This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Oxidative stress has been implicated in the pathogenesis of various retinal diseases. Excessive production of reactive oxygen species (ROS) may lead to impairment of retinal cells including retinal pigment epithelium (RPE) cells and vascular endothelial cells. It may also promote development and acceleration of retinal diseases, such as age-related macular degeneration (AMD), diabetic retinopathy (DR), glaucoma, retinal vascular occlusion, and inherited retinal diseases [1].
Various signaling pathways have been proposed to clarify the mechanisms of ROS-induced retinal degeneration. Glutamate is an important neurotransmitter in the retina. However, excessive glutamate triggers calcium overload and subsequently increases mitochondrial ROS, which may prompt retinal ganglion cell death via a mitochondrial-targeting mechanism [2–4]. Treatments that alleviate ROS, such as nuclear factor (erythroid-derived 2)-like 2 gene therapy and spermidine, an endogenous ROS scavenger, successfully protect retinal cells from cell death in experimental models [5–7]. Mechanisms of cell death, including apoptosis, necroptosis, and recently, ferroptosis, have been reported in the research of retinal diseases [8–12]. Iron overload in the neuroretina and RPE may be a contributing factor in the progression of AMD or other diseases involving intraocular hemorrhage [13–15]. Ferroptosis is one of the nonapoptotic forms of programmed cell death, which is characterized by the development of iron-dependent lipid peroxidation [16]. It is regulated by the enzyme, glutathione peroxidase 4 (GPx4), with glutathione (GSH) synthesized from amino acids [17]. The membrane cystine transporter system xc- and GPx4 protect cells from ferroptosis [18]. Toxic substances may develop when superoxide interacts with membrane lipids and produce lipid hydroperoxides through Fenton reaction in the presence of excessive iron or deficiencies in antioxidant defense responses [19].
Both enzymatic and nonenzymatic metabolic pathways, such as cystine deprivation (CD), mevalonate, lipid metabolism, GPx4, iron metabolism, and ferritinophagy pathways, have been reported to be involved in the regulation of ferroptosis [20]. Lipoxygenases (LOXs), a group of enzymes that metabolize arachidonic acid as well as polyunsaturated fatty acids (PUFA), may contribute to lipid peroxidation and induce ferroptosis [21, 22]. Inhibitors of LOX inhibitors, such as 5-LOX inhibitors Zileuton and BWB70C, 12/15-LOX inhibitor baicalin or baicalein, and pan-LOX inhibitor nordihydroguaiaretic (NDGA), have been reported to clear free radicals and therefore decrease the levels of lipid and protein oxidation [23]. Recombinant pigment epithelium-derived factor receptor (PEDF-R) proteins inhibit 5-LOX and protect RPE from ROS-induced cell death in vitro [24]. In ARPE-19 cells, docosahexaenoic acid (DHA) suppressed the H2O2-induced transcriptional upregulation of 5-LOX and proinflammatory hydroxyeicosatetraenoic acids (HETEs) following omega-6 PUFA oxidation [25]. These results imply the role of 5-LOX in lipid peroxidation in RPE cells. However, to the best of our knowledge, no studies have implicated the direct involvement of 5-LOX in RPE or retinal cell death under excessive oxidative stress in in vitro or in vivo models.
The role of LOXs in retinal or RPE diseases is still poorly understood. In this study, we investigated the role of 5-LOX in ROS-damaged RPE and retina with sodium iodate- (NaIO3-) induced cell death in RPE. We used ARPE-19 cells as an in vitro model, as well as a murine model of NaIO3-induced acute retinal damage, which has been widely used for investigating ROS-induced effects in AMD [26, 27]. Both pharmacological and genetic approaches were used to verify the effect of LOX inhibition on protecting the retina or RPE from regulated cell death such as ferroptosis.
2. Materials and Methods
2.1. Materials and Reagents
Protein Block (ab156024) was purchased from Abcam (Cambridge, UK). ATP Detection Assay Kit-Luminescence (700410), arachidonic acid (90010), BLX-3887 (27391), deferoxamine (DFO, 14595), Erastin (17754), ferrostatin-1 (17729), JC-1 (15003), Mk-886 (10133), ML355 (18537), necrostatin-1 (11658), RSL3 (19288), Zileuton (10006967), and Z-VAD-FMK (14467) were purchased from Cayman (Ann Arbor, MA, USA). A black 96-well glass-bottom plate was purchased from Cellvis (Mountain View, CA, USA). Cell culture plates including 6-, 12-, and 96-well plates were purchased from Corning (Corning, NY, USA). Cell Counting Kit-8 (CCK-8, CK04) and FerroOrange (F374-10) were purchased from Dojindo (Kumamoto, Japan). Scramble control (SR30004) and the siRNA specific for human ALOX5 (SR319325) were purchased from OriGene (Rockville, MD, USA). Corn oil (sc-214761) was purchased from Santa Cruz (Dallas, TX, USA). NaIO3 (S4007) and tert-Butyl hydroperoxide (tBHP, 458139) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Bodipy C11 (D3861), Dulbecco’s Modified Eagle’s Medium/Nutrient Mixture F-12 (DMEM/F-12, 12400024), fetal bovine serum (FBS, A3160602), glass-bottom 8-well chamber slides (154534PK), Lipofectamine RNAiMAX Transfection Reagent (13778075), MitoSOX (M36008), M-PER™ Mammalian Protein Extraction Reagent (M-PER, 78501), and T-PER™ Tissue Protein Extraction Reagent (T-PER, 78510) were purchased from Thermo Fisher (Waltham, MA, USA). Quick-RNA™ Miniprep Kit was purchased from Zymo (Irvine, CA, USA).
2.2. Cell Culture
The RPE cell line ARPE-19 (ATCC, Manassas, VA, USA) was seeded at densities of
2.3. ALOX5 Knockdown with siRNA
To knockdown ALOX5, ARPE-19 cells were transfected for 72 h in 24-well plates with three unique 27mer siRNA duplexes specific for human ALOX5 (OriGene, SR319325, 10 nM), or with scrambled siRNA (OriGene SR30004, 10 nM) as negative control, using the Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher) according to the manufacturer’s protocol. In vitro experiments were carried out 5 days after the start of the transfection procedure. Effectiveness of the ALOX5 knockdown was examined using western blot analysis for 5-LOX protein.
