This work is licensed under http://creativecommons.org/licenses/by/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
1. Introduction
There are several drugs available for cancer chemotherapy that can be used alone or in combination with other agents to treat a wide range of malignancies. Although chemotherapy is an efficient process to treat many types of cancer, it usually has toxic side effects depending on the type and dose of the drug. Some side effects of chemotherapy are mild and treatable such as nausea and hair loss, while others can cause serious side effects like infection [1]. The basic mechanism of action of anticancer agents is working on cells with a high rate of division. Based on this mechanism of action, other normal cells with a high rate of division, such as the gastrointestinal epithelium, are affected too. 5-Fluorouracil (5-FU) belongs to the category of anticancer and antimetabolite drugs. 5-FU inhibits DNA synthesis during the S phase of the cell cycle by limiting the availability of thymidylate [2]. It is used alone or in combination with other common drugs in the treatment of various cancers, including breast, head and neck, anal, stomach, colorectal, and some skin cancers [3–5]. The mechanism of action of 5-FU is associated with interference with DNA synthase and inhibition of thymidylate synthase. 5-FU, like other anticancer drugs, has many side effects that reduce the patient's quality of life by causing various destructive effects and sometimes interrupt treatment [6–8]. The most common side effects are nausea, diarrhea, vomiting, oral and intestinal mucositis, mouth ulcers, loss of appetite, light sensitivity, metallic taste, neutropenia, and thrombocytopenia [7]. Oral mucositis (OM) is an important and common side effect of chemotherapy with 5-FU treatment. Its incidence is 40% in chemotherapy and almost 100% in combination with chemotherapy and radiotherapy [9–11]. Chemotherapy-induced OM with anticancer drugs may initiate swelling, erythema, or ulcers. It can also involve a wide range of changes, from mild burning sensitization to painful wounds. OM symptoms consist of sleep and eating disorders, communication barriers, and severe pain, which can affect patients’ quality of life [12]. Also, these symptoms can even interrupt the course of treatment [13, 14]. These lesions start when the oral mucosa is exposed to chemical agents, causing DNA destruction and cell death. They are commonly caused by the production of reactive oxygen species (ROS) and oxidative stress [15]. Various studies have shown that the origin and extent of these lesions can be controlled by using antioxidants. Antioxidants protect cells from oxidative stress damage by neutralizing the ROS and preventing their formation [16–18].
Preventing or improving OM can increase the patient’s quality of life and uninterrupted therapeutic regimen. Currently, the most important methods used to improve OM include cryotherapy, prescribing nonsteroidal anti-inflammatory drugs (NSAIDs), using mouthwash to disinfect the mouth brushing [12, 19] local anesthesia, such as diphenhydramine and using sodium carbonate mixture of promethazine and milk of manganese [20, 21]. These methods do not seem to be effective enough [22]. Anticancer drugs cause OM by two main mechanisms. In addition to directly damaging the mucosa, these drugs also suppress the immune system and predispose to bacterial infections [23]. Anticancer drugs can reduce the secretion and function of mucosa and mucosal cells [24]. On the other hand, using NSAIDs to alleviate adverse reactions of chemotherapeutic agents is problematic and cannot be a good solution to treat and improve mucositis caused by cancer chemotherapy [25].
Quercetin (3,3′,4′,5,7-pentahydroxyflavone) (QRC) is a naturally occurring flavonoid found in large quantities in the diet and its main sources are tea, apples, red wine, onions, broccoli, kale, oranges, and blueberries (Figure 1) [26]. The most important property of this flavonoid is its antioxidant effect, but its oral bioavailability is very low. This flavonoid can prevent cell death and oxidative damage by several mechanisms, such as inhibiting the activity of oxygen free radicals, lipid peroxidation, inhibiting xanthene oxidase, and chelating metal ions [27]. It is also known as an antiallergic, anti-inflammatory, and antiviral compound [28]. QRC can prevent the invasion of malignant tumors of the prostate, liver, lung, breast, colon, and cervix. QRC is easily metabolized by the tyrosinase enzyme to different metabolites which can enhance anticancer activity [29]. Recently, it has been reported that QRC in combination with cisplatin, has synergistic effects in cancer treatment [30]. Also, QRC was used in a double-blind, randomized, placebo-controlled clinical trial to prevent and treat OM due to chemotherapy [31]. QRC nanoparticles have been used in many studies to increase the effectiveness of chemotherapy drugs and improve cancer treatment. It has been reported that QRC nanoparticles can reduce injuries caused by intestinal mucositis caused by methotrexate [32]. In another study, QRC nanoparticles were used to improve abnormal cell growth in breast cancer. The results showed that treating with QRC nanoparticles can result in cell death or preventing from cell proliferation in breast cancer [33]. In another study, silica nanoparticles were used to load QRC and doxorubicin nanoparticles, which increased the quality of chemotherapy in gastric cancer [34]. Based on studies and according to the fact that nanoparticles have a large surface area despite their low weight, they can be more active than other molecules; therefore, we used QRC nanoemulsion to improve OM caused by chemotherapy with 5-FU.
