1. Introduction
Soil salinization has become one of the harmful factors for the loss of cultivated land. Most of the world’s arable lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy [1]. The total areas of global saline-alkali soil have even reached 1.0 × 108 hm2 since in the 1980s, which are still expanding [2]. Plant growth and development are affected by salt stress due to the destruction of osmotic balance and water deficiency [3,4,5].
When plants suffer from salt stress, Na+ will enter the cells through the non-selective ion channels and high-affinity K+ transporter-1 (HKT1) protein [6]. A high concentration of salt will disturb the balance of ions. Therefore, maintaining or reconstructing ionic equilibrium is essential for plants, the key of which is to reduce the concentration of Na+ in the cytoplasm. Plants relieve the harmful effects of excessive Na+ by separating Na+ into the vacuoles or removing Na+ from the cells [7]. The capacity of Na+ compartmentalization and exclusion was mainly relying on the activities of ion transporters [8]. Ion transporters mainly consist of HKT1 and Na+/H+ antiporter (NHX) in plants under salt stress [9,10]. The former can regulate the long-distance transport of Na+, while the latter can control the compartmentalization or efflux of Na+.
Na+/H+ antiporter is belongs to the NHX gene family and is widely distributed in all organisms [11]. Na+/H+ antiporter could be recognized as homodimers in the cell membrane, with 10–12 transmembrane regions at the N terminus. The highly conservative regions of TM6 and TM7 could transport Na+ and H+ [12]. NHX genes play significant roles in osmotic regulation, stoma regulation and flower development [13,14]. The salt-tolerant effect of NHX genes has been highlighted, with the production of salt-tolerant transgenic plants. The NHX genes have also been identified in many plants, but the number of members is varied. For instance, there are eight NHX genes in Arabidopsis thaliana. (L.) Heynh [15], six in grapevine (Vitis vinifera L.) [16], five in sugar beet (Beta vulgaris) [17], seven in sorghum (Sorghum bicolor (L.) Moench) [18], 10 in soybean (Glycine max (L.) Merr.) [6], and 25 in cotton (Gossypium barbadense L.) [19]. Among the eight NHX genes in Arabidopsis, AtNHX1, AtNHX2, AtNHX3, and AtNHX4 were located on the vacuolar membrane; AtNHX5, and AtNHX6 were located on the endosomal; and AtNHX7 (AtSOS1) and AtNHX8 were located on the plasma membrane. They were divided into Vacu-clade, Endo-clade, and Plas-clade, respectively, according to their subcellular location [15,17]. AtNHX1, AtNHX2, AtNHX3, AtNHX4, AtNHX5, and AtNHX6 could participate in vesicle transport and cell expansion activities and regulate pH and K+. AtNHX7 endowed plants with salt tolerance by the SOS (Salt overly sensitivity) pathway. The SOS pathway includes SOS1, SOS2 (serine/threonine protein kinase), and SOS3 (calcineurin), and the SOS2-SOS3 compound could regulate SOS1 to remove Na+ from the cell [20,21]. AtNHX8 located on the plasma membrane, was also considered a Li+/H+ antiporter [22,23].
Pomegranate (Punica granatum L.) belongs to the Lythraceae family, with significant ecological, cultural and economic values [24,25,26]. Pomegranate with moderate salt tolerance is predominantly grown in arid and semi-arid regions [27,28]. Bhantana et al. [29] pointed out that pomegranate could be listed as a model crop for perennial deciduous fruit trees, and it is of a great significance for investigation into the response mechanism to abiotic stress. Our previous study found that Na+ accumulation in pomegranate tissues was closely associated with its salt tolerance under NaCl stress [27,28]. Thus, studying the NHX genes and their expression patterns in pomegranate tissues will contribute to revealing the mechanisms of Na+ uptake and transport. However, there are few studies based on the Na+/H+ antiporter, despite many kinds of research focused on the pomegranate salt tolerance [30,31,32].
In the present study, the NHX gene family in pomegranate was identified based on the genome sequences (ASM220158v1) [33]. Additionally, various characteristics of PgNHX genes were analyzed, including their conserved domains, gene structures, phylogenetic relationship, cis-acting elements, protein-protein interaction network, and qRT-PCR analysis. Our results could reveal the roles of PgNHXs in response to salt stress, and our study aimed to provide a valuable reference for the further functional verification of the NHX genes in pomegranate.