2.4. Cell Viability Assay
Cells were seeded in sterile transparent 96-well plates. The culture media was mixed with 10% (
2.5. Fluorescence Probes for Oxidative Stress and Intracellular Ferrous Ion
ARPE-19 cells seeded in black glass-bottom 96-well plates were stained with BODIPY C1 (Ex/Em: 488/520 and 590 nm, 5 μM 30 min,
2.6. HPLC Detection of Arachidonic Acid Metabolites
The intracellular component of ARPE-19 cells was extracted using subcellular fractionation buffer (HEPES 20 mM, KCl 10 mM, MgCl2 2 mM, EDTA 1 mM, EGTA 2 mM, DTT 1 mM, and proteinase inhibitor). Then, 100 μL of the sample was fortified with isotopically labeled analogues of arachidonic acid and 5-hydroxyeicosatetraenoic acid (5-HETE) that functioned as isotope internal standards. Next, the sample was acidified with 0.5 mL 1% formic acid aqueous solution and mixed with ethyl acetate solution to extract the method analytes, including arachidonic acid, 5-HETE, and their isotope-labeled analogues. The extract was concentrated to dryness with nitrogen and then reconstituted in 50 μL acetonitrile and 50 μL 0.1% formic acid aqueous solution. The analytes were separated on a Poroshell EC-18 column (Agilent Technologies, Santa Clara, CA, USA) with gradient elution using a mobile phase made of ultrapure water and acetonitrile. Detection was carried out using negative electrospray ionization and multiple reaction monitoring (MRM) in liquid chromatography-tandem mass spectrometry. The concentration of arachidonic acid and 5-HETE was calculated using the isotope internal standard. The data was acquired and processed using Agilent MassHunter Workstation Version 10.1 software (Agilent Technologies). Detailed methodology is described in Supplemental Method S1.
2.7. Evaluation of Mitochondrial Function and Integrity
Mitochondrial function and integrity of ARPE-19 cells were evaluated using ATP Detection Assay Kit-Luminescence (Cayman) and JC-1 staining (Cayman), respectively. In the ATP detection, the luciferin in assay reagent was converted to oxyluciferin with light emission that was quantitatively proportional to the amount of intracellular ATP (
2.8. Animal Care for In Vivo Experiments
Animal experiments were conducted in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement on the Use of Animals in Ophthalmic and Vision Research. All procedures involving animals were approved by the Institutional Animal Care and Use Committee of Kaohsiung Chang Gung Memorial Hospital (Kaohsiung, Taiwan). C57BL/6JNarl mice (National Laboratory Animal Center, Taipei, Taiwan) were maintained on 12 h light/12 h dark cycles with ad libitum food and water.
2.9. NaIO3-Induced Acute Retinal Degeneration of a Murine Model
Acute retinal degeneration was induced with intraperitoneal injection of NaIO3 (40 mg/kg of body weight) in sterile phosphate-buffered saline (PBS) in 6-week-old male C57BL/6JNarl mice based on the previously published protocols [26, 27]. Mice in the control group were injected with equal volume of PBS. Mice were sacrificed with intraperitoneal injection of Zoletil® 50 (zolazepam and tiletamine, 100 mg/kg body weight) (Virbac, Carros, France) and xylazine (100 mg/kg body weight) (Bayer, Leverkusen, Germany) 24 h, 3 days, and 14 days following NaIO3 injection depending on the experimental design. For protecting RPE/retina from NaIO3-induced damage, 5-LOX inhibitor Zileuton (20 mg/kg, dissolved in 10% DMSO and 90% corn oil), DFO (100 mg/kg in PBS), or Ferrostatin-1 (5 mg/kg, dissolved in 3% DMSO and 97% PBS) was injected intraperitoneally twice, at 24 h and 15 min before NaIO3 treatment.
2.10. Cryosections of Mouse Retina
After sacrificing the mice, eyeballs were extracted and fixed with 4% paraformaldehyde (PFA) for 3 h at 4°C, followed by serial dehydration in sucrose (concentration from 10 to 30%) at 4°C, and then embedded in Tissue-Tek® O.C.T. Compound (4583, Sakura Finetek, Torrance, CA, USA). Transverse cryosections (20 μm thick) were cut and mounted onto glass slides for drying and were stored in a -80°C freezer before staining.
2.11. Detection of mRNA Expression with Real-Time PCR
The total RNA of mouse RPE/choroid was extracted using the Quick-RNA™ Miniprep Kit (Zymo) and then reversely transcripted with the cDNA Reverse Transcription Kit (Thermo Fisher). Quantitative real-time PCR was performed for mouse ALOX5, SLC7A11, GPX4, CHAC1, CISD1, HSPB1, CD80, TNF, and ACTB using specific primers (Table 1) and SYBR Green qPCR assays using Applied Biosystems™ 7500 Fast Real-time PCR System (Thermo Fisher). Fold changes in mRNA expression were analyzed using the comparative cycle threshold method. ACTB was used as the housekeeping gene for the analysis of target gene expression.
Table 1
Primers of mouse genes for real-time PCR.
| Gene name | Accession number | Forward primer | Revere primer |
| ALOX5 | NM_009662 | TCTTCCTGGCACGACTTTGCTG | GCAGCCATTCAGGAACTGGTAG |
| GPX4 | NM_001037741 | CCTCTGCTGCAAGAGCCTCCC | CTTATCCAGGCAGACCATGTGC |
| SLC7A11 | NM_011990 | CTTTGTTGCCCTCTCCTGCTTC | CAGAGGAGTGTGCTTGTGGACA |
| CHAC1 | NM_026929 | TGACCCTCCTTGAAGACCGTGA | AGTGTCATAGCCACCAAGCACG |
| CISD1 | NM_134007 | AAGACAACCCGAAGGTGGTGCA | CTTCGTTGTGCTTTATGTGAGCC |
| HSPB1 | NM_013560 | GCTCACAGTGAAGACCAAGGAAG | TGAAGCACCGAGAGATGTAGCC |
| CD80 | NM_009855 | CCTCAAGTTTCCATGTCCAAGGC | GAGGAGAGTTGTAACGGCAAGG |
| TNF | NM_013693 | GGTGCCTATGTCTCAGCCTCTT | GCCATAGAACTGATGAGAGGGAG |
| ACTB | NM_007393 | CGGTTCCGATGCCCTGAGGCTCTT | CGTCACACTTCATGATGGAATTGA |
The primers for ALOX5, GPX4, SCL7A11, CHACI, CISDI, HSPB1, CD80, and TNF were from OriGene (Rockville, MD, USA).
