This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Lung cancer is the leading cause of cancer-related deaths worldwide, with over 2 million new cases diagnosed [1]. As the most common pathological type, lung adenocarcinoma (LUAD) has strong invasive ability and generally poor prognosis [2, 3]. As a primary epithelial tumor of the lung, LUAD pathogenesis involves many factors such as environment, heredity, and living habits [4]. However, its cause has not yet been fully elucidated. Because LUAD often manifests as peripheral lung cancer clinically, the early clinical symptoms are often atypical, leading to the difficulty of early diagnosis. Some LUAD have metastasized or invaded to the pleura at the time of diagnosis, resulting in a generally poor prognosis for patients [5, 6]. Therefore, it is very important and urgent to identify effective biomarkers for its early diagnosis.
Radiotherapy is a local treatment of a tumor, which is widely used in the clinical treatment of LUAD. Nevertheless, many patients have radiotherapy resistance, which often limits the therapeutic effects of radiotherapy. Previous researches reported that radiotherapy caused changes in the expression profile of miRNAs in LUAD patients, and these miRNAs might be related to their radiosensitivity [7–9].
Previous studies [10–12] have confirmed that miR-195-5p had significant antitumor effects. Feng et al. [10] found that miR-195-5p increased chemosensitivity and apoptosis in chemoresistant colorectal cancer cells. A similar phenomenon was also observed [11], which indicated that miR-195-5p could reduce chemoresistance by inhibiting the stem cell-like ability of colorectal cancer cells. Chai et al. found that miR-195-5p, acting as tumor suppressors of melanoma, inhibited A375 cell proliferation, migration, and invasion, arrested the cell cycle, and induced cell apoptosis [12]. In our previous work, we revealed that miR-195-5p had high diagnostic values for LUAD [13]. Higher expression of miR-195-5p indicated better LUAD prognosis. Therefore, in our current research, we explored its roles in response to radiation in LUAD cells and mouse model.
2. Materials and Methods
2.1. Target Prediction and Function of miR-195-5p
Three different databases (TargetScan, miRDB, and DIANA-TarBase) were adopted to predict miRNA target genes. Based on TCGA-LUAD expression profile data, the upregulated genes in LUAD tissues (
2.2. Cells Culture and Transfection
PC9 and A549 cells were cultured in RPMI medium (Gibco, USA) containing 10% fetal calf serum. The miR-195-5p mimic, inhibitor, and negative control (NC) were provided by RiboBio, China, and the corresponding transfection reagent was Lipofectamine 2000 (Invitrogen, USA). Three siRNA duplexes (GenePharma, China) were designed to target human HOXA10, transfected with jetPRIME (PolyPlus-transfection).
2.3. Total RNA Extraction and qRT-PCR
TRIzol was used to extract total RNA directly from PC9 and A549 cells. The PrimeScript™ RT Reagent Kit with gDNAEraser was adopted to detect the levels of mature miR-195-5p. The levels of mRNAs were detected by PrimeScript™ RT Reagent Kit and gDNAEraser and SYBR Advantage qPCR Premix (Takara). GADPH and U6 were used as references. Table 1 provides all PCR-related primer sequences.
Table 1
PCR primer sequence.
