seq database was analyzed. As shown in Figure D, the KM plotter indicated that NSCLC patients with high TRIM26 expression had the longer overall survival than the patients with low TRIM26 expression.
Enlarge this image.Fig. 1. TRIM26 is lowly expressed in NSCLC and predicts a positive index for NSCLC patients. A, Twenty pairs of NSCLC primary tumor tissues were collected for qRT‐PCR analysis against TRIM26. GAPDH was used as an internal control. B, Statistic analysis for (A). C, Five indicated representative NSCLC tumor tissues were prepared for immunoblotting against TRIM26 and GAPDH. N: Individual normal para‐cancerous tissues; C: NSCLC tumor tissues. D, The overall survival curve of lung cancer patients with low or high expression of TRIM26 was predicted by the Kaplan‐Meier plotter (http://kmplot.com). *P < .05, **P < .01
Above studies have shown that TRIM26 was lowly expressed in NSCLC tumor tissues. To further confirm it, we also evaluated the expression of TRIM26 in NSCLC cell lines. As shown in Figure A, TRIM26 was markedly decreased in four NSCLC cell lines compared with the human normal bronchial epithelial cell line. Subsequently, to evaluate whether TRIM26 was functional in NSCLC cells, TRIM26 was overexpressed in NSCLC cells by the lentivirus (Figure B). As shown in Figure C,D, overexpression of TRIM26 could significantly suppress cell growth in A549 and H1792 cells.
Enlarge this image.Fig. 2. Overexpression of TRIM26 inhibits cell growth in NSCLC cells. A, A human normal bronchial epithelial cell line HBE and four NSCLC cell lines (A549, H358, H1299, and H1792) were prepared for qRT‐PCR analysis against TRIM26. B, A549 and H1792 cells were stably infected with lentivirus‐derived PLVX‐NC or PLVX‐TRIM26, respectively. Then, cells were prepared for immunoblotting against TRIM26 and GAPDH. C & D, A549 (C) and H1792 (D) cells were stably infected with PLVX‐NC and PLVX‐TRIM26, followed by CCK‐8 assay. *P < .05, **P < .01
In our further study, we found that overexpression of TRIM26 could significantly inhibit the phosphorylation of PI3K in NSCLC cells (Figure A). It is known that PI3K/AKT signaling is a key survival signaling for tumor progression. Then, to confirm whether TRIM26 regulated PI3K/AKT signaling, the activation of AKT was evaluated. As shown in Figure B, overexpresison of TRIM26 markedly decreased the phosphorylation of AKT in NSCLC cells. Finally, we also detected the downstream genes' expression of AKT signaling, which were involved in cell cycle progression. As shown in Figure C,D, overexpression of TRIM26 markedly inhibited the expression levels of Cyclin D1 and Cyclin D3, both of which were the key regulators in cell cycle progression in NSCLC cells. In contrast, overexpression of TRIM26 increased the expression levels of p27 in NSCLC cells (Figure C,D). And TRIM26 overexpression also downregulated other cell cycle‐related genes' expression, including Cyclin A, Cyclin E, and CDK4 (Figure E,F). These results indicated that TRIM26 regulated PI3K/AKT signaling in NSCLC cells.
Enlarge this image.Fig. 3. Overexpression of TRIM26 suppresses PI3K/AKT signaling in NSCLC cells. A, A549 and H1792 cells were infected with PLVX‐NC or PLVX‐TRIM26‐derived lentivirus for 72 hours, followed by immunoblotting against p‐PI3K p85 (Tyr458), PI3K p85, TRIM26, and GAPDH. B, A549 and H1792 cells were infected with PLVX‐NC or PLVX‐TRIM26‐derived lentivirus for 72 hours, followed by immunoblotting against p‐AKT (Ser473), AKT, TRIM26, and GAPDH. C & D, A549 (C) and H1792 (D) cells were infected with PLVX‐NC or PLVX‐TRIM26‐derived lentivirus for 72 hours, followed by qRT‐PCR analysis against Cyclin D1, Cyclin D3, and p27. GAPDH was used as an internal control. E & F, Above cells were also prepared for qRT‐PCR against Cyclin A, Cyclin E, and CDK4. **P < .01
It is known that PTEN was the main negative regulator of PI3K/AKT pathway. Then, to further explore why TRIM26 regulated PI3K/AKT pathway, we evaluated whether TRIM26 regulated PTEN expression. As shown in Figure A,B, overexpression of TRIM26 up‐regulated endogenous levels of PTEN in both of NSCLC and HEK293T cells. However, overexpressed TRIM26 had no effect on the mRNA levels of PTEN in NSCLC cells (Figure C). Furthermore, CHX chase assay showed that overexpression of TRIM26 could significantly prolong the half‐life of PTEN protein in NSCLC cells (Figure D,E). Collectively, TRIM26 stabilized PTEN protein in NSCLC cells.