2.12. Western Blot Analysis
ARPE-19 cells (
2.13. Immunofluorescence Imaging for In Vitro Studies
For immunofluorescence imaging of intracellular structure, ARPE-19 cells were seeded at a density of
2.14. Immunofluorescence Imaging for In Vivo Studies
The primary antibodies used include anti-Iba1 (019-19741, Fujifilm Wako, Osaka, Japan), anti-4-hydroxynonenal (HNE) (HNEJ-2, JaICA, Shizuoka, Japan), and anti-zonula occludens-1 (ZO-1, 61-7300, Thermo Fisher). For flat mount imaging of the RPE monolayer, the eyeball was cut along the equator. After removal of the anterior segment and neuroretina, the eyecup was fixed with 4% PFA for 3 h, blocked with mouse-on-mouse blocking reagent (ab269452, Abcam) for mouse-derived primary antibodies or 5% normal goat serum for the rabbit-derived primary antibodies with 0.3% Triton X-100 in PBS for 1 h at RT. Next, the eyecup was incubated with primary antibodies 4-HNE (
2.15. Statistical Analyses
The differences between the control and treatment groups were compared using Student’s
3. Results
3.1. NaIO3 Induces Oxidative Stress and Cell Death That Is Mitigated by Treatment with Ferroptosis Inhibitors in ARPE-19 Cells
NaIO3 treatment induced cell death with more than 50% decline in ARPE-19 cells at NaIO3 concentrations higher than 30 mM (Figure 1(a)). Lethal concentration of NaIO3 (35 mM, 20 h) induced rapid elevation of intracellular ROS in ARPE-19 cells, which was detected with H2DCFDA staining 1 h after NaIO3 treatment (Figure 1(b)). To identify the underlying mechanism of cell death induced by NaIO3, inhibitors for different pathways including apoptosis (z-VAD-FMK, 33 μM, pretreatment 8 h), necroptosis (necrostatin-1, 40 μM, pretreatment 8 h), and ferroptosis (Ferrostatin-1, 2 μM, pretreatment 8 h) were used to protect cells from NaIO3-induced loss in cell viability. We found that pretreatment with ferroptosis inhibitor, ferrostatin-1, partially alleviated NaIO3-induced cell death (Figure 1(c)). Furthermore, 8 h pretreatment with iron-chelator DFO also prevented NaIO3-induced cell death in ARPE-19 cells (Figure 1(d)). These results suggest that ferroptosis may be one of the major mechanisms of cell death induced by NaIO3.
[figures omitted; refer to PDF]
3.2. Inhibition of 5-LOX Reduces NaIO3-Induced Cell Death and ROS Production
Oxidative stress can induce the mobilization of arachidonic acid from membranous structures in the cells [28]. Arachidonic acid can be metabolized by lipoxygenases to produce 5-hydroperoxyeicosatetraenoic acid (5-HPETE), which is associated with lipid peroxidation and ferroptosis [29]. HPLC-MS/MS analysis showed that NaIO3 (35 mM, 15 h) induced upregulation of arachidonic acid and its 5-LOX-dependent stable metabolite 5-HETE in cell lysates of ARPE-19 cells (Figure 2(a)). Other arachidonic acid-associated metabolites, such as 8-iso prostaglandin F2α and prostaglandin F2α, were not detected. Externally derived arachidonic acid increased the susceptibility to nonlethal NaIO3 (10 mM, 20 h)-induced cell death when compared with cells cultured in serum-free medium (Figure 2(b)). Pretreatment with the 5-LOX inhibitor Zileuton for 8 h protected ARPE-19 cells from NaIO3-induced cell death and maintained cell viability (Figure 2(c)). In contrast, 5-LOX activating protein inhibitor Mk-886 (15 μM), 12-LOX inhibitor ML355 (3 μM), and 15-LOX inhibitor BLX-3887 (500 nM) had limited or no effect on NaIO3-induced cell death (Figure 2(d)). We further verified the role of 5-LOX in ARPE-19 cells lacking 5-LOX due to knockdown of ALOX5 with siRNA (ALOX5-KD). ALOX5-KD cells were resistant to NaIO3-induced cell death when compared with cells treated with scrambled siRNA (Figure 2(e)). Additionally, the combination of Zileuton (40 μM) and DFO (25 μM) at suboptimal concentrations did not exert an additive effect in protecting ARPE-19 cells from NaIO3-induced cell death (Figure 2(f)). Moreover, pretreatment with Zileuton also mitigated ferroptosis induced by conventional ferroptosis inducers including RSL3 (1 μM), Erastin (10 μM), and combined treatment with FeSO4 (100 μM) and tBHP (250 μM). The role of 5-LOX in ferroptosis was verified by the observed resistance to Erastin-induced cell death in ALOX5-KD ARPE-19 cells (Figure 3). These findings suggest the significance of 5-LOX in ferroptosis. Inhibition of 5-LOX could be a beneficial approach to protect RPE from oxidative stress-induced cell death.
[figures omitted; refer to PDF]
[figures omitted; refer to PDF]
Lipid peroxidation is one of the key players in ferroptosis. Pretreatment with Zileuton and knockdown of ALOX5 both reduced NaIO3-induced green fluorescence emission (520 nm) of BODIPY C11, an indicator of lipid peroxidation, in live ARPE-19 cells (Figures 4(a) and 4(b)). Intracellular iron level may affect the susceptibility of cells to ferroptosis. However, FerroOrange staining showed that treatment with Zileuton (75 μM) for 24 h did not affect the level of intracellular ferrous iron (Figure 4(c)). NaIO3 induced the upregulation of ferroptosis-associated antioxidant protein cystine-glutamate antiporter (xCT or SLC7A11) that is involved in the intracellular transport of cysteine and glutathione production. Furthermore, the upregulation of xCT was alleviated in ALOX5-KD ARPE-19 cells, which suggests lower levels of ROS (Figure 4(d)). Zileuton pretreatment mitigated the percentage of 8-OHdG-positive nuclei, an indicator of oxidative stress-induced DNA damage, in ARPE-19 cells (Figure 4(e)). These results suggest that inhibition of 5-LOX suppresses NaIO3-induced ROS, which may be correlated with cell death in RPE.
[figures omitted; refer to PDF]
3.3. NaIO3 Induces Mitochondrial Damage in ARPE-19 Cells
Mitochondria contain membranous structures and iron and therefore may be a target of oxidative damage in ferroptosis [20, 30, 31]. NaIO3 treatment caused an increase in mitochondrial ROS, detected with MitoSOX staining (Figure 5(a)). Additionally, a decrease in mitochondrial membrane potential (ΔΨm) was detected with JC-1 staining (Figure 5(b)), along with a decrease in ATP production (Figure 5(c)). Pretreatment with Zileuton (75 μM) alleviated NaIO3-induced mitochondrial ROS, decreased ΔΨm and ATP production, and decreased expression of mitochondrial proteins including COX-4, SDHB, and SDHA, demonstrated by immunofluorescence imaging or western blot analysis (Figures 5(d) and 5(e)). Using ALOX5-KD ARPE-19 cells, the role of 5-LOX was further verified by rescue of impaired ΔΨm, ATP production, and downregulated mitochondrial proteins (Figures 5(b), 5(c), and 5(e)).
