Morinda officinalis polysaccharide regulates rat bone mesenchymal stem cell osteogenic–adipogenic differentiation in osteoporosis by upregulating miR‐21 and activating the PI3K/AKT pathway

Abstract

Osteoporosis (OP) is a prevailing bone metabolic disease. Morinda officinalis polysaccharide (MOP) has biological activities and medicinal potential. This study explored its mechanism in OP. Rat bone mesenchymal stem cells (rBMSCs) were pretreated with low/high concentrations of MOP and subjected to osteogenic differentiation (OD) or adipogenic differentiation (AD) induction. The protein markers of OD (RUNX2 and BMP2) and AD (CEBPα and PPARγ) and miR‐21 expression were detected. miR‐21 was overexpressed to study its effects on rBMSC OD and AD. rBMSCs were transfected with miR‐21 inhibitor and treated with high concentration of MOP for verification. The targeted relationship between miR‐21 and PTEN was verified by bioinformatics and dual‐luciferase assay. The PTEN/PI3K/AKT pathway‐related proteins were detected. Ovariectomy (OVX)‐induced OP rats were treated with MOP. Rat bone mineral density (BMD), serum bone metabolism indexes bone‐derived alkaline phosphatase (BALP), and osteocalcin (BGP) levels were assessed by BMD detectors and ELISA kits. miR‐21 expression in rBMSCs was detected. After treatment with low/high concentrations of MOP, the OD of rBMSCs was increased and AD was inhibited and miR‐21 was upregulated. miR‐21 overexpression enhanced the OD of rBMSCs and inhibited AD. miR‐21 knockdown reversed the effect of high concentration of MOP on rBMSCs. miR‐21 targeted PTEN. After treatment with low/high concentrations of MOP, PI3K, and AKT phosphorylation were increased and the PI3K/AKT pathway was activated. BMD, BALP, BGP, and miR‐21 levels in OVX rats were decreased. MOP partially alleviated OP in OVX rats. Briefly, MOP enhanced rBMSC OD and inhibited AD via the miR‐21/PTEN/PI3K/AKT axis.

INTRODUCTION

Osteoporosis (OP) is a predominant type of skeletal disease characterized by compromised bone strength that predisposes people to an increased risk of fracture, which has long been an increasing burden on health care all over the world.¹ A variety of risk factors are related to osteoporotic fractures, such as hormonal factors, low peak bone mass, cigarette smoking, the administration of certain drugs, low intake of vitamin D and calcium, lack of physical activity, small body size, and a family or a personal history of fracture.² Bone mesenchymal stem cells (BMSCs) can differentiate into adipocytes and osteoblasts in bone and fat formation.³ Dysfunction of BMSCs is identified as essential in bone deteriorations in OP.⁴ The differentiation of BMSCs to adipocytes rather than osteoblasts leads to the enhancement of adipogenic differentiation (AD) and the decrease of osteogenic differentiation (OD), which is closely related to the occurrence of OP.⁵ Therefore, it is of vital importance to study the regulatory mechanism of therapeutic drugs in OP in terms of the OD and AD of BMSCs, clarify the pathogenesis of OP, and find new gene therapy targets.

Morinda officinalis polysaccharide (MOP), as a member of the rubiaceae family, is widely distributed in the subtropical and tropical regions of China, which has the potential to strengthen muscles and bones and nourish the kidney and liver.⁶ It is noteworthy that MOP has practical value in the prevention and treatment of OP and rheumatoid arthritis.^7,8 But the mechanism of MOP in the OD and AD of BMSCs remains elusive.

microRNAs (miRNAs) a type of short RNAs with 18–25 nucleotides, play principal roles in RNA silencing and encoding gene posttranscriptional regulation by interacting with the 3′ untranslated region of the mRNA transcripts.⁵ Certain miRNAs and specific targets have been recognized to mediate the OD and AD of BMSCs, including miR-149-3p and miR-23a/b.^9–11 miR-21 nanocapsules are reported to promote the early bone repair of osteoporotic fractures by stimulating the OD of BMSCs.¹² Therefore, miR-21 may play a principal role in the OD and AD processes of BMSCs.