[figure omitted; refer to PDF]
Tissue staining was resolved to consume the hematoxylin and eosin (H & E) experiment. This was accounted for the percentage of H & E-positive cells divided by the total number of cells. Samples were fixed in 10% buffered formalin, fixed in paraffin, and sectioned (in the size of 5 μm). Hematoxylin and eosin were applied for staining.
2.7. Real-Time PCR
2.7.1. Sample Collection
The tissue specimens were collected. About 20–30 mg of tongue tissues was transferred immediately to 1.5 ml RNase and DNase-free microtubes including 200 µl RNA later solution (YektaTajhizAzma, Tehran, Iran). After overnight incubation at 4°C, the tissues were transferred to −80°C until the RNA extraction process.
2.7.2. RNA Extraction
Total RNA was extracted from 20 to 30 mg collected tissues using a total RNA extraction kit (Cat No. A101231, Pars Tous Biotechnology, Mashhad, Iran). The isolated RNA samples’ amount was measured by a NanoDrop spectrophotometer (Thermo Scientific, Wilmington, USA). All the RNA samples were transferred to −80°C until further experimentation.
2.7.3. cDNA Synthesis and Real-Time PCR
Pars Tous cDNA synthesis kit was applied for cDNA synthesis; the mixture was including 250 ng RNA, 5 µl enzyme buffer 2x, 1 µl of reverse transcriptase enzyme, and the mixture reached the 10 µl volume with DEPC treated water. The thermal program was performed using FleXCycler2 by incubating the reaction mixture 10 minutes at 25°C for random hexamer primer annealing, 60 minutes at 47°C for reverse transcriptase reaction, and 5 minutes at 85°C for ending the reaction. In this study, the SYBR Green method was used for real-time PCR assay. The mRNA amplification was performed by ABI step-one plus PCR system (applied biosystem step-one plus PCR, USA) and using AmpliqonRealQ Plus Master Mix Green-high Rox (Ampliqon, Denmark). The specific primers were designed utilizing Oligo7 v 7.60 software and OligoAnalyzer online tool (http://www.idtdna.com); and the sequence of the primers is represented in Table 1. Every 10 µl PCR reaction mixture consisted of 6.25 µl master mix, 0.25 µl of each primer, 2.25 µl RNase free dH2O, and 1 µl cDNA templates. The PCR temperature protocol was started with 95°C for 15 minutes as the first activation temperature then 40 cycles of temperature were performed at 95°C for 15 s, 61, 62, and 63°C for 30 s (according to the appropriate temperatures for each primer), and 72°C for 30 s and then ramped from 60 to 95°C to achieve a melting curve. In this study, GPDH was used as the reference internal control gene.
Table 1
The utilized primers sequence.
| Hif-1α forward | 5`- CCCAAGTACCTCAAGAAACGACC- 3` |
| Hif-1α reverse | 5`- TGACTCTCTTTCCTGCTCTGTCTG -3` |
| NFκB forward | 5`- AGAGGGGATTTCGATTCCGC -3` |
| NFκB reverse | 5`- CCTGTGGGTAGGATTTCTTGTTC -3` |
| GAPDH forward | 5`- TTGGCATTGTGGAAGGGCTCA -3` |
| GAPDH reverse | 5`- TGGATGCAGGGATGATGTTCTGG -3` |
2.8. Statistical Analysis
All data were analyzed via GraphPad Prism v 8.0.2). Results were expressed as the mean ± SEM. The Kruskal–Wallis test was applied to specify whether there were any statistically significant differences between the means of expression of Hif-1α and NfκB among the groups. Investigation of the mean difference among the groups was carried out by Dunn’s multiple comparison test.