2. Materials and Methods
2.1. Identification and Sequence Analysis of PgNHXs
We downloaded the protein sequences of the NHX genes in Arabidopsis from the Arabidopsis Information Resource (TAIR) database (
The physicochemical properties of PgNHX proteins were predicted by ExPASy online tools (
2.2. Phylogenetic Analysis
Multiple sequence alignment was conducted by Clustal W (v2.1, Dublin, Ireland) using the NHX protein sequences from eight angiosperms, including two monocots Oryza sativa L. (Os, four sequences, 485–545 aa) and Zea mays L. (Zm, six sequences, 538–545 aa), and six core eudicots Arabidopsis thaliana (L.) Heynh. (At, eight sequences, 503–1146 aa), Citrus sinensis (L.) Osbeck (Cs, six sequences, 439–1148 aa), Eucalyptus grandis Hill ex Maiden (Eg, six sequences, 525–1145 aa), Pucica granatum L. (Pg), Populus euphratica Oliv. (Pe, seven sequences, 423–1145 aa), and Vitis vinifera L. (Vv, six sequences, 524–541 aa). All accession numbers and sequences of NHX proteins were presented in Supplementary File S1. The result of multiple sequence alignment of NHXs was visualized by Jalview [41]. A whole phylogenetic tree was constructed by MEGA (v5.0) [42] with the following settings: the neighbor-joining (NJ) method, 1000 bootstrap replicates, the Jones-Taylor-Thornton (JTT) model, and pairwise deletion. The EvolView (
2.3. Motif Identification and Gene Structure Analysis
Multiple Expectation Maximization for Motif Elicitation (MEME) (
The coding sequence (CDS) was aligned with the corresponding pomegranate genomic DNA sequences to generate the intron/exons of PgNHX genes and analyze gene structures. Gene structures could be demonstrated using the TBtools (v1.075, Guangzhou, China) [45].
2.4. Protein Tertiary Structure and Protein Interaction Network Analysis
To investigate the tertiary structure of PgNHX proteins, I-TASSER (
We analyzed the interaction network of PgNHX proteins using a model plant Arabidopsis on the String protein interaction database (
2.5. Cis-Acting Elements Located in NHX Gene Promoters
Based on the pomegranate genome, 1500 bp upstream sequences of NHX genes were acquired. PlantCARE (
2.6. Plant Material, Treatment, and qRT-PCR Analysis
One-year-old ‘Taishanhong’ pomegranate cuttings were grown in pots (32 cm×25 cm) filled with a mixture substrate (turf and perlite 1:1), which were put in a phytotron of the Nanjing Forestry University (Nanjing, China) with a photoperiod of 14 h lighting/10 h darkness, temperatures of 28 °C (lighting)/22 °C (darkness), and 60% humidity. Three completely randomized blocks were designed in the present study with a total of 24 pots. Every eight pots were designed as a block, and there were two pots per biological replicate, each plot containing one plant. The mixed solution containing 0 (control), 100, 200, or 300 mM NaCl (Guangzhou Chemical Reagent Factory, Guangzhou, China) supplemented with half-strength Hoagland’s nutrient solution (Shanghai yuanye Bio-Technology Co., Ltd, Shanghai, China) was watered in each pot every 6 days, respectively. Moisture was maintained by placing a saucer under each container. All samples of leaves and roots were collected separately after 18 days of treatments.
Total RNA was extracted from pomegranate leaves and roots using a Trizol Total RNA Kit (Bio Teke, Wuxi, China). After that, the extracted RNA was used as a template for reverse transcription to obtain cDNA using the PrimeScriptTM RT reagent kit with gDNA Eraser (TaKaRa, Beijing, China). As shown in Table 1, there were sequences of primers used for qRT-PCR. The PCRs were performed on 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with a TB Green Premix Ex TaqTM II Kit (TaKaRa, Beijing, China). The thermal cycler was set as follows: (a) 95 °C for 34 s, 95 °C for 5 s, 60 °C for 34 s for 40 cycles, and at the second step of each cycle, fluorescence was obtained; (b) a dissolution curve was acquired as followed: 95 °C for 15 s, 60 °C for 60 s and 95 °C for 15 s. Three biological replicates were used for this study. The method of 2−ΔΔCT [49] was adopted to represent relative expression levels of the PgNHX genes. The logarithm (base 2) was taken for the relative expression values, and represented by TBtools with heatmap.