| Primer name | Sequence (5 |
| miR-195-5p forward | GTCTAGCAGCACAGAAATA |
| miR-195-5p reverse | GTGCAGGGTCCGAGGT |
| miR-195-5p RT | GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCAA |
| U6 forward primer | CTCGCTTCGGCAGCACA |
| U6 reverse primer | AACGCTTCACGAATTTGCGT |
| HOXA10 forward | GGGTAAGCGGAATAAACT |
| HOXA10 reverse | GCACAGCAGCAATACAATA |
| GAPDH forward | GGAGCGAGATCCCTCCAAAAT |
| GAPDH reverse | GGCTGTTGTCATACTTCTCATGG |
2.4. Cell Proliferation, Migration, and Invasion Assays
The cell viability at different time points was measured by the Cell Counting Kit-8 (CCK-8, Beyotime). The migration of LUAD cells was examined by the wound healing assay. LUAD cells were cultured and incubated until the cell confluence was over 90% in 6-well plates. A clean pipette tip (200 μL) was applied to create a scratch in the middle of the cell monolayer. After being cultured with fresh serum-free medium for 48 h, the wound was photographed with an inverted microscope. DiI (5 μM, Google Bio, China) was used 30 min before the observation. For invasion assays, the lower chambers of transwell were filled with 700 μL complete medium. The
2.5. Cell Cycle and Apoptosis Assays
After transfection or irradiation (4 Gy) for 48 h, the apoptotic/necrotic cells (
2.6. Colony Survival Assay
PC9 and A549 cells, transfected with mimics, inhibitors, siRNA, and corresponding NC, were seeded in 6-well plates (100, 200, 400, 600, 800, 1000, and 2000 cells/well) and exposed to the following radiation (0, 1, 2, 4, 6, 8, and 10 Gy) correspondingly. After 13 days, the colonies were counted and cell survival was evaluated. Specifically, colonies with more than 50 cells were counted, and the survival fraction was calculated by the ratio of the colony number and seed cell number.
2.7. Luciferase Assay
To construct a HOXA10 3
2.8. Immunoblotting
The antibodies of BCL2, Bax, MMP-2, MMP-9, cyclin D1, and c-myc were from Wuhan Sanying, China. The antibodies of β-catenin and Wnt1 were purchased from Cell Signaling Technology, USA, and the antibody of HOXA10 was from Abcam, UK. The proteins were extracted by using RIPA buffer with 1% PMSF and then loaded onto an SDS-PAGE minigel. After being transferred onto PVDF membranes, the primary and corresponding secondary antibodies were used to label the target proteins. GAPDH was used as an endogenous protein for normalization.
2.9. Tumor Formation in Nude Mice
The nude mice (BALB/c, 4-6 weeks old) were provided by Vital River Laboratory Animal Technology, China. All mouse feeding and operation processes followed the Experimental Animal Welfare Ethics Committee of Zhongnan Hospital of Wuhan University. PC9 was used to construct a subcutaneous implant tumor model (
2.10. Statistical Analysis
The results were presented as
3. Results
3.1. miR-195-5p Inhibited Proliferation, Invasion, and Migration of LUAD Cells
Compared with the normal lung epithelial cell line (BASE-2B), miR-195-5p levels were significantly lower in A549 and PC9 cells (Figure 1(a)). The results of cell viability assays suggested that the proliferation of A549 and PC9 cells was restrained by the miR-195-5p mimic (Figure 1(b)), which was in accordance with the results of immunofluorescence of Ki67 (Figure 1(c)). The inhibitors of miR-195-5p induced LUAD cell proliferation and increased Ki67 staining. The results of migration and invasion assays indicated that the miR-195-5p mimic reduced PC9 and A549 cell migration, while its inhibitors had the opposite effects (Figures 1(d) and 1(e)). Immunoblotting confirmed that the miR-195-5p mimic downregulated the protein levels of MMP2 and MMP9, while its inhibitors induced these 2 proteins in A549 and PC9 cells (Figure 1(f)).
[figures omitted; refer to PDF]
3.2. miR-195-5p Enhanced Radiosensitivity
The miR-195-5p mimic increased the numbers of PC9 and A549 cells at the G1 phase, suggesting that the miR-195-5p mimic arrested cells at the G1 phase (Figure 2(a)). In addition, the miR-195-5p mimic also significantly induced LUAD cell apoptosis (
[figures omitted; refer to PDF]
To examine whether miR-195-5p affected radiosensitivity of LUAD cells, PC9 and A549 cells were exposed to ionizing radiation (4 Gy). The apoptosis levels of PC9 and A549 cells were measured, and miR-195-5p enhanced LUAD cell apoptosis induced by X-ray (Figure 3(a)). The colony survival assay showed that the miR-195-5p mimic reduced the survival fractions of PC9 and A549 cells at each dose (Figure 3(b)).