[figures omitted; refer to PDF]
3.4. NaIO3 Caused RPE Loss, Inflammatory Responses, and Damage of Mouse Retina
To verify the effects of NaIO3 and the role of 5-LOX in RPE in vivo, we used a murine model of NaIO3 (intraperitoneal injection 40 mg/kg body weight)-induced acute retinal degeneration using 6-week-old male wild-type C57BL/6JNarl mice. To detect ferroptosis after NaIO3 treatment in vivo, we examined genes associated with ferroptosis using real-time PCR. Changes in the mRNA expression of ferroptosis-associated genes ALOX5, GPX4, SLC7A11, CHAC1, CISD1, and HSPB1 were observed in RPE/choroid samples collected 1 day after NaIO3 treatment (Figure 6(a)). Unexpectedly, we observed a decrease in mRNA expressions of GPX4 and CIS1D, previously reported to protect mitochondria from lipid peroxidation [32], following the NaIO3 treatment. NaIO3-induced change in the protein level of xCT (SLC7A11) was consistent with change in mRNA in RPE/choroid (Figure 6(b)). Pretreatment with Zileuton (20 mg/kg intraperitoneal, 24 h and 15min before NaIO3 injection) modulated NaIO3-induced changes in mRNA expression including ALOX5. These results suggest the potential participation of 5-LOX in cell death such as ferroptosis induced by NaIO3 in vivo. NaIO3 induced lipid peroxidation as evidenced by positive staining for 4-HNE, particularly in the membrane of cells in the RPE monolayer (Figure 6(c)). Meanwhile, cell death, demonstrated by positive TUNEL staining, was observed in the retinal photoreceptor layer 24 h after NaIO3 treatment (Figure 7(a)). Pretreatment with Zileuton effectively reduced NaIO3-induced cell death in the retina and 4-HNE staining of RPE (Figures 7(a) and 6(c)). Induction of ferroptosis was supported by the protective effect of DFO, which reduced NaIO3-induced cell death in mouse retina (Figure 7(b)).
[figures omitted; refer to PDF]
[figures omitted; refer to PDF]
Infiltration of inflammatory cells in the retina and/or RPE layers can be related to cell death. An increasing number of active microglia or monocytic cells with amoebic, round, or oval-shaped and positive Iba1-staining were observed in the RPE monolayers 3 days following NaIO3 treatment (Figures 8(a) and 8(b)). Pretreatment of mice with Zileuton reduced the number of Iba1-positive cells on the RPE monolayer surface and downregulated the expression of proinflammatory genes, including CD80 and TNF in the cells derived from the RPE and eyecup (Figure 8(c)). Destruction of RPE monolayer integrity was observed 14 days following NaIO3 treatment in mice. Pretreatment with Zileuton protected the RPE monolayer from NaIO3-induced destruction, which was demonstrated with ZO-1 staining. Pretreatment with ferroptosis inhibitors, such as DFO and ferrostatin-1, showed similar protective effects in the RPE monolayer (Figure 9(a)). This finding also supported the involvement of cell death mechanisms related to ferroptosis in NaIO3-induced destruction of RPE in vivo. Additionally, NaIO3 induced reduction in the thickness of neuroretina, which was also mitigated with Zileuton (Figure 9(b)).
[figures omitted; refer to PDF]
[figures omitted; refer to PDF]
4. Discussion
In this study, NaIO3-induced lipid peroxidation and cell death were mitigated with the 5-LOX inhibitor Zileuton in ARPE-19 cells (Figures 2 and 4). Furthermore, the potential benefit of 5-LOX inhibition was validated for the first time in an in vivo model of NaIO3-induced acute retinal degeneration. Inhibition of 5-LOX decreased lipid peroxidation of RPE cells (Figure 6), cell death in the photoreceptor layer of mouse retina (Figure 7), activation of inflammatory cells (Figure 8), and degeneration of the neuroretina and RPE monolayer following NaIO3 treatment (Figure 9). Pretreatment with ferroptosis inhibitors including DFO and ferrostatin-1 exerted similar effects in protecting RPE cells from NaIO3-induced damage both in in vitro and in vivo models (Figures 1, 2, and 9). Additionally, the role of 5-LOX in cell death caused by conventional ferroptosis inducers, such as Erastin was demonstrated in vitro (Figure 3). Our results suggest that ferroptosis was one of the major mechanisms involved in oxidative stress-induced cell death and that 5-LOX was a crucial enzyme that participated in the ROS-induced response and induction of ferroptosis in RPE cells. Therefore, modulating 5-LOX activity could be a promising strategy to alleviate damages induced by accumulation of ROS and disturbance of iron homeostasis in retinal diseases, such as AMD. The graphic summary of the proposed mechanisms is presented in Figure 10.
[figure omitted; refer to PDF]
Research on ferroptosis in the retina is still in its early stages. Ferroptosis has been implicated to be one of the mechanisms associated with stress-induced cell death and senescence in RPE [10–12, 33, 34]. The importance of antioxidative enzyme systems in the protection of retina degeneration has been emphasized previously. Increased expression of GPx4 provided strong functional and structural protection from oxidative damage in a transgenic mouse model [35]. Iron is essential for energy generation and metabolism in most tissues involved in energy homeostasis [36]. However, it has been reported that genetic iron-overload in diabetic Hfe-knockout mice escalated neuronal cell death, vascular damages, and defects in retinal barrier integrity [37]. Apart from DR, iron may also be involved in a broad range of retinal disorders. It has been reported that the iron levels in the human macula increase with age. Postmortem retinal tissues derived from patients with AMD had higher iron and iron-carrying transferrin protein (TF) than age-matched controls [15]. The increase in both iron and TF has been shown to be correlated with poor visual acuity in murine models of retinal detachment. Exogenous transferrin can thus help in iron clearance to decrease cell death induced by retinal detachment [38]. Ferrous ions have also been found to interact with bis-retinoids in the RPE and promote cell damage [39]. In another study, iron-chelating reagent metallocomplex zinc-desferrioxamine lowered lipid peroxidation and oxidative DNA damage in a murine model of retinitis pigmentosa [40]. These findings suggest that iron metabolism potentially participates in cell death observed in retinal diseases.