3. Results
3.1. Identification and Sequence Analysis of PgNHXs
In total, 10 putative PgNHX genes were identified from the pomegranate genome. All the PgNHX genes were renamed according to the order of protein id. The physical and chemical properties showed that the CDS length of 10 PgNHXs ranged from 1419 bp (PgNHX09) to 3582 bp (PgNHX10) (Table 2). The amino acid lengths were exhibited from 472 aa (PgNHX09) to 1193 aa (PgNHX10). The molecular weight ranged from 52.60 kDa (PgNHX09) to 132.31 kDa (PgNHX10). The predicted pI ranged from 5.45 (PgNHX07) to 9.32 (PgNHX09). The PgNHX04 and PgNHX07 were unstable proteins with high protein instability index (45.44 and 43.64 respectively), while other PgNHX proteins were stable. The grand average of hydropathy (GRAVY) value varied from 0.103 (PgNHX10) to 0.577 (PgNHX09), suggesting that all PgNHX proteins were hydrophobins. None of the PgNHX were secretory proteins and none had any signal peptide (Figure S1). In total, 10 PgNHXs were typical transmembrane transporters. PgNHX04 contained 12 transmembrane helices. PgNHX01 and PgNHX09 contained 11 transmembrane helices. The other seven proteins had ten transmembrane helices (Figure S2). The prediction of subcellular localization showed that most of these PgNHX proteins might located in the vacuoles, while PgNHX03 could be found in the vacuoles and on the cell membranes, and PgNHX10 was only located on the cell membranes.
3.2. Phylogenetic Analysis
NHX proteins with full-length sequences from pomegranate and the other seven species were used to construct a phylogenetic tree to analyze the phylogenetic relationship of PgNHX genes (Figure 1). According to the phylogenetic tree, all the NHX proteins were divided into three obvious clades: clades I, II and III, with strong support (Bootstrap = 100%). Clade I was the largest clade, including 38 NHXs (7 PgNHXs). Clade II was the smallest clade including 7 NHXs (PgNHX07). Clade III had 8 NHXs, including PgNHX03 and PgNHX10.
3.3. Motif Identification and Gene Structure of PgNHXs
A combined figure, including a phylogenetic tree, multiple sequence alignment, conserved motifs, and sequence logo showed characteristics of the NHX gene family (Figure 2). The conservative motif distribution of PgNHX proteins were consistent with the phylogenetic tree. Hence, PgNHXs in the same clade presented similar conserved motif compositions. Here, motifs 1–10 were mainly presented in clade I. However, motif 3 were absent from clades II and III, and motif 4 was lost in clade II. Interestingly, the amiloride-binding site (FFI/LY/FLLPPI), a typical feature of NHX protein, was presented in motif 1. We could see that the site was presented in most NHX proteins, but absent from clade III. There were differences in the amiloride-binding site concerning the composition. For instance, most of the proteins were FFIYLLPPI in clade I, while FFLFLLPPI in clade II. Residue IY or LF at this position could be known to be related to its sensitivity to amiloride [15]. Differentiation of sensitivity to amiloride indicated for NHX in different tissues is most likely involved in the structure of the protein, such as an accessory regulatory co-factor [50]. Those results might reveal that evolutionary patterns exist in this amiloride-binding site.
Members from the same clade had similar gene structures, including the exon/intron number, intron phase, and exon length (Figure 3). The results of the gene structure showed that PgNHX09, PgNHX07, PgNHX03, and PgNHX10 contained 13, 22, 21, and 23 exons, respectively, while other 6 PgNHX genes all had 14 exons. Overall, there was a unique and relatively conservative intron-exon arrangement.
3.4. Protein Tertiary Structure and Protein Interaction Network Analysis
All the NHX proteins in pomegranate were modeled by I-TASSER to understand their functional mechanism. Based on the ideal structural templates and crystal structures from PDB, tertiary structures of PgNHX protein were obtained (Figure 4). The confidence of constructed models evaluated by C-score, showed that its value generally ranged from −5 to 2, and that the more reliable model had a higher value. In this study, the ten predicted NHX protein models in pomegranate with a high credibility, C-score varied from −1.92 (PgNHX09) to −0.11 (PgNHX10) (Table 3). Most proteins shared the same PDB hit 4cz8A, indicating that their tertiary structures were similar.
