Insecticide Resistance and Mechanisms of Culex pipiens Populations in the Mediterranean and Aegean Regions of Turkey During 2017-2018

Abstract

Keywords: Kdr; Acetylcholinesterase; Monooxygenase; Glutathione S-Transferase Introduction Mosquitoes can transmit many different pathogenic organisms such as viruses, bacteria, protozoa and nematodes and impact over half of the worlds' population through the transmission of harmful diseases to both human and animal. According to the European Centre for Disease Prevention and Control (ECDC) report, 1605 WNV infection and 166 deaths due to WNV infection was reported from 11 EU/EU member states in 2018 (6). [...]as it was stated before, rapidly developing insecticide resistance in mosquito populations is the biggest obstacle in vector management and control. [...]it's so crucial to understand the status and mechanisms of insecticide resistance for overcoming or delaying resistance to existing compounds and preventing the development of resistance to new pesticides (9). Turkey is a country with high agricultural activities. Because of the fact that wide ranges of insecticides are still used for different kinds of pest control in Turkey (14).

Headnote

(Received 17 June 2020; accepted 30 Dec 2021)

Abstract

Background: Culex pipiens has a significant public health importance since it is an important vector of West Nile virus and Rift Valley fever virus. We, therefore, aimed to determine the insecticide resistance level in Cx. pipiens populations in the Aegean and Mediterranean regions of Turkey.

Methods: Bioassay s have been carried out against Dichlorodiphenyltrichloroethane (DDT) (4%), Malathion (5%), Fenitrothion (1%), Propoxur (0.1%), Bendiocarb (0.1%), Permethrin (0.75%) and Deltamethrin (0.05%). Biochemical analyses have been performed to detect non-specific esterase, mixed function oxidase, glutathione-s-transferase and acetylcholinesterase levels. A knockdown resistance (kdr) (L1014F) and Acetylcholinesterase (Ace-1) (G119S) mutations have been detected by using allele-specific primers and a polymerase chain reaction (PCR) amplification of specific alleles (PASA) diagnostic test was performed for detection of F290V mutation.

Results: Bioassay results showed that all Cx. pipiens populations were resistant to DDT, Malathion, Fenitrothion, Bendiocarb, Propoxur and some of the populations have started to gain Permethrin and Deltamethrin resistance. Biochemical analyses results revealed that altered glu-tathione-s-transferases, P450 monooxygenases, esterase levels might be responsible for DDT, or-ganophosphate, carbamate and pyrethroid resistance in Cx. pipiens populations. Results showed mild to high frequency of L1014F, low frequency of F290Vbut no Ace-1 G119S mutation within the populations. Additionally, acetylcholinesterase insensitivity was not significantly high within the most of these populations.

Conclusion: Overall results may help to fulfil the lacking information in the literature regarding insecticide resistance status and underlying mechanism of'Culex pipiens populations of the Mediterranean and Aegean region of Turkey by using all bioassays, molecular tests and biochemical assays.

Keywords: Kdr; Acetylcholinesterase; Monooxygenase; Glutathione S-Transferase

Introduction

Mosquitoes can transmit many different pathogenic organisms such as viruses, bacteria, protozoa and nematodes and impact over half of the worlds' population through the transmission of harmful diseases to both human and animal. They are also responsible for transmitting malaria, lymphatic filariasis and arboviruses such as yellow fever virus, dengue virus and Zika virus (1). Millions of people are threatened and killed by mosquito-borne diseases every year (2).

Mosquito control strategies have played a major role in reducing the global burden of mosquito-borne diseases since the introduction of dichlorodiphenyltrichloroe-thane (DDT) in the 1940s (3). Malaria control has been achieved during recent years as a result of insecticide-based strategies including indoor residual spraying (IRS), insecticide-treated nets (ITNs) and long-lasting insecticide-treated nets (LLITNs) (4). Current control of mosquitoes is still heavily dependent upon the use of chemical insecticides and four classes of synthetic insecticides called organochlorines (OC), organophosphates (OP), carbamates (CB), pyrethroids (PY) are recommended by World Health Organisation (WHO) for IRS (3). However, pyrethroids are recommended for use in ITNs and LLITNs (3). Despite their environmental pollution concerns and toxicity to non-target organisms and humans, insecticides are still heavily used in current mosquito control strategies. However, this is not sustainable because extensive use of insecticides has also resulted in the development of resistance in mosquito populations around the world.