The participation of the phosphatidylinositol 3-kinase (PI3K)/AKT pathway in the regulation of the OD and AD processes of BMSCs has been reported.¹³ PTEN is a negative regulator of the PI3K/AKT pathway; inhibiting PTEN expression can activate the PI3K/AKT pathway.¹⁴ Through bioinformatics and literature retrieval, we predicted that there were targeted binding sites between miR-21 and the 3′ noncoding region of PTEN. However, there is no report at present on whether MOP affects the OD and AD of BMSCs via the PTEN/PI3K/AKT axis. This study aims to estimate the effect of MOP on the OD and AD of BMSCs, in an effort to provide new insights into the pathogenesis and treatment of OP.

MATERIALS AND METHODS Cell culture

Sprague–Dawley (SD) rat BMSCs (rBMSCs) were provided by Cell Bank of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured in the Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and 100 × penicillin–streptomycin double antibodies (Xin Fan Biological Technology, Shanghai, China) in an incubator at 37°C with 5% CO₂. The medium was refreshed every other day. When reaching 80% confluence, the adherent cells were detached using 0.25% trypsin and made into suspension for subculture. The cells were subcultured every 2–3 days. After the third subculture, the rBMSC suspension was collected for the following experiment.

Cell treatment and grouping

The rBMSCs in the logarithmic growth phase were seeded in 12-well plates and cultured in the DMEM at 37°C with 5% CO₂. The cells were allocated to the following groups: (a) blank group (rBMSCs cultured in DMEM without other treatment); (b) L-MOP group (rBMSCs treated with low concentration of MOP [10 μg/ml, HPLC >90%, wkq-08910, Weikeqi-biotech, Chengdu, Sichuan, China] for 48 h); (c) H-MOP group (rBMSCs treated with high concentration of MOP [50 μg/ml] for 48 h); (d) miR-NC group (rBMSCs transfected with the control of miR-21 mimics for 48 h); (e) miR-21 group (rBMSCs transfected with miR-21 mimics for 48 h); (f) H-MOP + miR-inhi-NC group (rBMSCs transfected with the control of miR-21 inhibitor and treated with high concentration of MOP [50 μg/ml] for 48 h); and (g) H-MOP + miR-inhi group (rBMSCs transfected with miR-21 inhibitor and treated with high concentration of MOP [50 μg/ml] for 48 h).

MOP was dissolved in double-distilled water. The main components of MOP were polysaccharides combined by monosaccharides Ara, Xyl, Rha, Man, GlaUA, Glc, and Gla through glycosidic bonds, with a molecular weight of 19,494 Da. miR-21 mimics, miR-21 inhibitor, and their corresponding controls (designed and synthesized by Genomeditech, Shanghai, China) were transfected into rBMSCs according to the instructions of the transfection reagent Lipofectamine 2000 (11668027, Invitrogen, Carlsbad, CA).

OD and AD induction

After cell treatment, the cells were seeded in 12-well plates in an incubator at 37°C with 5% CO₂. OD or AD was induced using the OD medium (C-28013, PromoCell, Heidelberg, Germany) or the AD medium (C-28011, PromoCell). The medium was changed every 3 days. The inductions were performed for 14 days.

RT-qPCR

The cells in different groups were collected. The total RNA was extracted using the total RNA kit (80224, QIAGEN, Dusseldorf, Germany) and reverse-transcribed into the complementary DNA (cDNA) using the RNA reverse transcription kit (c-8020, Caiyou Co., Ltd., Shanghai, China). Subsequently, qPCR was carried out using the ABI Prism 7300 system (ABI, Foster City, CA). The reaction procedure was as follows: predenaturation at 95°C for 10 min and 40 cycles of denaturation at 90°C for 15 s, annealing at 63°C for 20 s, and extending at 72°C for 35 s. With U6 as the internal reference, gene relative expressions were calculated using the 2^−ΔΔCT method. The amplification primer sequence (Table 1) of each gene was synthesized by Sangon Biotech (Shanghai, China).