To further explore the potential function, signal transduction and metabolic pathways of the PgNHX members, the protein-protein interaction network was constructed with the online tool String (Figure 5). All of them were on the protein-protein interaction network, and they shared the same putatively interactive proteins, including AVP1 (AT1G15690.1), HKT1 (AT4G10310.1), SOS2 (AT5G35410.1) and SOS3 (AT5G24270.2). AVP1 was involved in the regulation of apoplastic pH and auxin transport. HKT1 could play a significant role in Na+ recirculation to roots from shoots. SOS2 and SOS3 were involved in the regulatory pathway of salt stress by controlling intracellular Na+ and Ca2+ homeostasis, and directly interacted with SOS1 (PgNHX03and PgNHX10), NHX1 (PgNHX01 and PgNHX08), and NHX2 (PgNHX02, PgNHX04, PgNHX05 and PgNHX06). Additionally, the interaction between SOS1 and RCD1 (AT1G32230.1), might respond to high salt or oxidative stress. All PgNHX proteins worked together to response to salt stress.
3.5. Cis-Acting Elements Located in Promoters of PgNHXs
We submitted upstream 1500 bp sequences in the promoter region to PlantCARE to obtain cis-acting elements. The results showed that 20 cis-elements involved in abiotic stress were found, including LTR, O2-site, ABRE, G-Box, CAAT-box, TGA-element, GARE-motif, CGTCA-motif, GATA-motif, MBS, MRE, Sp1, P-box, TATC-box, Box 4, TCA-element, TCCC-motif, TGACG-motif, and AuxRR-core (Figure 6 and Table S1).
Most of the members contained ABA-responsive element ABRE, except PgNHX04. Half of the PgNHX genes contained the low-temperature stress response element LTR. PgNHX genes all contained two or more elements related to light responsiveness, including ACE, MRE, Sp1, Box 4, G-Box, GATA-motif, and TCCC-motif. 60% of the PgNHX genes contained elements of the GARE-motif, P-box and TATC-box and were involved in gibberellin response. All of the members of PgNHX genes contained MeJA responsive elements, CGTCA-motif and TGACG-motif. Only PgNHX02 and PgNHX05 contained the drought-inducibility element MBS. Only PgNHX01 and PgNHX06 contained the salicylic acid responsive element TCA. A total of 20% and 40% of PgNHX genes contained the auxin response element AuxRR-core and TGA-element. Above all, PgNHX genes might be related to the process of photosynthetic, hormone and adversity stress, and regulation of growth and development.
3.6. qRT-PCR Analysis of PgNHXs under Salt Stress
The results of the qRT-PCR analysis of PgNHX genes indicated that the expression patterns were tissue-specific under different NaCl treatments (Figure 7 and Table S2). Interestingly, the relative expression levels of all PgNHX genes in leaves were up-regulated, while most of PgNHXs were down-regulated or not changed in roots. At a low salinity level (100 mM NaCl), the relative expression levels in leaves were up-regulated, compared with the control (0 mM NaCl). The up-regulated expression of PgNHX10 was almost 9-fold higher than that found in control plants. However, most of the PgNHX genes were the down-regulation in roots compared with control, especially PgNHX01. Under moderate salt stress (200 mM NaCl), the relative expression levels were increased continuously in leaves, except PgNHX02 and PgNHX08. Meanwhile, PgNHX02 and PgNHX09 were up-regulated in roots compared with control. When subjected to severe salt stress (300 mM NaCl), the relative expression level still increased in leaves, and the expression level of PgNHX04 in roots was higher than other treatments.
4. Discussion
The NHX genes, coding for the Na+/H+ antiporter, belong to the CPA1 family. The Na+/H+ antiporter plays critical roles in the steady state of K+ and pH, leaf development and responses to salt stress [13,14,51]. In the present study, we identified 10 NHX genes in pomegranate. PgNHX proteins all contained Na+/H+ exchanger domains, which were relatively conservative in the evolution.