In addition to abnormal iron metabolism, research on ferroptosis-associated molecules and signaling pathways has also increased. Metabolism of cysteine, iron and lipid, mevalonate pathway, GPx4 activity, and autophagy have been reported to participate in the regulation of ferroptosis [20, 31, 41]. However, simple blockage of these metabolic and signaling pathways can cause disturbance and unexpected impairment in retinal functions; therefore, identification of a feasible treatment to control ferroptosis is challenging. In this study, NaIO3 induced changes in the mRNA expression of ferroptosis-associated genes including ALXO5, GPX4, SLC7A11, CHAC1, and HSPB1 in the mouse RPE/eyecup tissue (Figure 6) [32, 42, 43]. The understanding of 5-LOX activity in the RPE or retina is limited. We found that the protective effect of 5-LOX inhibition was mostly associated with NaIO3-induced oxidative stress, especially lipid peroxidation, and less likely associated with modulation of intracellular iron levels in ARPE-19 cells (Figure 4). It has previously been reported that DHA suppressed hydrogen peroxide-induced transcriptional upregulation of 5-LOX and associated proinflammatory HETEs, following omega-6 PUFA oxidation observed in ARPE-19 cells [25]. Some recombinant PEDF-R proteins, which can inhibit 5-LOX activity, have been shown to protect RPE cells from ROS-induced cell death in vitro via the inhibition of leukotriene production [24]. LOXs including 5-12- and 15-LOX can metabolize arachidonic acid and PUFA into inflammatory chemokines including leukotrienes and prostaglandins to counteract with the damages caused in diseases [44, 45]. Nevertheless, it has been reported that downstream metabolites of LOXs, such as HPETEs, can react with ROS and contribute to the lipid peroxidation, which induces ferroptosis. Mobilization of arachidonic acid under oxidative stress has also been reported [28]. In this study, we found that NaIO3 upregulated both arachidonic acid and 5-HETE in ARPE-19 cells (Figure 2). This could indicate the possibility of transient increase of unstable hydroperoxide derivatives, such as 5-HPETE, which may react with ROS to cause lipid peroxidation of cellular membrane structures through Fenton reaction inducing ferroptosis [21, 22]. In addition to cell death, NaIO3 caused a significant increase in the density of inflammatory cells in the RPE monolayer of the eyecup (Figure 8). ROS-damaged RPE cells potentially release proinflammatory signals, such as leukotriene B4, which can lead to infiltration of inflammatory cells in the retina [24]. However, the exact role of 5-LOX inhibition in the differentiation of inflammatory cells was not explored in this study and requires further investigation.
Upregulation of antioxidant proteins including xCT (SLC7A11) in vitro (Figure 4) and SCL7A11 and CHAC1 mRNA in vivo (Figure 6) suggested the activation of the intracellular antioxidant system, which utilizes glutathione to counteract NaIO3-induced increase in ROS. Upregulation of xCT was observed in both in vitro and in vivo experiments, suggesting that xCT may be a sensitive marker of ROS in RPE cells. This can also indicate shortage of cysteine following oxidative stress, and induction of ferroptosis in cysteine deprivation condition [41]. In addition, we found that NaIO3 induced significant loss of ATP production, mitochondrial transmembrane potential, and expression of mitochondrial proteins essential for citric acid cycle and the electron transport chain (Figure 5). Mitochondria are iron-rich organelles, in which iron is incorporated to form iron–sulfur clusters in the electron transport chain. However, abnormality in iron metabolism, particularly ferrous ions or excessive ROS, can induce lipid peroxidation through Fenton reaction, which may compromise mitochondrial membrane integrity and subsequently induce bioenergetic crisis and cell death [20]. This is of particular significance in the retina, which is a tissue with high metabolic demand and rich in mitochondria. In this study, Zileuton prevented an increase in ROS and mitigated the loss of mitochondrial proteins including SDHA, SDHB, and COX4, thereby preserving ATP production in ARPE-19 cells (Figure 5). Consistent with our findings, 5-LOX was previously shown to mediate mitochondrial damage and cell death in mononuclear cells in end-stage retinal disease patients and PC-12 neuronal cells [46]. NaIO3-induced drop in CIS1D mRNA, which regulates iron homeostasis in mitochondria, may indicate the involvement of mitochondria in ferroptosis in RPE cells in vivo. Overall, our results support the hypothesis that mitochondria are implicated in ferroptosis, and inhibition of 5-LOX can partially preserve mitochondrial integrity and function in RPE cells.
Our results suggested that NaIO3-induced oxidative damage, although a fast model to investigate the effects of ROS in the retina and RPE, should be interpreted cautiously. NaIO3 may induce cell death through multiple mechanisms besides ferroptosis in the RPE in vivo, and it is not easy to exclude the possibility that 5-LOX is activated by mechanisms other than NaIO3-induced ferroptosis in the retina. Nevertheless, NaIO3-induced ferroptosis was confirmed through the protective effects of the iron chelator, DFO, which inhibited cell death in the outer retinal layer and destruction of the RPE monolayer. Additionally, cell death induced by conventional ferroptosis inducers Erastin and RSL3 was successfully blocked via 5-LOX inhibition with Zileuton in ARPE-19 cells, providing evidence for the role of 5-LOX in ferroptosis in RPE cells in vitro. Moreover, combination of Zileuton with DFO did not exert additive effects when compared with Zileuton alone. Taken together, these results suggest that 5-LOX inhibition can effectively block ferroptosis in NaIO3-injured RPE.
5. Conclusions
In summary, we demonstrated the involvement of 5-LOX in oxidative stress in RPE cells, and that 5-LOX inhibition protected RPE cells from NaIO3-induced lipid peroxidation, mitochondrial damage, DNA damage, and cell death. The observed increase in 5-HETE provided evidence for the activation of the 5-LOX pathway and increase in the upstream unstable 5-HPETE. These eicosanoids can react with ROS to cause lipid peroxidation of cellular membrane structures ultimately leading to cell death through mechanisms including ferroptosis. A novel finding of our study was the protective effect of 5-LOX inhibition on RPE and retina from ROS-induced inflammation and cell death in vivo. Our results highlight the potential of 5-LOX inhibition as a feasible strategy for control of ROS damage in RPE and retina in retinal diseases, such as AMD. Future studies with genetic and pharmaceutical approaches are required to confirm the role of 5-LOX activity in managing retinal diseases associated with abnormal iron metabolism and oxidative stress.
Acknowledgments
We appreciate the Center for Shockwave Medicine and Tissue Engineering, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung, Taiwan, for providing the immunofluorescence microscope. We thank the service of real-time PCR provided by the Instrumentation Laboratory, Department of Medical Research, Kaohsiung Chang Gung Memorial Hospital. This work was supported by the Ministry of Science and Technology Research Project Grant (MOST 110-2314-B-182A-117) and Chang Gung Memorial Hospital under grant (CMRPG8K1341).
[1] T. Masuda, M. Shimazawa, H. Hara, "Retinal diseases associated with oxidative stress and the effects of a free radical scavenger (edaravone).," Oxidative Medicine and Cellular Longevity, vol. 2017,DOI: 10.1155/2017/9208489, 2017.
[2] T. I. Peng, M. J. Jou, "Oxidative stress caused by mitochondrial calcium overload," Annals of the New York Academy of Sciences, vol. 1201 no. 1, pp. 183-188, DOI: 10.1111/j.1749-6632.2010.05634.x, 2010.
[3] H. Prentice, J. P. Modi, J. Y. Wu, "Mechanisms of neuronal protection against excitotoxicity, endoplasmic reticulum stress, and mitochondrial dysfunction in stroke and neurodegenerative diseases," Oxidative Medicine and Cellular Longevity, vol. 2015,DOI: 10.1155/2015/964518, 2015.