Enlarge this image.Fig. 4. TRIM26 stabilizes PTEN protein in NSCLC cells. A, HEK293T cells were transfected with increasing concentrations of Myc‐TRIM26 for 48 hours, followed by immunoblotting against PTEN, Myc, and GAPDH. B, A549 and H1792 cells were infected with PLVX‐NC or PLVX‐TRIM26‐derived lentivirus for 72 hours, followed by immunoblotting against PTEN, TRIM26, and GAPDH. C, A549 and H1792 cells were infected with PLVX‐NC or PLVX‐TRIM26‐derived lentivirus for 72 hours, followed by qRT‐PCR analysis against PTEN. D, H1792 cells were transfected with Myc‐TRIM26 plasmids for 24 hours. Then, transfected cells were incubated with 50 μg/mL cycloheximide (CHX) for indicated time, followed by immunoblotting against PTEN and Myc. GAPDH was used as a loading control. E, Statistical analysis for (D). n.s. means non‐sense. F, Whole cell lysates of H1792 cells were subjected to co‐immunoprecipitation assay using anti‐PTEN antibody
Recent studies have shown that TRIM26 acted as a tumor suppressor in several tumors. In papillary thyroid carcinoma (PTC), a recent study reported that TRIM26 was lowly expressed in both of PTC tissues and cell lines. And overexpressed TRIM26 significantly suppressed the epithelial‐to‐mesenchymal transition process of PTC cells, and obviously decreased the lactate production and glucose uptake in PTC cells. It has been also reported that TRIM26 was a novel tumor suppressor of hepatocellular carcinoma (HCC). In HCC, TRIM26 was found markedly decreased in HCC tissues compared with the normal tissues, and the low TRIM26 expression was closely associated with the poor prognosis of HCC patients. And silence of TRIM26 promoted cell proliferation, migration, invasion, and colony forming of HCC cells. In this study, we found that TRIM26 was also markedly down‐regulated in both of NSCLC tissues and cell lines, and high expression of TRIM26 predicted a positive index for NSCLC patients. In addition, overexpression of TRIM26 significantly inhibited NSCLC cell growth, which indicated that TRIM26 acted as a novel tumor suppressor in NSCLC.
PTEN is the first reported tumor suppressor with phosphatase activity, and it is a tumor suppressor gene closely related to tumorigenesis after p53 and Rb genes reported. Its main mechanism is that PTEN is the main negative regulator of PI3K/AKT pathway. It is known that the RING domain gives to the TRIM proteins a role as E3 ubiquitin ligases in the ubiquitination process involved in proteasomal degradation other than non‐proteasomal pathways. The contribution of TRIM26 to PTEN stability is still unknown. It is interesting that PI3K/AKT activation induces PTEN ubiquitination and destabilization through the MKRN1 E3 ligase. It implies that PI3K/AKT signals enforce positive‐feedback regulation by suppressing PTEN function. And in the present study, we speculated that TRIM26 inhibited PI3K/AKT signaling by stabilizing PTEN in NSCLC cells, and the contribution of TRIM26 to PTEN stability will be further investigated in our future work.
In conclusion, this study indicated that TRIM26 was functional in NSCLC cells, and exerted its anti‐tumor effect by suppressing PI3K/AKT signaling in NSCLC cells. It also suggested that TRIM26 could be as a potential target for the treatment of NSCLC in the future.
All authors declare no conflict of interest.
© 2020. This work is published under http://creativecommons.org/licenses/by-nc-nd/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Luo, Man 1 ; Sun, Hong 1 ; Hong‐Mei Zhao 1 ; Qing‐Song Sun 1 ; Zi‐Ming Huang 2
1 Department of Emergency, The Affiliated Huaian No.1 People's Hospital of Nanjing Medical University, Huai'an, China
2 Department of Emergency Surgery, The Affiliated Huaian No.1 People's Hospital of Nanjing Medical University, Huai'an, China