According to the phylogenetic tree, all genes were divided into three clades. Among them, PgNHX01, PgNHX02, PgNHX04, PgNHX05, PgNHX06, PgNHX08, PgNHX09 and AtNHX01, AtNHX02, AtNHX03, AtNHX04 of the Arabidopsis were on the same branch of cladeI. PgNHX07, AtNHX05 and AtNHX06 were on the same branch of clade II. PgNHX03, PgNHX10, AtNHX07 and AtNHX08 were on the same branch of clade III. Members of the same branch in the evolutionary tree might have similar biological functions. The evolutionary relationship was highly consistent with the subcellular location classification of G.max, Brachypodium distachyon (L.) Beauv., Populus trichocarpa Torr. & Gray ex Brayshaw and Beta vulgaris L. [17,52,53] As mentioned above, the NHX members of Arabidopsis were divided into three clades, according to its subcellular location: vacuolar membrane, endosomal and plasma membrane [15]. However, subcellular locations of PgNHX proteins were not consistent with Arabidopsis. Most of the PgNHX proteins were located in the vacuoles, while there were fewer on the cell membranes. Accordingly, this might indicate that the NaCl resistant mechanism of pomegranate was chiefly through the regionalization of Na+ into vacuoles.
In pomegranate, clade I had fewer exons (13–14) than other two clades (21–23). The results were in line with the NHX proteins in sugar beet, soybean, and poplar [6,17,52]. Our result showed clearly that their gene structures were highly conserved. Additionally, the same clade had similar motif compositions, indicating that the gene structures of the NHX gene family were relatively conserved during evolution. The binding site of amiloride (FFI/LY/FLLPPI) is one of the typical characteristics of NHX proteins. NHX is highly sensitive to amiloride, and could be completely inhibited due to the high affinity of its specific amino acid residue to amiloride. Na+ and amiloride could have the same functional binding site, according to amiloride, which was a competitive inhibitor of NHX mediating Na+ transport [54,55]. In this study, the binding site of amiloride was found in most members, but missing in three members, including PgNHX03, PgNHX09 and PgNHX10. Similar amiloride-binding sites were observed in V.vinifera, A.thaliana, P.trichocarpa and S.bicolor [11,18,52]. This finding implied that the motif (FFI/LY/FLLPPI) on the transmembrane region of PgNHX is sensitive to the Na+ of the substrate.
There were many cis-acting elements involved in hormone or abiotic stress response in the promoter region of the PgNHX genes. For example, most of the PgNHX genes had elements related to abscisic acid (ABA) regulation, low temperature, light, gibberellins, etc. These results might indicate that PgNHX genes participated in the growth and development of pomegranate through different hormone regulation pathways, abiotic stress response, and other physiological processes.
The protein-protein interaction network showed that the PgNHXs played a crucial role in salt-stress resistance. In the present study, we found that all PgNHX proteins shared the same putatively interactive protein AVP1, HKT1, SOS2 and SOS3. All of these putatively interacted proteins play essential roles in response to abiotic stress. Overexpression of the AVP1 can increase the plant’s tolerance to salt in Arabidopsis [56]. Romero-Aranda et al. [57] pointed out that HKT1 can improve salt tolerance by extracting Na+ from the xylem of different tissues and organs. SOS2 can encode a protein kinase to alleviate salt stress in Arabidopsis [58]. SOS3 is a Ca2+ sensor, which can escort SOS2 and SOS1 to promote Na+ efflux from the cells [18]. As shown in the summarized diagram, salt tolerance regulation is a multi-way regulation network (Figure 8). It is highly consistent with previous findings [58,59]. The increases in the transcription level of H+-ATPase, result in improving tolerance to salinity [60]. Moreover, we can also regulate the amount of K+ by AKT1 to reduce salt damage [59]. It is well know that many plants tend to adapt to high salinity environments by maintaining a high K+/Na+ ratio. Notably, AKT1 plays important roles in K+ uptake, maintenance and restoration of K+ homeostasis under salt stress. The overexpression of AKT1 in transgenic Arabidopsis also indicates that AKT1 could enhance the salt resistance [61,62]. As explained above, the response processes of plant growth, development, biotic and abiotic stresses are closely related. Thus, they may have similar regulatory functions, and simultaneously induce expression during stress.