[figures omitted; refer to PDF]
3.3. miR-195-5p Targeted HOXA10
Based on TCGA-LUAD profile data, the differentially expressed microRNAs (DEMs) and differentially expressed genes (DEGs) in LUAD tissues were selected. Three different databases (TargetScan, miRDB, and DIANA-TarBase) were adopted to predict miRNA target genes. When DEMs were matched to GEGs, 34 target genes were screened out (Figure S1). Among them, 16 target genes were the target genes of miR-195-5p. Except TMEM00, RS1, and OSCAR, the remaining genes (CEP55, PSAT1, CHEK1, KIF23, CCNE1, CLSPN, CDC25A, E2F7, CBX2, HOXA10, SALL1, TGFBR3, and RET) were upregulated in LUAD tissues (Figure S2). The clinical values of these upregulated target genes were evaluated by diagnostic efficacy and prognostic analysis (Figure S3). The results suggested that HOXA10 might be a hub target gene, which had an important impact on the prognosis of LUAD patients.
Pearson’s correlation analysis with TCGA database revealed that the levels of HOXA10 were suppressed by miR-195-5p in LUAD (
[figures omitted; refer to PDF]
3.4. Effects of HOXA10 on Proliferation, Migration, and Invasion of LUAD Cells
To explore the biological functions of the HOXA10, single gene set enrichment analysis was performed. The logarithm for the fold difference of 18,148 protein coding genes between the high- and low-expression groups was analyzed. The results showed that DNA replication and cell cycle-related signal pathways were activated in the HOXA10 high-expression group (Figure 5(a)). The above results further suggested the importance of HOXA10 in the occurrence and development of LUAD.
[figures omitted; refer to PDF]
After the expression of HOXA10 was downregulated with siRNAs (Figure 5(b)), the proliferation of PC9 and A549 cells was inhibited (Figure 5(c)). This phenomenon can be confirmed by the detection of Ki67 immunofluorescence (Figure 5(d)). HOXA10-siRNA inhibited LUAD cell migration (Figure 6(a)) and invasion (Figure 6(b)). Immunoblotting results showed that MMP2 and MMP9 protein levels were decreased in the HOXA10-siRNA group compared with NC (Figure 6(c)).
[figures omitted; refer to PDF]
3.5. HOXA10 Decreased Radiosensitivity of LUAD Cells
The results of cell cycle analysis indicated that HOXA10 knockdown blocked the cell cycle at the G1 phase, and the rate of apoptosis was significantly increased (Figures 7(a) and 7(b)). Immunoblotting results showed a decrease in cyclin D1 and Bcl-2 and an increase in Bax protein levels in the HOXA10-siRNA group (Figure 7(c)).
[figures omitted; refer to PDF]
Moreover, HOXA10 knockdown increased the rate of apoptosis induced by radiation (Figure 8(a)). Colony formation assays confirmed that HOXA10 deficiency improved PC9 and A549 cell radiosensitivity (Figure 8(b)). It was worth noting that the enrichment analysis results suggested that HOXA10 might be involved in the regulation of the Wnt pathway (Figure 8(c)). To confirm this prediction, we examined the expression of β-catenin, c-myc, and Wnt1, and their protein levels were inhibited by HOXA10-siRNA (Figure 8(d)).
[figures omitted; refer to PDF]
Therefore, HOXA10 may regulate the tumor biological behaviors and radiosensitivity of the LUAD cells through the Wnt/β-catenin pathway. To further clarify whether miR-195-5p regulated the Wnt/β-catenin pathway through HOXA10, we investigated its effects on the expression of Wnt1 and β-catenin in LUAD cells. It was found that the miR-195-5p mimic inhibited the Wnt/β-catenin pathway, while its inhibitors activated this pathway. Moreover, the effects of miR-195-5p inhibitors on the Wnt/β-catenin pathway could be eliminated by HOXA10-siRNA. Therefore, miR-195-5p regulated the Wnt pathway through HOXA10 (Figure 8(e)).