[4] J. Marshall, K. Y. Wong, C. N. Rupasinghe, R. Tiwari, X. Zhao, E. D. Berberoglu, C. Sinkler, J. Liu, I. Lee, K. Parang, M. R. Spaller, M. Hüttemann, D. J. Goebel, "Inhibition of _N_ -methyl-d-aspartate-induced retinal neuronal death by polyarginine peptides is linked to the attenuation of stress-induced hyperpolarization of the inner mitochondrial membrane potential ∗," The Journal of Biological Chemistry, vol. 290 no. 36, pp. 22030-22048, DOI: 10.1074/jbc.M115.662791, 2015.
[5] W. Xiong, A. E. MacColl Garfinkel, Y. Li, L. I. Benowitz, C. L. Cepko, "NRF2 promotes neuronal survival in neurodegeneration and acute nerve damage," The Journal of Clinical Investigation, vol. 125 no. 4, pp. 1433-1445, DOI: 10.1172/JCI79735, 2015.
[6] T. Noro, K. Namekata, Y. Azuchi, A. Kimura, X. Guo, C. Harada, T. Nakano, H. Tsuneoka, T. Harada, "Spermidine ameliorates neurodegeneration in a mouse model of normal tension glaucoma," Investigative Ophthalmology & Visual Science, vol. 56 no. 8,DOI: 10.1167/iovs.15-17142, 2015.
[7] T. Noro, K. Namekata, A. Kimura, X. Guo, Y. Azuchi, C. Harada, T. Nakano, H. Tsuneoka, T. Harada, "Spermidine promotes retinal ganglion cell survival and optic nerve regeneration in adult mice following optic nerve injury," Cell Death & Disease, vol. 6 no. 4, pp. e1720-e1720, DOI: 10.1038/cddis.2015.93, 2015.
[8] J. L. Dunaief, "The role of apoptosis in age-related macular degeneration," Archives of Ophthalmology, vol. 120 no. 11,DOI: 10.1001/archopht.120.11.1435, 2002.
[9] Y. Murakami, H. Matsumoto, M. Roh, A. Giani, K. Kataoka, Y. Morizane, M. Kayama, A. Thanos, S. Nakatake, S. Notomi, T. Hisatomi, Y. Ikeda, T. Ishibashi, K. M. Connor, J. W. Miller, D. G. Vavvas, "Programmed necrosis, not apoptosis, is a key mediator of cell loss and DAMP- mediated inflammation in dsRNA-induced retinal degeneration," Cell Death and Differentiation, vol. 21 no. 2, pp. 270-277, DOI: 10.1038/cdd.2013.109, 2014.
[10] K. Totsuka, T. Ueta, T. Uchida, M. F. Roggia, S. Nakagawa, D. G. Vavvas, M. Honjo, M. Aihara, "Oxidative stress induces ferroptotic cell death in retinal pigment epithelial cells," Experimental Eye Research, vol. 181, pp. 316-324, DOI: 10.1016/j.exer.2018.08.019, 2019.
[11] C. Chen, J. Chen, Y. Wang, Z. Liu, Y. Wu, "Ferroptosis drives photoreceptor degeneration in mice with defects in all-trans-retinal clearance," The Journal of Biological Chemistry, vol. 296,DOI: 10.1074/jbc.RA120.015779, 2021.
[12] B. Liu, W. Wang, A. Shah, M. Yu, Y. Liu, L. He, J. Dang, L. Yang, M. Yan, Y. Ying, Z. Tang, K. Liu, "Sodium iodate induces ferroptosis in human retinal pigment epithelium ARPE-19 cells," Cell Death & Disease, vol. 12 no. 3,DOI: 10.1038/s41419-021-03520-2, 2021.
[13] J. L. Dunaief, "Iron induced oxidative damage as a potential factor in age-related macular degeneration: the Cogan Lecture," Investigative Ophthalmology & Visual Science, vol. 47 no. 11, pp. 4660-4664, DOI: 10.1167/iovs.06-0568, 2006.
[14] A. Ciudin, C. Hernández, R. Simó, "Iron Overload in Diabetic Retinopathy: A Cause or a Consequence of Impaired Mechanisms," Experimental Diabetes Research, vol. 2010,DOI: 10.1155/2010/714108, 2010.
[15] X. He, P. Hahn, J. Iacovelli, R. Wong, C. King, R. Bhisitkul, M. Massaro-Giordano, J. L. Dunaief, "Iron homeostasis and toxicity in retinal degeneration," Progress in Retinal and Eye Research, vol. 26 no. 6, pp. 649-673, DOI: 10.1016/j.preteyeres.2007.07.004, 2007.
[16] S. J. Dixon, K. M. Lemberg, M. R. Lamprecht, R. Skouta, E. M. Zaitsev, C. E. Gleason, D. N. Patel, A. J. Bauer, A. M. Cantley, W. S. Yang, B. Morrison, B. R. Stockwell, "Ferroptosis: an iron-dependent form of nonapoptotic cell death," Cell, vol. 149 no. 5, pp. 1060-1072, DOI: 10.1016/j.cell.2012.03.042, 2012.
[17] S. Doll, B. Proneth, Y. Y. Tyurina, E. Panzilius, S. Kobayashi, I. Ingold, M. Irmler, J. Beckers, M. Aichler, A. Walch, H. Prokisch, D. Trümbach, G. Mao, F. Qu, H. Bayir, J. Füllekrug, C. H. Scheel, W. Wurst, J. A. Schick, V. E. Kagan, J. P. F. Angeli, M. Conrad, "ACSL4 dictates ferroptosis sensitivity by shaping cellular lipid composition," Nature Chemical Biology, vol. 13 no. 1, pp. 91-98, DOI: 10.1038/nchembio.2239, 2017.
[18] H. Yu, P. Guo, X. Xie, Y. Wang, G. Chen, "Ferroptosis, a new form of cell death, and its relationships with tumourous diseases," Journal of Cellular and Molecular Medicine, vol. 21 no. 4, pp. 648-657, DOI: 10.1111/jcmm.13008, 2017.
[19] Kajarabille and Latunde-Dada, "Programmed cell-death by ferroptosis: antioxidants as mitigators," International Journal of Molecular Sciences, vol. 20 no. 19,DOI: 10.3390/ijms20194968, 2019.
[20] A. M. Battaglia, R. Chirillo, I. Aversa, A. Sacco, F. Costanzo, F. Biamonte, "Ferroptosis and cancer: mitochondria meet the “iron maiden” cell death," Cell, vol. 9 no. 6,DOI: 10.3390/cells9061505, 2020.