TABLE 1 Primer sequence

Gene	Forward 5′–3′	Reverse 5′–3′
miR-21	TCGCCCGTAGCTTATCAGACT	CAGAGCAGGGTCCGAGGTA
U6	ATTGGAACGATACAGAGAATT	GGAACGCTTCACGAATTTG

Western blotting

The cells in different groups were collected. The total protein of cells was extracted using radioimmunoprecipitation assay lysis buffer (08714-04, Nacalai, Kyoto, Japan). Next, the protein concentration was quantified using the bicinchoninic acid (BCA) kit (701780-480, Cayman, Ann Arbor, MI). Subsequently, the equal protein was isolated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to the polyvinylidene fluoride membranes. Afterwards, the membranes were blocked with 5% skim milk for 1 h, added with rabbit antiprimary antibodies PTEN (1/1000, ab267787, Abcam, Cambridge, MA, USA), total PI3K (t-PI3K, 1/20000, ab191606, Abcam), phosphorylated PI3K (p-PI3K, 1/500, ab182651, Abcam), total AKT (t-AKT, 1/10000, ab179463, Abcam), phosphorylated AKT (p-AKT, 1/1000, ab192623, Abcam), RUNX2 (1/1000, ab236639, Abcam), BMP2 (1/1000, ab214821, Abcam), CEBPα (1/1000, ab40764, Abcam), PPARγ (1/1000, ab272718, Abcam), and GAPDH (1/10000, ab181602, Abcam) and incubated at 4°C overnight. After washing, the membranes were added with horseradish peroxidase-labeled goat anti-rabbit secondary antibody IgG H&L (1/20000, ab97051, Abcam) and incubated at room temperature for 1 h. The Western blots were visualized following the addition of an enhanced chemiluminescence working solution. With GAPDH as the internal reference, the gray value of bands in Western blot images was analyzed using the Image-Pro Plus 6.0 software (Media Cybernetics, Rockville, MD, USA).

Alkaline phosphatase staining and quantitative analysis

On the seventh day of the OD induction, the medium was removed. The cells were washed three times with phosphate-buffered saline (PBS) and fixed with 4% paraformaldehyde for 30 s, followed by the removal of the fixation fluid. Following three times of PBS washes, the cells were added with alkaline phosphatase (ALP) staining solution (QY-ED2820, QiaoYu Bio, Shanghai, China) and incubated at 37°C for 30 min. Later, ALP staining solution was removed and the cells were washed three times with PBS, observed, and imaged using a microscope (CX43, OLYMPUS, Tokyo, Japan). Afterwards, the cells were collected and incubated at 37°C for 15 min, with 10 mM p-nitrophenyl phosphate as the substrate. The optical density value was determined at 420 nm using a microplate reader (25-315S, Lonza, Walkersville, MD).

Alizarin red staining and quantitative analysis

On the 14th day of the OD induction, the medium was removed. The cells were washed three times with PBS and fixed with ethanol at 70% volume fraction for 1 h. Then, the cells were washed three times with ddH₂O, added with alizarin red S solution (G1452, Solarbio, Beijing, China), and stained for 10 min. After washing three times with ddH2O, the cells were observed and imaged using a microscope and the percentage of alizarin red staining density was analyzed using the Image-Pro Plus 6.0 software.

Oil red O staining and quantitative analysis

On the 14th day of the AD induction, the medium was removed. The cells were fixed with 10% formalin for 30 min and then the fixation fluid was removed. Afterwards, the cells were washed twice with 60% isopropyl alcohol, added with oil red O staining solution (RS1820-4, G-CLONE, Beijing, China), stained for 10 min, and washed three times with 60% isopropyl alcohol. After washing with sterile water, the cells were observed and imaged. The percentage of oil red O-positive cells was analyzed using the Image-Pro Plus 6.0 software.