The results of qRT-PCR suggested that the relative expression levels of PgNHXs had tissue-specific expressional patterns in pomegranate under salt stress, and the expression levels in leaves were higher than roots. Such results might be due to the stimulation of PgNHXs with the increasing of NaCl concentration, Na+ in leaf transfers from cytoplasm to vacuole, which were timely and effective, resulting in reducing ion toxicity [63]. Most genes showed adverse regulatory effects in roots, except PgNHX06. Under low and moderate salt stress, as the Na+ accumulated, the relative expression levels in leaves of pomegranate increased as well. Thus, Na+ could be up-taken or sequestrated in the vacuoles of leaves. At a high salinity level, some PgNHX genes still had higher expression levels. However, at the same time, PgNHX01 could not compartmentalize excessive Na+ in leaves so that expression level was drastically reduced in leaves. The results of tissue-specific expressional patterns of NHX were similar to Quintero et al. [64] and Wu et al. [65], and Na+ accumulation resulted in up-regulation in leaves rather than roots. Thus, the PgNHX genes might perform the different functions in pomegranate roots and leaves. PgNHXs might alleviate the harmful effects of Na+ via sequestrating the excessive Na+ into vacuoles of leaves and reducing the Na+ accumulation in roots.
5. Conclusions
In the present study, 10 PgNHX genes were identified, and the same clade had similar motif compositions and gene structures. The tissue-specific expressional patterns were displayed in PgNHX genes, with relatively low expression levels in roots and high expression levels in leaves under different concentrations of NaCl stress. The PgNHX genes were related to the uptake and transport of Na+ in pomegranate. Overall, our results could provide a reference for further research on the stress response of PgNHX and the functional verification of PgNHX.
Supplementary Materials
The following are available online at
Author Contributions
Conceptualization, J.D. and Z.Y.; methodology, Y.W. and D.G.; software, Y.W.; formal analysis, J.D.; investigation, J.D. and C.L.; writing—original draft preparation, J.D.; writing—review and editing, J.D., C.L., Y.W., Y.Z., D.G. and Z.Y.; supervision, C.L., Y.W., Y.Z. and Z.Y.; funding acquisition, Z.Y. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded jointly by the Tibet Autonomous Region Natural Science Foundation [XZ201019ZRG-153], the Initiative Project for Talents of Nanjing Forestry University [GXL2014070, GXL2018032], the Priority Academic Program Development of Jiangsu High Education Institutions [PAPD], and the Natural Science Foundation of Jiangsu Province [BK20180768].
Conflicts of Interest
The authors declare no conflict of interest.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Figures and Tables
Figure 1. The phylogenetic tree of the NHX gene family, and sequences from Arabidopsis thaliana (L.) Heynh. (At), Citrus sinensis (L.) Osbeck (Cs), Eucalyptus grandis Hill ex Maiden (Eg), Oryza sativa L. (Os), Populus euphratica Oliv. (Pe), Punica granatum L. (Pg), Vitis vinifera L. (Vv) and Zea mays L. (Zm). Various branch colors indicate different clades. The species are presented by various font colors. The values of bootstrap are presented by three coloured pots.
Figure 2. Phylogenetic tree, alignments and conserved motifs of the NHX gene family. (A) The phylogenetic tree of 53 NHX proteins as shown in Figure 1. (B) Multiple sequence alignment of the amiloride-binding site. (C) Conserved motifs in the PgNHX proteins. Different colored boxes represented different conserved motifs. (D) Sequence logo of motifs 1, 3 and 4.
Figure 3. Phylogenetic tree, and gene structures of the PgNHX genes. (A) The phylogenetic tree of 10 PgNHX proteins. (B) Gene structures of the PgNHX genes. Blue boxes represent exons. Yellow boxes represent UTR.
Figure 4. Tertiary structure of PgNHX proteins. The models of proteins were obtained by the online server I-TASSER. The α-helix, β-strand, and random coil are marked by red, yellow and blue, respectively. The parameters of the best PDB structure for PgNHXs are listed in Table 3.
Figure 5. Protein-protein interaction network of PgNHX protein was analyzed by the Tool String. Network nodes represent proteins. Colored nodes represent query proteins and first shell of interactors. Empty nodes indicate proteins of unknown 3D structure. Filled nodes indicate that some 3D structure is known or predicted.
Figure 6. Cis-acting elements analysis of PgNHX genes. Note: ABRE was involved in the abscisic acid responsiveness; LTR involved in low-temperature responsiveness; ACE, MRE, Sp1, Box 4, G-Box, GATA-motif, and TCCC-motif were involved in light responsiveness; O2-site was involved in zein metabolism regulation; CAAT-box was involved in promoter and enhancer regions; TGA-element and AuxRR-core were involved in auxin-responsiveness; GARE-motif, P-box and TATC-box involved in gibberellin-responsiveness; CGTCA-motif and TGACG-motif were involved in the MeJA-responsiveness; MBS was involved in drought-inducibility; TCA was involved in salicylic acid responsiveness.