3. Results
3.1. Weight Variation
During the 13 days of the experiment, analysis of changes in weight over three days (days 6, 10, and 13) showed that the 5-FU group had less weight gain than the control groups (
3.2. Biochemical Analysis
The results of the MDA test analysis showed a significant decrease in posttreatment and pretreatment of QRC and nano-pretreatment of QRC in comparison to the 5-FU group (
[figures omitted; refer to PDF]
3.3. Effects of QRC Pretreatment and Posttreatment on Histopathological Aspects of 5-FU-Induced OM
The histology of the tongue was normal in the control group, whereas tongue tissue of the 5-FU treatment group had significantly degraded (Table 2) [36]. In the 5-FU group, in addition to hemorrhage, inflammatory cell infiltration and hyalinization occurred in the tongue tissue, although no signs of hemorrhage and infiltration of inflammatory cells were observed in the pretreatment and posttreatment groups (Figure 6).
Table 2
Results of tissue lesions in different groups.
| Groups | Hyperemia | Infiltration of inflammatory cells | Hyaline cells |
| Ctrl | − | − | − |
| 5-FU | + | + | + |
| 5-FU + quercetin NPs pre | − | − | + |
| 5-FU + quercetin NPs post | − | − | + |
| 5-FU + quercetin pre | − | − | + |
| 5-FU + quercetin post | − | − | + |
3.4. Evaluation of Hif-1α and NFκB Expression in Oral Mucosa Using Real-Time PCR
As the results showed, the expression of Hif-1α and NFκB increased in the 5-FU injected group compared to the normal group. The expression of Hif-1α and NFκB downregulated in the posttreatment of the QRC group compared to the 5-FU group but not significantly that assign with
[figures omitted; refer to PDF]
4. Discussion
Chemotherapy, which is one of the main therapies of cancer treatment, works by interfering with the synthesis of protein, DNA, and RNA in cells that have a high rate of division [39]. Therefore, normal tissue cells are damaged along with cancer cells. OM is one of the prevalent adverse effects of cancer chemotherapeutic drugs [40]. As mentioned earlier, one of the mechanisms that lead to the complication of OM is the formation of oxidative stress and free radicals. QRC is used in the present study as a powerful antioxidant and anti-inflammatory that has been used against the toxicity of many neoplastic agents [32, 41]. Induction of mucositis is difficult in the animal model, and the extent of the lesion depends entirely on the induction protocol. In this study, we induced OM according to the previous protocol [37]. In mice, the peak severity of oral mucosal lesions usually occurs 4 days after induction and the onset of recovery within 7 days [42]. In the present study, after the administration of 5-FU on day 6, the signs of oral mucositis appeared at around day 10.
Weight loss during the experiment was mostly observed on the fourth day after mucositis, in which QRC pretreatment and QRC pretreatment in nanoform groups showed less weight loss than the 5-FU group, and approximately seven days after mucosal induction, weight gain increased. Weight loss is a common result of treatment with antineoplastic drugs [43].
At the macroscopic level, the results on the 4th day after mucosal induction in all treatment groups showed a significant difference compared to group 5-FU. However, regarding the macroscopic level on the 4th and 6th days after mucosal induction, only the posttreatment of the QRC group showed a significant difference with group 5-FU. However, in histopathology, the posttreatment group with QRC did not show a significant difference compared to the other groups.
CAT and SOD are endogenous antioxidants that are able to clear free radicals. These enzymes’ activity and their high levels indicate that the body is under oxidative stress [44]. The performance of the pretreatment groups was more significant in comparison to the posttreatment groups. In both pretreatment groups, a significant decrease in serum MDA level was observed compared to the 5-FU group. Since QRC is widely mentioned in sources as a powerful antioxidant, increasing the strength of the antioxidant system has not been unexpected. Following the results of the present study, some researchers have noted an increase in the number of various antioxidants in other mucosal models [32, 41, 42].