Dual-luciferase reporter gene assay

PTEN wild-type (PTEN-WT) and mutant (PTEN-MUT) pmirGLO reporter gene plasmids (purchased from YaJi Biological, Shanghai, China) were cotransfected with miR-21 mimics or control into HEK 293 T cells in the logarithmic growth phase, respectively. After 48 h of transfection, the relative activities of firefly luciferase and Renilla luciferase were detected.

Animal treatment and grouping

Several 6-month-old ovariectomized (OVX) model rats (modeling for 4 weeks) and sham-treated SD rats, weighing 260 ± 20 g, were purchased from Cavenslasales (Changzhou, Jiangsu, China) and raised in the environment of 12-h light–dark cycles at 24 ± 1°C, with 60% air humidity and freely available food and drinking water. After 1 week of adaptive feeding, six rats were assigned to the sham group and 12 OVX rats were equally assigned to the OVX group and OVX + MOP group. In the OVX + MOP group, OVX model rats were treated with MOP (400 mg/kg) by gavage once a day for 4 weeks. The MOP concentration was slightly adjusted according to the reference¹⁵). The rats in other groups were fed normally.

Animal sampling and rBMSC isolation

After 4 weeks of treatment, the rats were euthanized by intraperitoneal injection of 3% pentobarbital sodium (400 mg/kg). The abdominal cavity was opened, the abdominal aorta blood was collected and centrifuged at 3000 r/min for 10 min, and the serum was collected and stored into the cryopreservation tube at −80°C. The left femur and tibia of rats were collected. Under aseptic conditions, the attached muscles and soft tissues were removed, and the bone tissues at both ends were cut to expose the bone marrow cavity. The bone marrow fluid was washed out by slowly injecting the DMEM containing 10% FBS and 100 U/ml penicillin–streptomycin with a syringe. The same number of rBMSCs was collected from each group and the expression of miR-21 was detected by RT-qPCR.

Bone mineral density detection

The lumbar vertebrae of rats were collected and the attached muscles and soft tissues were removed. After washing with normal saline, the bone mineral density (BMD) of rats was measured by DPX-L dual-energy x-ray absorptiometry (Lunar). The BMD value was expressed as bone mineral content per unit area (g/cm²).

Serum bone alkaline phosphatase and osteocalcin detection

The levels of serum bone alkaline phosphatase (BALP, CSB-E11188r, CUSABIO, Wuhan, Hubei, China) and osteocalcin (BGP, CSB-E05129r, CUSABIO) were detected using ELISA kits in strict accordance with the instructions.

Statistical analysis

SPSS 22.0 statistical software (IBM Corp., Armonk, NY) was used for data analyses. The data were described as mean ± standard deviation. One-way analysis of variance (ANOVA) was utilized for comparisons among multigroups. Tukey's test was used for the post hoc test. p value was obtained by a bilateral test. p < 0.05 was indicative of statistical significance.

RESULTS MOP treatment increased OD ability and decreased AD ability of rBMSCs

Existing evidence suggests that MOP is capable of alleviating OP.^7,15 However, its specific mechanism is not fully clarified. The pathogenesis of OP is closely related to the imbalance of OD and AD of BMSCs.^4,16 To explore whether the anti-OP effect of MOP is related to the OD and AD of BMSCs, the rBMSCs were pretreated with MOP at high/low concentrations (10 and 50 μg/ml) and subjected to OD and AD induction. The OD level and the mineralized nodule degree of rBMSCs were detected by ALP and alizarin red staining, the AD level of rBMSCs was detected by oil red O staining, and the levels of OD markers (RUNX2 and BMP2) and AD markers (CEBPα and PPARγ) were further detected by Western blotting (WB). After OD induction of rBMSCs, the positive expression of ALP staining was significantly increased (Figure 1A), mineralized nodules were increased (Figure 1B), and the levels of OD markers RUNX2 and BMP2 were elevated (Figure 1C), while the OD ability of rBMSCs pretreated with high/low concentrations of MOP was increased, with the high concentration of MOP showing a stronger promoting effect (Figure 1A–C, all p < 0.05). After AD induction of rBMSCs, red oil O staining positive cells were significantly increased (Figure 1D), and the levels of AD markers CEBPα and PPARγ were increased (Figure 1E), while the AD ability of rBMSCs pretreated with high/low concentration of MOP was notably decreased, with the high concentration of MOP showing a stronger inhibitory effect (Figure 1D and E, all p < 0.05). These results suggested that MOP increased OD ability and decreased AD ability of rBMSCs.