3.6. miR-195-5p Enhanced the Radiosensitivity of Xenograft-Formed LUAD
The tumor volume in the mice injected with miR-195-5p agomir combined with irradiation was lower than that of agomir NC and radiation alone (Figure 9(a)). In addition, the expression levels of HOXA10 in the tumor tissues of nude mice treated with miR-195-5p agomir were lower than those in the agomir NC tumors (Figure 9(b)).
[figures omitted; refer to PDF]
4. Discussion
Radiotherapy is widely used in the clinical treatment of LUAD. However, some patients have radiotherapy resistance at the beginning or during treatment, which is a challenge. Researchers try to explain the mechanism of radioresistance, including autophagy [14], tumor stem cells [15], and abnormal activation of signal pathways [16]. Previous studies have reported that miRNAs affect radiation damage to cells in different tumors, indicating that miRNAs may play important roles in tumor radiosensitivity [17–19].
Our current study supported that increased miR-195-5p in LUAD cells considerably decreased cell growth, migration, and invasion. Subsequent studies found that miR-195-5p could also increase the cell proportion of the G1 phase in the cell cycle, induce apoptosis, and improve radiosensitivity. Moreover, miR-195-5p could directly regulate HOXA10 expression via targeting its 3
More and more researches supported that miRNAs could be used as biomarkers for malignant tumors. miRNAs were widely present in body fluids and tissues, and their abnormal expression or distribution has important impacts on the biological behaviors [20, 21]. Previous studies suggested that miR-195-5p was proposed to be a biomarker of lung cancer [22]. Our bioinformatics results also showed that miR-195-5p might be a tumor suppressor gene in lung cancer [13], and our in vitro experiments were consistent with previous results in non-small-cell lung cancer [23]. Guan et al. reported that HOXA10 mediated EMT in head and neck squamous cell carcinoma and was targeted by miR-195-5p [24]. However, their effects on radiosensitivity were to be investigated.
Previous researches reported that miRNAs affected cell apoptosis and regulated tumor cell radiosensitivity. For example, miR-148b promoted the cell apoptosis and enhances radiosensitivity [25], and miR-185 inhibited the apoptosis of gastric cancer cells [26]. Our studies found that overexpression of miR-195-5p enhanced LUAD radiosensitivity, evidenced by reduced survival fractions and induced apoptosis after miR-195-5p overexpression. In addition, the increase in the cell apoptosis rate was accompanied by induced expression of the proapoptotic molecule Bax, while the levels of Bcl-2 were downregulated. Therefore, it can be considered that miR-195-5p in LUAD cells might modify the outcome of radiation by the induction of apoptosis.
Dual-luciferase reporter experiments suggested that miR-195-5p directly targeted HOXA10. HOXA10 plays a vital function in embryonic development and cell proliferation and differentiation. Its expression levels are elevated in various tumors. For example, Plowright et al. found that HOXA10 was upregulated in NSCLC [27]. The expression levels of HOXA10 were negatively correlated with the invasion ability of gastric tumor cells. Moreover, Chu et al. reported that HOXA10 induced P53 to exhibit tumor suppressor genes [28]. Therefore, HOXA10 regulated tumor growth in a cancer-specific manner.
The specific functions of HOXA10 in LUAD need to be further explored. The CCK-8 and Ki67 immunofluorescence suggested that HOXA10 downregulation inhibited LUAD cell proliferation, migration, and invasion. The colony formation assay indicated that as radiation dose increased, the colony numbers gradually decreased. At the same dose level, HOXA10 knockdown significantly suppressed colony formation. These results indicated that HOXA10 deficiency induced LUAD cell apoptosis after radiation and reduced cell proliferation and survival. Our findings suggested that miR-195-5p enhanced the radiosensitivity of LUAD cells via inhibiting the HOXA10 expression.