Recent studies have shown that QRC has anti-inflammatory properties and can downregulate the production of some inflammatory factors such as NFκB, COX-2, and NO [44]. In the molecular part of our study, an interesting event occurred. In the QRC posttreatment group, the NFκB level decreased. But in both the nano-pre- and posttreatment of QRC groups, the NF-Κb and Hif-1α level increased. To justify this event, we can refer to the synergistic effects of QRC and 5-FU, which we found in a recent study [45]. It means that although the role of certain doses of QRC as a flavonoid with therapeutic properties is undeniable, we can find out that pretreatment with QRC not only cannot prevent its effectiveness against OM damage but also can reduce the levels of antioxidant enzymes and increase the expression of inflammatory factors that lead to cell death and apoptosis.
On the other hand, by comparing the nano- and non-nanoforms of QRC in this study, it can be found that since the nanoform has more permeability to tissues and cells, it was observed that the group receiving 5-FU and nanoform of QRC as the same dose, had poor performance compared to the other groups receiving pre- and posttreatment of QRC. In this case, we found that, to use the nano-QRC form, we had to use a lower dose than the non-nanoform.
Our study focused on comparing the pre- and posttreatment protective effects of QRC against OM caused by 5-FU. QRC, as an effective flavonoid in the treatment of many disorders, if used in inappropriate doses can make disruption on the living body.
5. Conclusion
The results of the present study showed that QRC could be a useful compound to prevent the effects of chemotherapy-induced OM with 5-FU, since QRC has been shown to lessen the severity of lesions and inflammation. According to our results from the real-time PCR assay, histopathology, and oxidative stress measurement, using QRC in appropriate doses can be a suitable compound in combating OM.
Acknowledgments
The authors acknowledge the National Institute for Medical Research Development (NIMAD 982618) for funding this project.
[1] C. L. Shapiro, "Highlights of recent findings on quality-of-life management for patients with cancer and their survivors," JAMA Oncology, vol. 2 no. 11, pp. 1401-1402, DOI: 10.1001/jamaoncol.2016.3620, 2016.
[2] N. Zhang, Y. Yin, S.-J. Xu, W.-S. Chen, "5-Fluorouracil: mechanisms of resistance and reversal strategies," Molecules, vol. 13 no. 8, pp. 1551-1569, DOI: 10.3390/molecules13081551, 2008.
[3] M. Jahani, M. Azadbakht, H. Rasouli, "L-arginine/5-fluorouracil combination treatment approaches cells selectively: rescuing endothelial cells while killing MDA-MB-468 breast cancer cells," Food and Chemical Toxicology, vol. 123, pp. 399-411, DOI: 10.1016/j.fct.2018.11.018, 2019.
[4] T. J. Cunningham, M. Tabacchi, J. P. Eliane, "Randomized trial of calcipotriol combined with 5-fluorouracil for skin cancer precursor immunotherapy," The Journal of Clinical Investigation, vol. 127 no. 1, pp. 106-116, DOI: 10.1172/JCI89820, 2017.
[5] C. Jacobs, G. Lyman, E. Velez-García, "A phase III randomized study comparing cisplatin and fluorouracil as single agents and in combination for advanced squamous cell carcinoma of the head and neck," Journal of Clinical Oncology, vol. 10 no. 2, pp. 257-263, DOI: 10.1200/jco.1992.10.2.257, 1992.
[6] F. Tanaka, T. Fukuse, H. Wada, M. Fukushima, "The history, mechanism and clinical use of oral 5-fluorouracil derivative chemotherapeutic agents," Current Pharmaceutical Biotechnology, vol. 1 no. 2, pp. 137-164, DOI: 10.2174/1389201003378979, 2000.
[7] S. A. Thomas, Z. Grami, S. Mehta, K. Patel, "Adverse effects of 5-fluorouracil: focus on rare side effects," Cancer Cell & Microenvironment, vol. 3, 2016.
[8] N. Hamouda, T. Sano, Y. Oikawa, "Apoptosis, dysbiosis and expression of inflammatory cytokines are sequential events in the development of 5-fluorouracil-induced intestinal mucositis in mice," Basic & Clinical Pharmacology & Toxicology, vol. 121 no. 3, pp. 159-168, DOI: 10.1111/bcpt.12793, 2017.
[9] Y. Panahi, S. Ala, M. Saeedi, A. Okhovatian, N. Bazzaz, M. M. Naghizadeh, "Allopurinol mouth rinse for prophylaxis of fluorouracil-induced mucositis," European Journal of Cancer Care, vol. 19 no. 3, pp. 308-312, DOI: 10.1111/j.1365-2354.2008.01042.x, 2010.