MOP treatment upregulated miR-21 expression in rBMSCs

Prior studies have shown downregulated expression of miR-21 in bone tissue and serum of patients with OP.¹⁷ miR-21 may be closely involved in the regulation of OD and AD of BMSCs.¹² To study whether MOP affected the expression of miR-21, the expression changes of miR-21 in rBMSCs pretreated with low/high concentrations of MOP were detected. MOP with low/high concentrations both increased the expression of miR-21, with the high concentration of MOP showing a stronger effect. After OD or AD induction, the expression of miR-21 was increased in OD and decreased in AD. High concentration MOP treatment promoted the promotive effect of OD on miR-21 and inhibited the effect of AD on decreasing miR-21 (Figure 2, all p < 0.001). These results elicited that MOP treatment increased the expression of miR-21 in rBMSCs.

Overexpression of miR-21 enhanced OD ability and decreased AD ability of rBMSCs

To further elucidate the effects of miR-21 in OD and AD processes, miR-21 expression was elevated in rBMSCs by transfection with miR-21 mimics. RT-qPCR demonstrated that the miR-21 was successfully overexpressed (Figure 3A, p < 0.001). The level of miR-21 after differentiation was detected. Overexpression of miR-21 further increased the level of miR-21 in rBMSCs after OD or AD, indicating that overexpression of miR-21 had a sustained effect during the differentiation of rBMSCs (Figure 3B, all p < 0.001). The OD ability or AD ability was detected and the results showed that overexpression of miR-21 increased the ALP level, mineralized nodules, and OD markers RUNX2 and BMP2 in rBMSCs after OD induction (Figure 3C–E, all p < 0.01), and decreased adipocyte positive level and AD markers CEBPα and PPARγ in rBMSCs after AD induction (Figure 3F and G, all p < 0.01). Overall, overexpression of miR-21 promoted the OD and inhibited the AD of rBMSCs.

Knockdown of miR-21 partially reversed the effects of MOP on the OD and AD of rBMSCs

To further verify whether MOP affected the OD and AD of rBMSCs by regulating miR-21, the expression of miR-21 was downregulated in rBMSCs by transfection with miR-21 inhibitor. RT-qPCR demonstrated that the transfection was successful (Figure 4A, p < 0.001). The rBMSCs were treated with a high concentration of MOP and subjected to OD or AD induction. The level of miR-21 after differentiation was assessed. miR-21 inhibitor diminished the level of miR-21 in rBMSCs after OD or AD, suggesting that miR-21 inhibitor played a sustained role in the differentiation of rBMSCs (Figure 4B, all p < 0.001). The changes of OD ability and AD ability were detected and the results showed that knockdown of miR-21 partially reversed the effects of high concentration of MOP on promoting ALP level, mineralized nodule level, and OD markers RUNX2 and BMP2 levels in rBMSCs after OD induction (Figure 4C–E, all p < 0.01), and partially reversed the effects of high concentration of MOP on inhibiting lipogenesis and AD markers CEBPα and PPARγ levels in rBMSCs after AD induction (Figure 4F,G, all p < 0.01). These results suggested that the knockdown of miR-21 annulled the effects of MOP on the OD and AD of rBMSCs. The results above suggested that MOP upregulated miR-21 and promoted OD and inhibited AD of rBMSCs.