The Wnt/β-catenin signaling pathway is closely related to the biological behaviors of the tumor. Yang et al. found that miR-183 inhibited osteosarcoma cell growth, migration, and invasion via regulating the Wnt/β-catenin signaling pathway [29]. Other studies [30–32] also suggested that this pathway was involved in the regulation of radiosensitivity. Interestingly, our results indicated that HOXA10 downregulation significantly inhibited the Wnt/β-catenin signaling pathway, as well as the biological behaviors of LUAD cells. Moreover, HOXA10 deficiency reversed Wnt/β-catenin signaling activation induced by the miR-195-5p inhibitor. Therefore, miR-195-5p hindered the activation of the Wnt/β-catenin signaling pathway via targeting HOXA10, thereby inhibiting the corresponding cytological behaviors of LUAD cells and enhancing radiosensitivity (Figure 9(c)).
Our studies had certain limitations. The results of our researches are to be confirmed with clinical evidence. Furthermore, the direct targeting of HOXA10 and how it affects the Wnt/β-catenin pathway need further exploration.
In summary, our results demonstrated that miR-195-5p inhibited biological behaviors and sensitized LUAD cells to X-ray irradiation via targeting HOXA10. It provided a novel idea to improve the treatment of LUAD, especially the efficacy of radiotherapy.
Authors’ Contributions
Cheng Yuan and Rui Bai contributed equally to this work.
[1] F. Bray, J. Ferlay, I. Soerjomataram, R. L. Siegel, L. A. Torre, A. Jemal, "Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries," CA: a Cancer Journal for Clinicians, vol. 68 no. 6, pp. 394-424, DOI: 10.3322/caac.21492, 2018.
[2] M. Deng, B. Liu, Z. Zhang, Y. Chen, Y. Wang, X. Wang, Q. Lv, X. Yang, K. Hou, X. Che, X. Qu, Y. Liu, Y. Zhang, X. Hu, "Loss of G-protein-signaling modulator 2 accelerates proliferation of lung adenocarcinoma via EGFR signaling pathway," The International Journal of Biochemistry & Cell Biology, vol. 122,DOI: 10.1016/j.biocel.2020.105716, 2020.
[3] F. R. Hirsch, G. V. Scagliotti, J. Mulshine, R. Kwon, W. J. Curran, Y. L. Wu, L. Paz-Ares, "Lung cancer: current therapies and new targeted treatments," Lancet, vol. 389 no. 10066, pp. 299-311, DOI: 10.1016/S0140-6736(16)30958-8, 2017.
[4] V. Relli, M. Trerotola, E. Guerra, S. Alberti, "Distinct lung cancer subtypes associate to distinct drivers of tumor progression," Oncotarget, vol. 9 no. 85, pp. 35528-35540, DOI: 10.18632/oncotarget.26217, 2018.
[5] X. Ai, X. Guo, J. Wang, A. L. Stancu, P. M. N. Joslin, D. Zhang, S. Zhu, "Targeted therapies for advanced non-small cell lung cancer," Oncotarget, vol. 9 no. 101, pp. 37589-37607, DOI: 10.18632/oncotarget.26428, 2018.
[6] A. Zagryazhskaya, B. Zhivotovsky, "miRNAs in lung cancer: a link to aging," Ageing Research Reviews, vol. 17, pp. 54-67, DOI: 10.1016/j.arr.2014.02.009, 2014.
[7] B. Tomasik, J. Chałubińska-Fendler, D. Chowdhury, W. Fendler, "Potential of serum microRNAs as biomarkers of radiation injury and tools for individualization of radiotherapy," Translational Research, vol. 201, pp. 71-83, DOI: 10.1016/j.trsl.2018.06.001, 2018.