[10] E. B. Rubenstein, D. E. Peterson, M. Schubert, "Clinical practice guidelines for the prevention and treatment of cancer therapy-induced oral and gastrointestinal mucositis," Cancer, vol. 100 no. S9, pp. 2026-2046, DOI: 10.1002/cncr.20163, 2004.
[11] D. Moslemi, A. M. Nokhandani, M. T. Otaghsaraei, Y. Moghadamnia, S. Kazemi, A. A. Moghadamnia, "Management of chemo/radiation-induced oral mucositis in patients with head and neck cancer: a review of the current literature," Radiotherapy and Oncology, vol. 120 no. 1, pp. 13-20, DOI: 10.1016/j.radonc.2016.04.001, 2016.
[12] A. J. Bolouri, A. Pakfetrat, A. Tonkaboni, "Preventing and therapeutic effect of propolis in radiotherapy induced mucositis of head and neck cancers: a triple-blind, randomized, placebo-controlled trial," Iranian Journal of Cancer Prevention, vol. 8 no. 5, 2015.
[13] C. Scully, S. Sonis, P. Diz, "Oral mucositis," Oral Diseases, vol. 12 no. 3, pp. 229-241, DOI: 10.1111/j.1601-0825.2006.01258.x, 2006.
[14] B. Chaveli-López, "Oral toxicity produced by chemotherapy: a systematic review," Journal of Clinical and Experimental Dentistry, vol. 6 no. 1, pp. e81-90, DOI: 10.4317/jced.51337, 2014.
[15] G. Pizzino, N. Irrera, M. Cucinotta, "Oxidative stress: harms and benefits for human health," Oxidative Medicine and Cellular Longevity, vol. 2017,DOI: 10.1155/2017/8416763check.doi, 2017.
[16] S. Sonis, "New thoughts on the initiation of mucositis," Oral Diseases, vol. 16 no. 7, pp. 597-600, DOI: 10.1111/j.1601-0825.2010.01681.x, 2010.
[17] S. T. Sonis, "The pathobiology of mucositis," Nature Reviews Cancer, vol. 4 no. 4, pp. 277-284, DOI: 10.1038/nrc1318, 2004.
[18] S. T. Sonis, A. Villa, "Phase II investigational oral drugs for the treatment of radio/chemotherapy induced oral mucositis," Expert Opinion on Investigational Drugs, vol. 27 no. 2, pp. 147-154, DOI: 10.1080/13543784.2018.1427732, 2018.
[19] R. V. Lalla, S. T. Sonis, D. E. Peterson, "Management of oral mucositis in patients who have cancer," Dental Clinics of North America, vol. 52 no. 1, pp. 61-77, DOI: 10.1016/j.cden.2007.10.002, 2008.
[20] R. Meredith, M. Salter, R. Kim, "Sucralfate for radiation mucositis: results of a double-blind randomized trial," International Journal of Radiation Oncology ∗ Biology ∗ Physics, vol. 37 no. 2, pp. 275-279, DOI: 10.1016/s0360-3016(96)00531-7, 1997.
[21] J. Nyman, I. Turesson, "Does the interval between fractions matter in the range of 4-8 h in radiotherapy? a study of acute and late human skin reactions," Radiotherapy and Oncology, vol. 34 no. 3, pp. 171-178, DOI: 10.1016/0167-8140(95)01525-l, 1995.
[22] L. Bian, G. Han, C. W. Zhao, P. J. Garl, X.-J. Wang, "The role of Smad7 in oral mucositis," Protein & Cell, vol. 6 no. 3, pp. 160-169, DOI: 10.1007/s13238-014-0130-4, 2015.
[23] M. D. Lopes-Serrao, S. M. G. Ussery, R. G. Hall, S. R. Shah, "Evaluation of chemotherapy-induced severe myelosuppression incidence in obese patients with capped dosing," Journal of Oncology Practice, vol. 7 no. 1, pp. 13-17, DOI: 10.1200/jop.2010.000045, 2011.
[24] S. A. Khan, J. R. Wingard, "Infection and mucosal injury in cancer treatment," JNCI Monographs, vol. 2001 no. 29, pp. 31-36, DOI: 10.1093/oxfordjournals.jncimonographs.a003437, 2001.