MOP activated the PI3K/AKT pathway by miR-21 targeting PTEN

The PI3K/AKT pathway is principal in regulating the OD and AD of BMSCs.¹³ PTEN can negatively regulate the PI3K/AKT pathway.¹⁴ The potential targeted binding sites between PTEN and miR-21 were predicted by bioinformatics (Figure 5A), and their targeted binding relationship was verified by dual-luciferase assay (Figure 5B, p < 0.001). Then, the expression levels of PTEN and the PI3K/AKT pathway in rBMSCs treated with miR-21 mimics were detected by WB. After miR-21 overexpression, the expression of PTEN was repressed, while the phosphorylation levels of PI3K and AKT were increased, which suggested that miR-21 activated the PI3K/AKT pathway by inhibiting PTEN. Moreover, the levels of PTEN and PI3K/AKT pathway-related protein after low/high concentration of MOP treatment were detected. After low/high concentration of MOP treatment, PTEN expression was suppressed, while the phosphorylation levels of PI3K and AKT were increased, with the high concentration of MOP showing a stronger effect (Figure 5C, all p < 0.05). Briefly, MOP upregulated miR-21 expression and promoted the OD and inhibited AD of rBMSCs via the miR-21/PTEN/PI3K/AKT axis.

MOP improved OP in OVX rats and increased the expression of miR-21

To further verify the potential therapeutic effect of MOP on OP, the OVX-induced OP rat model was treated with MOP. The serum indexes BALP and BGP of lumbar BMD and bone metabolism were detected. Compared with the sham group, the BMD of the OVX group was decreased (Figure 6A, all p < 0.01), and the levels of serum BALP and BGP were decreased (Figure 6B,C, all p < 0.01), indicating that OVX group rats were OP rats. Compared with the OVX group, BMD level was increased, and BALP and BGP levels were also increased in the OVX + MOP group, indicating that MOP improved OP of OVX rats to a certain extent. In addition, the expression of miR-21 was decreased in BMSCs of OVX rats and partially recovered after treatment with MOP (Figure 6D, all p < 0.001). This suggested that the mechanism of MOP in the treatment of OP in animal experiments might also be related to miR-21, which further validated our conclusions in cell experiments.

DISCUSSION

OP is a silent threat to bone health, which leads to substantial mortality and morbidity, affects life quality, and imposes major socioeconomic burdens on societies and families.⁷ Existing evidence has highlighted the essential role of MOP in the OD and AD of BMSCs in OP.⁷ The present study illustrated that MOP regulated the OD and AD of rBMSCs in OP by upregulating miR-21 and activating the PI3K/AKT pathway.

Through much-valuable literature review, we learned that MOP has a protective effect against OP.¹⁸ During the process of aging, BMSCs are manifested with decreased OD and increased AD capacity, which is closely associated with the pathogenesis of OP.¹⁶ Our results demonstrated that after OD induction, ALP staining positive expression was increased, mineralized nodules were enhanced, and OD markers RUNX2 and BMP2 were increased, while the OD ability was increased after pretreatment with high/low concentrations of MOP, with the high concentration of MOP showing a stronger promoting effect; after AD induction, red oil O staining positive cells were increased and AD markers CEBPα and PPARγ were increased, while the AD ability of rBMSCs was decreased after pretreatment with high/low concentrations of MOP, with the high concentration of MOP showing a stronger inhibitory effect. Much in accordance with our discoveries, prior studies have shown that MOP is an inducer of bone formation.¹⁵ MOP has the effect of promoting OD in OP.⁷ In conclusion, MOP increased OD ability and decreased AD ability of rBMSCs. In addition, we pretreated hBMSCs with MOP and found that MOP also improved the OD ability of hBMSCs (Figure S1). It further showed that MOP had the ability to promote OD, which provided a certain reference value for MOP in the treatment of OP.