[21] S. Doll, F. P. Freitas, R. Shah, M. Aldrovandi, M. C. da Silva, I. Ingold, A. Goya Grocin, T. N. Xavier da Silva, E. Panzilius, C. H. Scheel, A. Mourão, K. Buday, M. Sato, J. Wanninger, T. Vignane, V. Mohana, M. Rehberg, A. Flatley, A. Schepers, A. Kurz, D. White, M. Sauer, M. Sattler, E. W. Tate, W. Schmitz, A. Schulze, V. O’Donnell, B. Proneth, G. M. Popowicz, D. A. Pratt, J. P. F. Angeli, M. Conrad, "FSP1 is a glutathione-independent ferroptosis suppressor," Nature, vol. 575 no. 7784, pp. 693-698, DOI: 10.1038/s41586-019-1707-0, 2019.
[22] B. R. Stockwell, J. P. Friedmann Angeli, H. Bayir, A. I. Bush, M. Conrad, S. J. Dixon, S. Fulda, S. Gascón, S. K. Hatzios, V. E. Kagan, K. Noel, X. Jiang, A. Linkermann, M. E. Murphy, M. Overholtzer, A. Oyagi, G. C. Pagnussat, J. Park, Q. Ran, C. S. Rosenfeld, K. Salnikow, D. Tang, F. M. Torti, S. V. Torti, S. Toyokuni, K. A. Woerpel, D. D. Zhang, "Ferroptosis: a regulated cell death nexus linking metabolism, redox biology, and disease," Cell, vol. 171 no. 2, pp. 273-285, DOI: 10.1016/j.cell.2017.09.021, 2017.
[23] G. A. Czapski, K. Czubowicz, R. P. Strosznajder, "Evaluation of the antioxidative properties of lipoxygenase inhibitors," Pharmacological Reports, vol. 64 no. 5, pp. 1179-1188, DOI: 10.1016/S1734-1140(12)70914-3, 2012.
[24] P. Subramanian, E. F. Mendez, S. P. Becerra, "A novel inhibitor of 5-lipoxygenase (5-LOX) prevents oxidative stress–induced cell death of retinal pigment epithelium (RPE) cells," Investigative Ophthalmology & Visual Science, vol. 57 no. 11, pp. 4581-4588, DOI: 10.1167/iovs.15-19039, 2016.
[25] H. H. Leung, J. M. Galano, C. Crauste, T. Durand, J. C. Y. Lee, "Combination of lutein and zeaxanthin, and DHA regulated polyunsaturated fatty acid oxidation in H 2 O 2 -stressed retinal cells," Neurochemical Research, vol. 45 no. 5, pp. 1007-1019, DOI: 10.1007/s11064-020-02994-4, 2020.
[26] G. Chowers, M. Cohen, D. Marks-Ohana, S. Stika, A. Eijzenberg, E. Banin, A. Obolensky, "Course of sodium iodate–induced retinal degeneration in albino and pigmented mice," Investigative Ophthalmology & Visual Science, vol. 58 no. 4, pp. 2239-2249, DOI: 10.1167/iovs.16-21255, 2017.
[27] M. Moriguchi, S. Nakamura, Y. Inoue, A. Nishinaka, M. Nakamura, M. Shimazawa, H. Hara, "Irreversible photoreceptors and RPE cells damage by intravenous sodium iodate in mice is related to macrophage accumulation," Investigative Ophthalmology & Visual Science, vol. 59 no. 8, pp. 3476-3487, DOI: 10.1167/iovs.17-23532, 2018.
[28] M. A. Balboa, J. Balsinde, "Oxidative stress and arachidonic acid mobilization," Biochimica et Biophysica Acta, Molecular and Cell Biology of Lipids, vol. 1761 no. 4, pp. 385-391, DOI: 10.1016/j.bbalip.2006.03.014, 2006.
[29] J. P. Friedmann Angeli, M. Schneider, B. Proneth, Y. Y. Tyurina, V. A. Tyurin, V. J. Hammond, N. Herbach, M. Aichler, A. Walch, E. Eggenhofer, D. Basavarajappa, O. Rådmark, S. Kobayashi, T. Seibt, H. Beck, F. Neff, I. Esposito, R. Wanke, H. Förster, O. Yefremova, M. Heinrichmeyer, G. W. Bornkamm, E. K. Geissler, S. B. Thomas, B. R. Stockwell, V. B. O’Donnell, V. E. Kagan, J. A. Schick, M. Conrad, "Inactivation of the ferroptosis regulator Gpx4 triggers acute renal failure in mice," Nature Cell Biology, vol. 16 no. 12, pp. 1180-1191, DOI: 10.1038/ncb3064, 2014.
[30] T. Tadokoro, M. Ikeda, T. Ide, H. Deguchi, S. Ikeda, K. Okabe, A. Ishikita, S. Matsushima, T. Koumura, K. I. Yamada, H. Imai, H. Tsutsui, "Mitochondria-dependent ferroptosis plays a pivotal role in doxorubicin cardiotoxicity," JCI Insight, vol. 5 no. 9,DOI: 10.1172/jci.insight.132747, 2020.
[31] H. Wu, F. Wang, N. Ta, T. Zhang, W. Gao, "The multifaceted regulation of mitochondria in ferroptosis," Lifestyles, vol. 11 no. 3,DOI: 10.3390/life11030222, 2021.
[32] H. Yuan, X. Li, X. Zhang, R. Kang, D. Tang, "CISD1 inhibits ferroptosis by protection against mitochondrial lipid peroxidation," Biochemical and Biophysical Research Communications, vol. 478 no. 2, pp. 838-844, DOI: 10.1016/j.bbrc.2016.08.034, 2016.
[33] Y. Sun, Y. Zheng, C. Wang, Y. Liu, "Glutathione depletion induces ferroptosis, autophagy, and premature cell senescence in retinal pigment epithelial cells," Cell Death & Disease, vol. 9 no. 7,DOI: 10.1038/s41419-018-0794-4, 2018.
[34] J. J. Lee, K. Ishihara, S. Notomi, N. E. Efstathiou, T. Ueta, D. Maidana, X. Chen, Y. Iesato, A. Caligiana, D. G. Vavvas, "Lysosome-associated membrane protein-2 deficiency increases the risk of reactive oxygen species-induced ferroptosis in retinal pigment epithelial cells," Biochemical and Biophysical Research Communications, vol. 521 no. 2, pp. 414-419, DOI: 10.1016/j.bbrc.2019.10.138, 2020.
[35] L. Lu, B. C. Oveson, Y.–. J. Jo, T. W. Lauer, S. Usui, K. Komeima, B. Xie, P. A. Campochiaro, "Increased expression of glutathione peroxidase 4 strongly protects retina from oxidative damage," Antioxidants & Redox Signaling, vol. 11 no. 4, pp. 715-724, DOI: 10.1089/ars.2008.2171, 2009.