[25] E. Sharon, K. K. F. Cheng, V. L. Rajesh, N. Yarom, "MASCC. ISOO clinical practice guidelines for the management of mucositis secondary to cancer therapy," Cancer, vol. 120, 2020.
[26] A. Rauf, M. Imran, I. A. Khan, "Anticancer potential of quercetin: a comprehensive review," Phytotherapy Research, vol. 32 no. 11, pp. 2109-2130, DOI: 10.1002/ptr.6155, 2018.
[27] D. Dodda, R. Chhajed, J. Mishra, M. Padhy, "Targeting oxidative stress attenuates trinitrobenzene sulphonic acid induced inflammatory bowel disease like symptoms in rats: role of quercetin," Indian Journal of Pharmacology, vol. 46 no. 3,DOI: 10.4103/0253-7613.132160, 2014.
[28] A. P. Rogerio, C. L. Dora, E. L. Andrade, "Anti-inflammatory effect of quercetin-loaded microemulsion in the airways allergic inflammatory model in mice," Pharmacological Research, vol. 61 no. 4, pp. 288-297, DOI: 10.1016/j.phrs.2009.10.005, 2010.
[29] V. C. George, G. Dellaire, H. P. V. Rupasinghe, "Plant flavonoids in cancer chemoprevention: role in genome stability," The Journal of Nutritional Biochemistry, vol. 45,DOI: 10.1016/j.jnutbio.2016.11.007, 2017.
[30] A. Filipa Brito, M. Ribeiro, A. Abrantes, "Quercetin in cancer treatment, alone or in combination with conventional therapeutics?," Current Medicinal Chemistry, vol. 22 no. 26, pp. 3025-3039, DOI: 10.2174/0929867322666150812145435, 2015.
[31] M. M. Kooshyar, P. M. Mozafari, M. Amirchaghmaghi, "A randomized placebo- controlled double blind clinical trial of quercetin in the prevention and treatment of chemotherapy-induced oral mucositis," Journal of Clinical and Diagnostic Research : JCDR, vol. 11 no. 3,DOI: 10.7860/JCDR/2017/23975.9571, 2017.
[32] I. Sukhotnik, D. Moati, R. Shaoul, B. Loberman, Y. Pollak, B. Schwartz, "Quercetin prevents small intestinal damage and enhances intestinal recovery during methotrexate-induced intestinal mucositis of rats," Food & Nutrition Research, vol. 62,DOI: 10.29219/fnr.v62.1327check.doi, 2018.
[33] F. Aghapour, A. A. Moghadamnia, A. Nicolini, "Quercetin conjugated with silica nanoparticles inhibits tumor growth in MCF-7 breast cancer cell lines," Biochemical and Biophysical Research Communications, vol. 500 no. 4, pp. 860-865, DOI: 10.1016/j.bbrc.2018.04.174, 2018.
[34] J. Fang, S. Zhang, X. Xue, "Quercetin and doxorubicin co-delivery using mesoporous silica nanoparticles enhance the efficacy of gastric carcinoma chemotherapy," International Journal of Nanomedicine, vol. 13, pp. 5113-5126, DOI: 10.2147/ijn.s170862, 2018.
[35] H. Rachmawati, D. K. Budiputra, R. Mauludin, "Curcumin nanoemulsion for transdermal application: formulation and evaluation," Drug Development and Industrial Pharmacy, vol. 41 no. 4, pp. 560-566, DOI: 10.3109/03639045.2014.884127, 2015.
[36] C. Tefas, L. Ciobanu, C. Berce, "Beneficial effect of oral administration of zinc sulfate on 5-fluorouracil-induced gastrointestinal mucositis in rats," European Review for Medical and Pharmacological Sciences, vol. 24 no. 21, pp. 11365-11373, DOI: 10.26355/eurrev_202011_23628, 2020.
[37] F. M. P. Galdino, M. E. R. Andrade, P. A. V. d. Barros, "Pretreatment and treatment with fructo-oligosaccharides attenuate intestinal mucositis induced by 5-FU in mice," Journal of Functional Foods, vol. 49, pp. 485-492, DOI: 10.1016/j.jff.2018.09.012, 2018.