Culex pipiens is amongst the most important mosquito species and responsible of maintaining several viruses such as West Nile virus (WNV), Rift Valley fever virus (RVFV) and Japanese encephalitis virus (JEV) which can be pathogen of human and livestock animals (5). According to the European Centre for Disease Prevention and Control (ECDC) report, 1605 WNV infection and 166 deaths due to WNV infection was reported from 11 EU/EU member states in 2018 (6). There have been no reported WNV cases until 2009 in Turkey. However, both epidemic and WNV-related central nervous system diseases have been reported in the western part of Anatolia since 2009 (7). A total of 47 and 5 WNV were reported from different regions of Turkey in 2010 and 2011, respectively (8). Recently, one human case of WNV has been reported in 2019 (6).

While many integrative techniques can be used for Cx. pipiens control, the fastest and cheapest way to control vector densities in endemic regions, control epidemics and reduce annoying mosquito populations is to apply insecticides. However, as it was stated before, rapidly developing insecticide resistance in mosquito populations is the biggest obstacle in vector management and control. Therefore, it's so crucial to understand the status and mechanisms of insecticide resistance for overcoming or delaying resistance to existing compounds and preventing the development of resistance to new pesticides (9).

To date, a few studies have been reported regarding the insecticide resistance status of Turkish Cx. pipiens populations. Akiner et al. (10) reported high DDT resistance in Cx. pipiens populations in Antalya, Ankara, Cankin, Mersin, Hatay, Birecik and Viran§ehir. They also reported high Fenitrothion resistance in Birecik, Mersin, Cankin and Antalya; high Temephos resistance in Birecik, Viran§ehir, Mersin, Ankara and Antalya. Similarly, high DDT, Malathion, Permethrin and Deltamethrin resistance have been reported in Cx. pipiens populations ofMediterranean region (Mersin, Adana and Antalya). High mixed function oxidase (MFO) and non-specific esterase (NSE) activities have been attributed to high DDT, Malathion and pyrethroid resistance in these populations (11). Tasjan et al. (12) reported high Malathion, Bendiocarb and Dieldrin resistance of Cx.pipiens populations collected from the Aegean region. Kdr mutation (L1014F and L1014C) frequencies were also high in these populations. However, Ace-1 (G119S and F290V) and Rdl (A302S) mutation frequencies were too low to explain Malathion and Dieldrin resistance. Finally, Guz et al. (13) reported high frequencies of Diflubenzuron resistance in Mugla for the first time. The Chitin synthase 1 gene mutations (I1043L and I1043M) were ranging from 15.7% to 52.7% and the kdr L1014F mutation was ranging from 40% to 50%.

Turkey is a country with high agricultural activities. Because of the fact that wide ranges of insecticides are still used for different kinds of pest control in Turkey (14). Although many insecticides have been used for many years, studies to regularly monitor resistance development in mosquito populations are not sufficient. Additionally, this study aims to evaluate both the molecular and biochemical mechanisms underlying the current insecticide resistance at the same time in Cx. pipiens populations of the Mediterranean and Aegean region during 2017 and 2018.

Materials and Methods

Mosquito strains

Larva and adult Cx. pipiens samples were collected from a total of 10 locations in both the Mediterranean and the Aegean regions of Turkey between April 2017 and September 2018 (Fig. 1, Table 1). Larval samples were collected using larval dippers and transferred to the transport container until it was brought to the laboratory.

Gravid females were collected from stables and houses by using mouth aspirators and brought to the laboratory in a cardboard cup sealed with a thin cloth. Following the egg laying of gravid females, F: generations were obtained. Larval samples were reared to adults under the standard laboratory conditions at 26-28 °C, 12:12 h photoperiod and 70-80% relative humidity in an insectarium. Morphological identifications were performed using an identification key (15). An unfed 3-5 days old F: generation females were preferred to use in bioassays, biochemical assays and molecular study. Samples were stored in a -80 °C freezer until biochemical assays have been carried out. We have sensitive Culex quinquefasciatus laboratory strain which had not been exposed to insecticides for more than 15 years and raised in Ay din Adnan Menderes university vector biology laboratory. These sensitive Cx. quinquefasciatus lab strain was used as a reference strain for comparison in biochemical analyses.