Figure 7. The relative expression levels of the PgNHX genes in leaves and roots under different NaCl treatments. T1, T2, T3, T4 represented the different treatments of 0, 100, 200, 300 mM NaCl in leaves, respectively. T5, T6, T7, T8 represented the different treatments of 0, 100, 200, 300 mM NaCl in roots, respectively.
Figure 8. Cell signaling pathways that regulate activities of ion transporters to maintain K+/Na+ homoeostasis under salt stress.
The sequences of primers used for qRT-PCR.
| No. | Gene Name | Gene ID | Forward Primer Sequence (5′-3′) | Reverse Primer Sequence (5′-3′) |
|---|---|---|---|---|
| 1 | PgNHX01 | CDL15_Pgr020251 | AGTTGCTCGGAACCTTTCTC | CAGCATCATGAGAGCGACTT |
| 2 | PgNHX02 | CDL15_Pgr020284 | TGGGACATACTCATCTGCGA | CCATGCTGGTCCTATGCTTT |
| 3 | PgNHX03 | CDL15_Pgr013571 | TGTGATTGAACCTCCAGCAG | CTGTCCTTGCAATCGTCTCA |
| 4 | PgNHX04 | CDL15_Pgr008437 | AGCTCGTCAGTGATAGTCCA | TGATCTGTTGCTTCCAGTCG |
| 5 | PgNHX05 | CDL15_Pgr018608 | CTGATTATGGTGGGAAGGGC | TCCTGACCTCGTGAACTGAT |
| 6 | PgNHX06 | CDL15_Pgr016272 | CTTCCATCGTGACTGGACTG | GAGAGCCGTGATTGATTCGT |
| 7 | PgNHX07 | CDL15_Pgr004028 | GTTAGGCCTGCACATCGTAA | ACTATAGCTGTGGTAGCCGT |
| 8 | PgNHX08 | CDL15_Pgr019015 | TACTTTCGGCAACGGATTCA | GGCATCATTCACGACTCCTT |
| 9 | PgNHX09 | CDL15_Pgr012091 | TGTGCTCGATGCTCCATGTT | AGTCACGGCTTGCGTTCATA |
| 10 | PgNHX10 | CDL15_Pgr021015 | CACAGGCACTCTGTTTGTCT | CCAATATTCGCCTCTTCGCT |
| 11 | PgACTIN | CDL15_Pgr015157 | AGTCCTCTTCCAGCCATCTC | ACTGAGCACAATGTTTCCA |
The identification and sequence analysis of the Na+/H+ antiporter (NHX) gene family in pomegranate.
| Gene Name | Protein ID | CDS |
Length |
MW |
pI | Instability |
GRAVY | TMHs | Subcellular Localization |
|---|---|---|---|---|---|---|---|---|---|
| PgNHX01 | OWM62957.1 | 1644 | 547 | 60.4 | 8.67 | 36.23 | 0.574 | 11 | Vacuole |
| PgNHX02 | OWM62990.1 | 1659 | 552 | 61.0 | 7.74 | 34.04 | 0.545 | 10 | Vacuole |
| PgNHX03 | OWM66354.1 | 2826 | 941 | 103.8 | 5.59 | 35.77 | 0.425 | 10 | Cell membrane; Vacuole |
| PgNHX04 | OWM74126.1 | 1632 | 543 | 60.6 | 9.21 | 45.44 | 0.479 | 12 | Vacuole |
| PgNHX05 | OWM78039.1 | 1617 | 538 | 59.5 | 9.32 | 35.22 | 0.571 | 10 | Vacuole |
| PgNHX06 | OWM78548.1 | 1626 | 541 | 60.4 | 8.17 | 39.49 | 0.476 | 10 | Vacuole |
| PgNHX07 | OWM83599.1 | 1647 | 548 | 60.0 | 5.45 | 43.64 | 0.401 | 10 | Vacuole |
| PgNHX08 | OWM85391.1 | 1653 | 550 | 60.3 | 8.32 | 36.53 | 0.546 | 10 | Vacuole |
| PgNHX09 | OWM85841.1 | 1419 | 472 | 52.6 | 6.94 | 35.40 | 0.577 | 11 | Vacuole |
| PgNHX10 | OWM90710.1 | 3582 | 1193 | 132.3 | 6.58 | 39.11 | 0.103 | 10 | Cell membrane |
Structural dependent modeling parameters for the PgNHX proteins.