[36] J. M. Fernández-Real, D. McClain, M. Manco, "Mechanisms linking glucose homeostasis and iron metabolism toward the onset and progression of type 2 diabetes," Diabetes Care, vol. 38 no. 11, pp. 2169-2176, DOI: 10.2337/dc14-3082, 2015.
[37] K. Chaudhary, W. Promsote, S. Ananth, R. Veeranan-Karmegam, A. Tawfik, P. Arjunan, P. Martin, S. B. Smith, M. Thangaraju, O. Kisselev, V. Ganapathy, J. P. Gnana-Prakasam, "Iron overload accelerates the progression of diabetic retinopathy in association with increased retinal renin expression," Scientific Reports, vol. 8 no. 1,DOI: 10.1038/s41598-018-21276-2, 2018.
[38] A. Daruich, Q. Le Rouzic, L. Jonet, M. C. Naud, L. Kowalczuk, J. A. Pournaras, J. H. Boatright, A. Thomas, N. Turck, A. Moulin, F. Behar-Cohen, "Iron is neurotoxic in retinal detachment and transferrin confers neuroprotection," Science Advances, vol. 5 no. 1,DOI: 10.1126/sciadv.aau9940, 2019.
[39] K. Ueda, H. J. Kim, J. Zhao, Y. Song, J. L. Dunaief, J. R. Sparrow, "Iron promotes oxidative cell death caused by bisretinoids of retina," Proceedings of the National Academy of Sciences of the United States of America, vol. 115 no. 19, pp. 4963-4968, DOI: 10.1073/pnas.1722601115, 2018.
[40] A. Obolensky, E. Berenshtein, M. Lederman, B. Bulvik, R. Alper-Pinus, R. Yaul, E. Deleon, I. Chowers, M. Chevion, E. Banin, "Zinc-desferrioxamine attenuates retinal degeneration in the rd10 mouse model of retinitis pigmentosa," Free Radical Biology & Medicine, vol. 51 no. 8, pp. 1482-1491, DOI: 10.1016/j.freeradbiomed.2011.07.014, 2011.
[41] M. Gao, J. Yi, J. Zhu, A. M. Minikes, P. Monian, C. B. Thompson, X. Jiang, "Role of mitochondria in ferroptosis," Molecular Cell, vol. 73 no. 2, pp. 354-363.e3, DOI: 10.1016/j.molcel.2018.10.042, 2019.
[42] Y. Liu, W. Wang, Y. Li, Y. Xiao, J. Cheng, J. Jia, "The 5-lipoxygenase inhibitor zileuton confers neuroprotection against glutamate oxidative damage by inhibiting ferroptosis," Biological & Pharmaceutical Bulletin, vol. 38 no. 8, pp. 1234-1239, DOI: 10.1248/bpb.b15-00048, 2015.
[43] M. S. Chen, S. F. Wang, C. Y. Hsu, P. H. Yin, T. S. Yeh, H. C. Lee, L. M. Tseng, "CHAC1 degradation of glutathione enhances cystine-starvation-induced necroptosis and ferroptosis in human triple negative breast cancer cells via the GCN2-eIF2 α -ATF4 pathway," Oncotarget, vol. 8 no. 70, pp. 114588-114602, DOI: 10.18632/oncotarget.23055, 2017.
[44] D. Steinhilber, A. S. Fischer, J. Metzner, S. D. Steinbrink, J. Roos, M. Ruthardt, T. J. Maier, "5-Lipoxygenase: underappreciated role of a pro-inflammatory enzyme in tumorigenesis," Frontiers in Pharmacology, vol. 1,DOI: 10.3389/fphar.2010.00143, 2010.
[45] A. Higdon, A. R. Diers, J. Y. Oh, A. Landar, V. M. Darley-Usmar, "Cell signalling by reactive lipid species: new concepts and molecular mechanisms," The Biochemical Journal, vol. 442 no. 3, pp. 453-464, DOI: 10.1042/BJ20111752, 2012.
[46] M. Maccarrone, M. Taccone-Gallucci, A. Finazzi-Agrò, "5-Lipoxygenase-mediated mitochondrial damage and apoptosis of mononuclear cells in ESRD patients," Kidney International, vol. 63 no. 84, pp. S33-S36, DOI: 10.1046/j.1523-1755.63.s84.26.x, 2003.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2022 Jong-Jer Lee et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. https://creativecommons.org/licenses/by/4.0/
Abstract
Excessive reactive oxygen species (ROS) contribute to damage of retinal cells and the development of retinal diseases including age-related macular degeneration (AMD). ROS result in increased metabolites of lipoxygenases (LOXs), which react with ROS to induce lipid peroxidation and may lead to ferroptosis. In this study, the effect of 5-LOX inhibition on alleviating ROS-induced cell death was evaluated using sodium iodate (NaIO3) in the retinal pigment epithelium (RPE) cell line ARPE-19 and a mouse model investigating oxidative stress in AMD. We demonstrated that NaIO3 induced cell death in the RPE cells through mechanisms including ferroptosis. Inhibition of 5-LOX with specific inhibitor, Zileuton, or siRNA knockdown of ALXO5 mitigated NaIO3-induced lipid peroxidation, mitochondrial damage, DNA impairment, and cell death in ARPE-19 cells. Additionally, in the mouse model, pretreatment with Zileuton reduced the NaIO3-induced lipid peroxidation of RPE cells, cell death in the photoreceptor layer of the retina, inflammatory responses, and degeneration of both the neuroretina and RPE monolayer cells. Our results suggest that 5-LOX plays a crucial role in ROS-induced cell death in the RPE and that regulating 5-LOX activity could be a useful approach to control ROS and ferroptosis-induced damage, which promote degeneration in retinal diseases.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Chang-Chien, Guo-Ping 2 ; Lin, Sufan 2 ; Yu-Ting, Hsiao 3
; Mu-Chan, Ke 3 ; Chen, Alexander 3 ; Tsu-Kung, Lin 4
1 Department of Ophthalmology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 833401, Taiwan; Center for Mitochondrial Research and Medicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833401, Taiwan
2 Super Micro Mass Research and Technology Center, Cheng Shiu University, Kaohsiung 833301, Taiwan; Center for Environmental Toxin and Emerging-Contaminant Research, Cheng Shiu University, Kaohsiung 833301, Taiwan; Institute of Environmental Toxin and Emerging-Contaminant, Cheng Shiu University, Kaohsiung 833301, Taiwan
3 Department of Ophthalmology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 833401, Taiwan
4 Center for Mitochondrial Research and Medicine, Kaohsiung Chang Gung Memorial Hospital, Kaohsiung 833401, Taiwan; Department of Neurology, Kaohsiung Chang Gung Memorial Hospital and Chang Gung University College of Medicine, Kaohsiung 833401, Taiwan