[8] H. Li, M. Jiang, M. Cui, G. Feng, J. Dong, Y. Li, H. Xiao, S. Fan, "MiR-365 enhances the radiosensitivity of non-small cell lung cancer cells through targeting CDC25A," Biochemical and Biophysical Research Communications, vol. 512 no. 2, pp. 392-398, DOI: 10.1016/j.bbrc.2019.03.082, 2019.
[9] T. Powrozek, T. Malecka-Massalska, "MiRNA and lung cancer radiosensitivity: a mini-review," European Review for Medical and Pharmacological Sciences, vol. 23 no. 19, pp. 8422-8428, DOI: 10.26355/eurrev_201910_19154, 2019.
[10] C. Feng, L. Zhang, Y. Sun, X. Li, L. Zhan, Y. Lou, Y. Wang, L. Liu, Y. Zhang, "GDPD5, a target of miR-195-5p, is associated with metastasis and chemoresistance in colorectal cancer," Biomedicine & Pharmacotherapy, vol. 101, pp. 945-952, DOI: 10.1016/j.biopha.2018.03.028, 2018.
[11] Y. Jin, M. Wang, H. Hu, Q. Huang, Y. Chen, G. Wang, "Overcoming stemness and chemoresistance in colorectal cancer through miR-195-5p-modulated inhibition of notch signaling," International Journal of Biological Macromolecules, vol. 117, pp. 445-453, DOI: 10.1016/j.ijbiomac.2018.05.151, 2018.
[12] L. Chai, X. J. Kang, Z. Z. Sun, M. F. Zeng, S. R. Yu, Y. Ding, J. Q. Liang, T. T. Li, J. Zhao, "MiR-497-5p, miR-195-5p and miR-455-3p function as tumor suppressors by targeting hTERT in melanoma A375 cells," Cancer Management and Research, vol. 10, pp. 989-1003, DOI: 10.2147/CMAR.S163335, 2018.
[13] C. Yuan, L. Xiang, R. Bai, K. Cao, Y. Gao, X. Jiang, N. Zhang, Y. Gong, C. Xie, "MiR-195 restrains lung adenocarcinoma by regulating CD4+ T cell activation via the CCDC88C/Wnt signaling pathway: a study based on the Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO) and bioinformatic analysis," Annals of Translational Medicine, vol. 7 no. 12,DOI: 10.21037/atm.2019.05.54, 2019.
[14] H. Chaachouay, P. Ohneseit, M. Toulany, R. Kehlbach, G. Multhoff, H. P. Rodemann, "Autophagy contributes to resistance of tumor cells to ionizing radiation," Radiotherapy and Oncology, vol. 99 no. 3, pp. 287-292, DOI: 10.1016/j.radonc.2011.06.002, 2011.
[15] C. Moncharmont, A. Levy, M. Gilormini, G. Bertrand, C. Chargari, G. Alphonse, D. Ardail, C. Rodriguez-Lafrasse, N. Magné, "Targeting a cornerstone of radiation resistance: cancer stem cell," Cancer Letters, vol. 322 no. 2, pp. 139-147, DOI: 10.1016/j.canlet.2012.03.024, 2012.
[16] F. J. Dumont, P. Bischoff, "Disrupting the mTOR signaling network as a potential strategy for the enhancement of cancer radiotherapy," Current Cancer Drug Targets, vol. 12 no. 8, pp. 899-924, DOI: 10.2174/156800912803251243, 2012.
[17] X. Deng, L. Ma, M. Wu, G. Zhang, C. Jin, Y. Guo, R. Liu, "miR-124 radiosensitizes human glioma cells by targeting CDK4," Journal of Neuro-Oncology, vol. 114 no. 3, pp. 263-274, DOI: 10.1007/s11060-013-1179-2, 2013.
[18] P. Wang, J. Zhang, L. Zhang, Z. Zhu, J. Fan, L. Chen, L. Zhuang, J. Luo, H. Chen, L. Liu, Z. Chen, Z. Meng, "MicroRNA 23b regulates autophagy associated with radioresistance of pancreatic cancer cells," Gastroenterology, vol. 145 no. 5, pp. 1133-1143.e12, DOI: 10.1053/j.gastro.2013.07.048, 2013.