Bioassays

Bioassays have been carried out through WHO's insecticide susceptibility bioassay tubes (16). Susceptibility tests was performed against DDT (4%), Malathion (5%), Fenitrothion (1%), Propoxur (0.1%), Bendiocarb (0.1%), Permethrin (0.75%) and Deltamethrin (0.05%) using WHO papers supplied by the WHOPES collaborating Centre at University Sains Malaysia. Bioassays were performed in the insectarium, under the same physical conditions in which mosquitoes were raised. A total of 660 adult females were used with controls of each of seven types of insecticides, 60 individuals from each population. For each test, we used 20 adult mosquitoes in assay tubes in triplicate. Mosquitoes were transferred into the holding tubes after one-hour exposure to each insecticide-impregnated paper and fed on 10%) sugar solution for 24 h. Control group were exposed to insecticide free, impregnated only with the excipient without any active ingredient control papers for one hour. Mean values of three replicates were used to calculate mortality rates. Resistance levels were calculated as susceptible if mortality rates are > 98%>, possible resistance if mortality rates are between 90-97%> and resistant if mortality rates are lower than 90% (17).

Biochemical assay

A total of 330 (30 samples from each population in addition to the control group) individuals were used for biochemical analyses. An unfed 3-5 days old Cx. pipiens Flfemales were used to perform enzyme assays.

Homogenization was first carried out using liquid nitrogen and then followed by 250 uL 50 mM sodium phosphate buffer onto the ice to keep the samples from heat denaturation. Homogenates were centrifuged at 10.000 g for lOmin. at 4 °C. Spectrophotometric analyses were carried out in 96 well microtiter plates using Biotek Elx808 microplate reader (Biotek Instruments, USA). Protein content was measured using a Bradford assay which includes Bradford dye reagent prepared with Coomassie brilliant blue, and the absorbance was measured at 595 nm (18). Total protein content was measured using a standard curve of bovine serum albumin (BSA).

All biochemical analyses including NSE, MFO, glutathione-s-transferase (GST) and Acetylcholinesterase (AchE) assay were carried out by following the test procedure provided by WHO (16). All tests were conducted as two replicates. Alpha-naphthyl acetate, beta-naphthyl acetate and p-nitrophenyl acetate (pNPA) were used as substrates of esterase enzyme for the calculation of non-specific esterase activity. Standard curves of alpha- napthol, beta-naphtol and 4-nitrophenol were created and enzyme activity was calculated as enzyme units (EU, umol/min) using these standard curves of alpha, beta and p-naphthol acetate. Specific enzyme activities were calculated based on enzyme units and stated as EU/ mg protein for each esterase. MFO level was calculated using heme-peroxidase assay based on heme-protein amount (16, 19). Heme protein content was calculated using a standard curve of cytochrome C protein to calculate MFO levels. Similarly, WHO (16) were followed for the calculation of GST levels. The extinction coefficient (s): 4.39 mMr1 was used to calculate specific GST enzyme activities as described by WHO (16). Finally, AchE and insensitive AchE levels were measured by following the instructions described by WHO (16). For this assay, the inhibition rate was calculated based on well optic density (OD) and the remaining AchE rates were calculated by dividing the OD of the well with Propoxur by that without Propoxur for the same mosquito, i.e. rate or end point with Propoxur * 100= % remaining activity in Propoxur inhibited replicate rate or end point without Propoxur.

Molecular assays

A total of 95 and 100 DNA was extracted from the Mediterranean and Aegean region, respectively by using Invitrogen PureLink genomic DNA isolation kit. Totally 195 individuals were tested for the presence of kdr (L1014F), Ace-1 G119S and Ace-1 F290V mutations from the study area.