| Protein | C-Score | TM-Score | RMSD (Å) | Best Identified Structure Analogs in PDB | ||||
|---|---|---|---|---|---|---|---|---|
| PDB Hit | TM-Scorea | RMSDa | IDENa | Cov | ||||
| PgNHX01 | −1.69 | 0.51 ± 0.15 | 11.5 ± 4.5 | 4cz8A | 0.707 | 1.06 | 0.209 | 0.717 |
| PgNHX02 | −1.21 | 0.56 ± 0.15 | 10.4 ± 4.6 | 4cz8A | 0.701 | 1.08 | 0.227 | 0.710 |
| PgNHX03 | −0.66 | 0.63 ± 0.14 | 10.3 ± 4.6 | 6xteA | 0.925 | 0.96 | 0.089 | 0.932 |
| PgNHX04 | −1.50 | 0.53 ± 0.15 | 11.0 ± 4.6 | 4cz8A | 0.702 | 1.50 | 0.210 | 0.720 |
| PgNHX05 | −1.67 | 0.51 ± 0.15 | 11.5 ± 4.5 | 4cz8A | 0.697 | 1.93 | 0.204 | 0.729 |
| PgNHX06 | −1.80 | 0.50 ± 0.15 | 11.8 ± 4.5 | 4cz8A | 0.702 | 1.51 | 0.223 | 0.723 |
| PgNHX07 | −1.48 | 0.53 ± 0.15 | 11.0 ± 4.6 | 6z3yB | 0.690 | 1.31 | 0.402 | 0.704 |
| PgNHX08 | −0.81 | 0.61 ± 0.14 | 9.4 ± 4.6 | 4cz8A | 0.702 | 1.17 | 0.212 | 0.713 |
| PgNHX09 | −1.92 | 0.48 ± 0.15 | 11.8 ± 4.5 | 6z3yB | 0.742 | 1.38 | 0.301 | 0.761 |
| PgNHX10 | −0.11 | 0.70 ± 0.12 | 9.6 ± 4.6 | 6r9tA | 0.986 | 0.87 | 0.105 | 0.991 |
Note: C-score ranged from −5 to 2, which signifies the confidence of each model. A higher value suggests a model with a higher confidence and vice-versa. TM-score and RMSD are evaluated derived from the C-score value and the protein length following the correlation observed between these qualities. The TM-scorea represents a measure of global structural similarity between query and template protein. RMSDa represents the RMSD between residues that are structurally aligned by TM-align. IDENa represents identity of the percentage sequence in the structurally aligned region. Cov is coverage, representing the coverage of the alignment by TM-align, and its value is equal to the number of structurally aligned residues divided by length of the query protein.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Most cultivated lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy. High NaCl concentrations in the soil result in the accumulation of toxic Cl− and Na+ in plants. Na+/H+ antiporter (NHX) can regulate Na+ compartmentalization or efflux to reduce Na+ toxicity. This study aims to identify the NHX genes in pomegranate (Punica granatum L.) from the genome sequences and investigate their expression patterns under different concentrations of NaCl stress. In this study, we used the sequences of PgNHXs to analyze the physicochemical properties, phylogenetic evolution, conserved motifs, gene structures, cis-acting elements, protein tertiary structure and expression pattern. A total of 10 PgNHX genes were identified, and divided into three clades. Conserved motifs and gene structures showed that most of them had an amiloride-binding site (FFI/LY/FLLPPI), except for the members of clade III. There were multiple cis-acting elements involved in abiotic stress in PgNHX genes. Additionally, protein-protein interaction network analysis suggested that PgNHXs might play crucial roles in keeping a balance of Na+ in cells. The qRT-PCR analysis suggested that PgNHXs had tissue-specific expressional patterns under salt stress. Overall, our findings indicated that the PgNHXs could play significant roles in response to salt stress. The theoretical foundation was established in the present study for the further functional characterization of the NHX gene family in pomegranate.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China;