[38] A. A. de Araujo, H. Varela, C. A. C. X. de Medeiros, "Azilsartan reduced TNF- α and IL-1 β levels, increased IL-10 levels and upregulated VEGF, FGF, KGF, and TGF- α in an oral mucositis model," PLoS One, vol. 10 no. 2,DOI: 10.1371/journal.pone.0116799check.doi, 2015.
[39] N. M. Blijlevens, "Cytotoxic treatment-induced gastrointestinal symptoms," Current Opinion in Supportive and Palliative Care, vol. 1 no. 1, pp. 16-22, 2012.
[40] A. M. Stringer, R. M. Logan, "The role of oral flora in the development of chemotherapy-induced oral mucositis," Journal of Oral Pathology & Medicine, vol. 44 no. 2, pp. 81-87, DOI: 10.1111/jop.12152, 2015.
[41] C.-S. Lei, Y.-C. Hou, M.-H. Pai, M.-T. Lin, S.-L. Yeh, "Effects of quercetin combined with anticancer drugs on metastasis-associated factors of gastric cancer cells: in vitro and in vivo studies," The Journal of Nutritional Biochemistry, vol. 51, pp. 105-113, DOI: 10.1016/j.jnutbio.2017.09.011, 2018.
[42] M. H. Aras, U. Sezer, S. Erkilic, T. Demir, S. N. Dagli, "Effect of dietary boron on 5-fluorouracil induced oral mucositis in rats," European Journal of Dentistry, vol. 07 no. 03, pp. 310-314, DOI: 10.4103/1305-7456.115415, 2013.
[43] L. Arribas, L. Hurtós, M. Taberna, "Nutritional changes in patients with locally advanced head and neck cancer during treatment," Oral Oncology, vol. 71, pp. 67-74, DOI: 10.1016/j.oraloncology.2017.06.003, 2017.
[44] P. Ramyaa, V. V. Padma, "Quercetin modulates OTA-induced oxidative stress and redox signalling in HepG2 cells - up regulation of Nrf2 expression and down regulation of NF- κ B and COX-2," Biochimica et Biophysica Acta (BBA)-General Subjects, vol. 1840 no. 1, pp. 681-692, DOI: 10.1016/j.bbagen.2013.10.024, 2014.
[45] C. P. Xavier, C. F. Lima, C. P. Wilson, "Quercetin synergistically induces sensitivity to 5-fluorouracil through p53 modulation in colorectal cancer cells," , 2011.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2021 Mandana Lotfi et al. This work is licensed under http://creativecommons.org/licenses/by/4.0/ (the “License”). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
The target of this study was to evaluate the efficacy, histopathological, oxidative stress, and molecular effects of quercetin (QRC) in mice with oral mucositis induced by 5-fluorouracil (5-FU). Thirty-six albino male mice with oral mucositis induced by 5-FU as a chemotherapeutic agent were used in this study. The animals were randomly divided into 6 groups: control group, mucositis (MUC) group, pretreatment group, posttreatment group, and two last groups including nanoemulsion form of QRC with a dose of 5 mg/kg in both pretreatment and posttreatment. In the present evaluation, fewer oral lesions were observed in the QRC posttreatment groups compared to the pretreatment and nanoemulsion receiving groups. In the SOD assay, the most significant difference was observed in the posttreatment nanogroup (41.073 ± 1.24) and pretreatment nanogroup (43.453 ± 2.60) in comparison to the 5-FU group (30.897 ± 1.93). The results of CAT assay also showed a significant difference in nano-posttreatment (124.60 ± 10.85), posttreatment (135.4 ± 9.82), and nano-pretreatment groups (128.80 ± 7.20) compared to the 5-FU group (55.07 ± 8.91). The expression of inflammatory genes such as Hif-1α and NfκB in this group was lower than in the other groups, although this difference was not significant. It seems that the use of QRC can improve the treatment process of oral mucositis induced by 5-FU.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Ebrahimpour, Anahita 2 ; Shirafkan, Fatemeh 2 ; Pirzadeh, Marzieh 1 ; Hosseini, Mohammad 3 ; Ali Akbar Moghadamnia 2
1 Student Research Committee, Health Research Center, Babol University of Medical Sciences, Babol, Iran
2 Cellular and Molecular Biology Research Center, Health Research Center, Babol University of Medical Sciences, Babol, Iran
3 Department of Veterinary Pathology, Babol-Branch, Islamic Azad University, Babol, Iran