[19] Y. J. Liu, Y. F. Lin, Y. F. Chen, E. C. Luo, Y. P. Sher, M. H. Tsai, E. Y. Chuang, L. C. Lai, "MicroRNA-449a enhances radiosensitivity in CL1-0 lung adenocarcinoma cells," PLoS One, vol. 8 no. 4, article e62383,DOI: 10.1371/journal.pone.0062383, 2013.
[20] K. B. Marcu, S. A. Bossone, A. J. Patel, "myc function and regulation," Annual Review of Biochemistry, vol. 61 no. 1, pp. 809-858, DOI: 10.1146/annurev.bi.61.070192.004113, 1992.
[21] S. A. Chappell, J. P. LeQuesne, F. E. Paulin, M. L. deSchoolmeester, M. Stoneley, R. L. Soutar, S. H. Ralston, M. H. Helfrich, A. E. Willis, "A mutation in the c-myc-IRES leads to enhanced internal ribosome entry in multiple myeloma: a novel mechanism of oncogene de-regulation," Oncogene, vol. 19 no. 38, pp. 4437-4440, DOI: 10.1038/sj.onc.1203791, 2000.
[22] L. Li, T. Feng, W. Zhang, R. Wang, W. Lv, T. Zhu, H. Yu, B. Qian, B. Qian, "MicroRNA Biomarkerhsa-miR-195-5pfor detecting the risk of lung cancer," International Journal of Genomics, vol. 2020,DOI: 10.1155/2020/7415909, 2020.
[23] J. Zheng, T. Xu, F. Chen, Y. Zhang, "MiRNA-195-5p functions as a tumor suppressor and a predictive of poor prognosis in non-small cell lung cancer by directly targeting CIAPIN1," Pathology Oncology Research, vol. 25 no. 3, pp. 1181-1190, DOI: 10.1007/s12253-018-0552-z, 2019.
[24] Y. Guan, A. Guan, L. Chen, A. Gong, "LINC00461 facilitates HNSCC development and reduces chemosensitivity by impairing miR-195-mediated inhibition of HOXA10," Molecular Therapy Oncolytics, vol. 21, pp. 74-86, DOI: 10.1016/j.omto.2021.01.008, 2021.
[25] Y. Wu, G. L. Liu, S. H. Liu, C. X. Wang, Y. L. Xu, Y. Ying, P. Mao, "MicroRNA-148b enhances the radiosensitivity of non-Hodgkin's lymphoma cells by promoting radiation-induced apoptosis," Journal of Radiation Research, vol. 53 no. 4, pp. 516-525, DOI: 10.1093/jrr/rrs002, 2012.
[26] J. Wang, J. He, F. Su, N. Ding, W. Hu, B. Yao, W. Wang, G. Zhou, "Repression of ATR pathway by miR-185 enhances radiation-induced apoptosis and proliferation inhibition," Cell Death & Disease, vol. 4 no. 6, article e699,DOI: 10.1038/cddis.2013.227, 2013.
[27] L. Plowright, K. J. Harrington, H. S. Pandha, R. Morgan, "HOX transcription factors are potential therapeutic targets in non-small- cell lung cancer (targeting HOX genes in lung cancer)," British Journal of Cancer, vol. 100 no. 3, pp. 470-475, DOI: 10.1038/sj.bjc.6604857, 2009.
[28] M. C. Chu, F. B. Selam, H. S. Taylor, "HOXA10 regulates p53 expression and Matrigel invasion in human breast cancer cells," Cancer Biology & Therapy, vol. 3 no. 6, pp. 568-572, DOI: 10.4161/cbt.3.6.848, 2004.