miR-21-5p is critical in reducing osteoclastogenesis in OP.¹⁹ miR-21 is closely associated with the OD and AD process of BMSCs.¹² Our results showed that the treatment of low/high MOP concentration increased miR-21 expression, with the high concentration of MOP showing a stronger effect. Consistently, the downregulated miR-21expression has been documented in OP.¹⁷ However, there is little study on the role of MOP in regulating miR-21 expression in BMACs in OP. Our study showed that MOP treatment elevated miR-21 expression in rBMSCs for the first time. Similarly, in hMBSCs, MOP increased the expression of miR-21 (Figure S1). To further study the role of miR-21 in the OD and AD processes of rBMSCs, we elevated miR-21 expression. Our results elicited that the overexpression of miR-21 increased ALP levels, mineralized nodules, and OD markers RUNX2 and BMP2 in rBMSCs after OD induction, and decreased adipose positive levels and AD markers CEBPα and PPARγ in rBMSCs after AD induction. Consistently, the overexpression of miR-21 improves OP.²⁰ miR-21 can promote mineralization and osseointegration through enhancing osteogenic and osteoclastic expression.²¹ In summary, the above evidence and findings suggested that miR-21 overexpression promoted the OD and inhibited AD of rBMSCs.

To further identify whether MOP affected the OD and AD of rBMSCs through miR-21, we knocked down miR-21 expression in rBMSCs and found that miR-21 knockdown partly averted the effect of high concentration of MOP on promoting ALP, mineralized nodules, and OD markers RUNX2 and BMP2 in rBMSCs after OD induction, and partially reversed the effects of high concentration of MOP on inhibiting lipogenesis and AD markers CEBPα and PPARγ in rBMSCs after AD induction, indicating that miR-21 knockdown reversed the effects of MOP on the OD and AD of rBMSCs. Much in accordance with our findings, in osteoblasts, miR-21 regulates the level of factors that are important for preosteoclast survival, and miR-21 knockdown in MC3T3 cells limits the differentiation and leads to a decreased viability of preosteoclasts.²² Reduced expression of miR-21 inhibited the OD of human BMSCs.²³ Collectively, MOP upregulated miR-21, promoted the OD and inhibited the AD of rBMSCs.

The PI3K/AKT pathway is involved in manipulating the OD of periosteal cells in fracture repair.²⁴ PTEN is involved in regulating skeletal development and bone mass density in mice and regulates the osteogenic potential of BMP9 in MSCs.²⁵ Our results demonstrated that low/high concentrations of MOP increased phosphorylation levels of PI3K and AKT, with the high concentration of MOP showing a stronger effect. After miR-21 overexpression, the expression of PTEN was repressed, while the phosphorylation levels of PI3K and AKT were increased. Consistently, macrophage MSR1 promotes the OD of BMSCs by activating the PI3K/AKT pathway.²⁶ Polysaccharide promotes the OD and proliferation of BMSCs by activating the PI3K/AKT pathway.²⁷ In conclusion, MOP was involved in the regulation of OD and AD of rBMSCs by activating the PI3K/AKT pathway. In addition, we conducted a supplementary experiment using MOP to treat OVX-induced OP rats and found that MOP could increase the expression of miR-21 in rBMSCs of OVX rats and improve OP in rats.

In summary, this study supported that MOP regulated the OD and AD of rBMSCs in OP by upregulating miR-21 and activating the PI3K/AKT pathway, which provided a theoretical basis for clarifying the pathogenesis of OP and developing new therapeutic drugs and new targets. However, the relationship between miR-21 and the PI3K/AKT pathway and the specific mechanism involved in the OD and AD of BMSCs remains unclear, which needs to be further studied. In addition, due to the limited research conditions, we did not verify the effects of MOP on regulating the OD and AD of BMSCs by regulating miR-21 and the PI3K/AKT pathway through the animal experiments and clinical treatment data. Further work is warranted to study a variety of physiologically active substances of traditional Chinese medicine for OP treatment and explore their mechanisms and targets at the molecular level based on clinical treatment data and animal experiments.

CONFLICT OF INTEREST

All authors declare no conflict of interest.