[29] X. Yang, L. Wang, Q. Wang, L. Li, Y. Fu, J. Sun, "MiR-183 inhibits osteosarcoma cell growth and invasion by regulating LRP6-Wnt/ β -catenin signaling pathway," Biochemical and Biophysical Research Communications, vol. 496 no. 4, pp. 1197-1203, DOI: 10.1016/j.bbrc.2018.01.170, 2018.
[30] M. S. Chen, W. A. Woodward, F. Behbod, S. Peddibhotla, M. P. Alfaro, T. A. Buchholz, J. M. Rosen, "Wnt/ β -catenin mediates radiation resistance of Sca1+ progenitors in an immortalized mammary gland cell line," Journal of Cell Science, vol. 120 no. 3, pp. 468-477, DOI: 10.1242/jcs.03348, 2007.
[31] N. Gassler, I. Herr, M. Keith, F. Autschbach, H. Schmitz-Winnenthal, A. Ulrich, H. Otto, J. Kartenbeck, K. Z'graggen, "Wnt-signaling and apoptosis after neoadjuvant short-term radiotherapy for rectal cancer," International Journal of Oncology, vol. 25 no. 6, pp. 1543-1549, DOI: 10.3892/ijo.25.6.1543, 2004.
[32] B. Hai, Z. Yang, S. E. Millar, Y. S. Choi, M. M. Taketo, A. Nagy, F. Liu, "Wnt/ β -catenin signaling regulates postnatal development and regeneration of the salivary gland," Stem Cells and Development, vol. 19 no. 11, pp. 1793-1801, DOI: 10.1089/scd.2009.0499, 2010.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2021 Cheng Yuan et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. https://creativecommons.org/licenses/by/4.0/
Abstract
Objective. To explore the effects of miR-195-5p and its target gene HOXA10 on the biological behaviors and radiosensitivity of lung adenocarcinoma (LUAD) cells. Methods. The effects of miR-195-5p on LUAD cell proliferation, migration, invasion, cycle arrest, apoptosis, and radiosensitivity were investigated by in vitro experiments. The bioinformatics analysis was used to assess its clinical value and predict target genes. Double-luciferase experiments were used to verify whether the miR-195-5p directly targeted HOXA10. A xenograft tumor-bearing mouse model was used to examine its effects on the radiosensitivity of LUAD in vivo. Results. Both gain- and loss-of-function assays demonstrated that miR-195-5p inhibited LUAD cell proliferation, invasion, and migration, induced G1 phase arrest and apoptosis, and enhanced radiosensitivity. Double-luciferase experiments confirmed that miR-195-5p directly targeted HOXA10. Downregulation of HOXA10 also inhibited LUAD cell proliferation, migration, and invasion, induced G1 phase arrest and apoptosis, and enhanced radiosensitivity. The protein levels of β-catenin, c-myc, and Wnt1 were decreased by miR-195-5p and increased by its inhibitor. Moreover, the effects of the miR-195-5p inhibitor could be eliminated by HOXA10-siRNA. Furthermore, miR-195-5p improved radiosensitivity of LUAD cells in vivo. Conclusion. miR-195-5p has excellent antitumor effects via inhibiting cancer cell growth, invasion, and migration, arresting the cell cycle, promoting apoptosis, and sensitizing LUAD cells to X-ray irradiation by targeting HOXA10. Thus, miR-195-5p may serve as a potential candidate for the treatment of LUAD.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Bai, Rui 2 ; Gao, Yanping 2 ; Jiang, Xueping 2 ; Li, Shuying 2 ; Sun, Wenjie 2 ; Li, Yangyi 2 ; Huang, Zhengrong 2 ; Gong, Yan 3
; Xie, Conghua 4
1 Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China; Department of Gynecological Oncology, Zhongnan Hospital of Wuhan University, Wuhan 430071, China
2 Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China
3 Department of Biological Repositories, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China
4 Department of Radiation and Medical Oncology, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China; Hubei Key Laboratory of Tumour Biological Behaviors, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China; Hubei Cancer Clinical Study Center, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, China