A voltage gated sodium channel (Vgsc 1) generegionwasamplifiedusingprimersCgdl: GTGGAACTTCACCGAACTT C, Cgd2: GCAAGGCTAAGAAAAGGTTAAG, Cgd3 :CCACCGTAGTGATAGGAAATTTA and Cgd4: CCACCGTAGTGATAGGAA-ATTTT (20). A polymerase chain reaction (PCR) were performed in a final volume of 25 uL containing 1 uL 2.5 mM dNTP, 2.5 uL 10 reaction buffer, 0.3 uL 20 mM each of the primers, 0.3 uL (5 U/mL) Taq DNA polymerase, 1 uL template DNA and 19.3 uL dH20. The amplification program consisted of an initial denaturation at 94 °C for 15min, 40 cycles of denaturation at 94 °C for lmin, annealing 50 °C for 1 min, extension 72 °C for 2min and followed by 72 °C for 10 min. Subsequently, amplified fragments were loaded on 1% agarose gel and visualized under UV light.

A 194 base paired Ace-1 gene amplicon was amplified using primer pairs ACE1-F1: 5'-CCGGGGGCCACCATGTGGAA-3' and ACE1-R2:5'GTTCTCCTCCGAGGCCAG-CGTCCG-3' (21). The PCR was performed in a final volume of 25 uL containing about 50 ng DNA, 1.5 U Taq DNA polymerase, 20 uM each of primers, 2.5 mM dNTP, and 10X reaction buffer. PCR reaction conditions were denaturation at 94 °C for 5 min, 30 cycles of denaturation at 94 °C for 30 s, annealing at 54 °C for 30 sn, extension at 72 °C for 1 min, and the final extension step of 72 °C for 5 min. Since the G119S mutation creates restriction sites, we used Alul enzyme which generates a 120 bp and 74 bp fragment to create fragments and visualize the fragment lengths on agarose gel as a result of the restriction fragment length polymorphism analysis (RFLP). The restriction fragment length polymorphism analysis content consisted of 2 uL lOXbuffer, 1 uLAlu-1 enzyme (2U), 2uLBSA(0,l mg/ ml), 15 uL PCR product and 5 uL dH20. This mixture was left in incubation for 4 hours at 37 °C and then the reaction was stopped at 65 °C for 20 minutes. PCR products then were visualized under UV light on 2% agarose gel. A PCR amplification of specific alleles (PASA) diagnostic test was performed for detection of F290V mutation as previously described by Ta§kin et al. (12). A 543 bp control band, a 148 bp phenylalanine band and a 435 bp valine band were obtained after a PCR reaction. Amplified fragments were then visualized on 1.5% agarose gel electrophoresis under UV Light.

Statistical analyses

Median enzymatic activities were calculated for Cx. pipiens mosquito populations and compared with sensitive Cx.quinquefasciatus laboratory strain by way of Kruskal-Wallis test using Statistica version 12.

Results

Bioassay

All of the Mediterranean populations were resistant to DDT, Malathion, Fenitrothion, Bendiocarb and Propoxur. Mortality rates ranged between 71.6-85%; 71.6-81.6%; 70-81.6%; 71.6-83%; 78.3-83%; 91.6-98.3% and 91.6-100% for DDT, Malathion, Fenitrothion, Bendiocarb, Propoxur,

Permethrin and Deltamethrin, respectively. The only Permethrin and Deltamethrin susceptible population was Golhisar. All of the populations were possible resistant to Deltamethrin and Permethrin except the Golhisar population. Mortality rates are given in Fig. 2.

All of the Aegean region populations were resistant against DDT, Malathion, Fenitrothion, Bendiocarb and Propoxur. Mortality rates ranged between 7.6-81.6%; 75-81.6%; 76.6-81.6%; 80-88.3%; 80-83.3%; 96.6-98.3% and 95-98.3% for

DDT, Malathion, Fenitrothion, Bendiocarb, Propoxur, Permethrin and Deltame-thrin, respectively. All the Hacihaliller, Honaz and Dalaman populations were possible resistant to Permethrin and Deltamethrin, whereas the Dinar and the Soke populations were still susceptible to Permethrin and Deltamethrin. Mortality rates are given in Fig. 3.

Biochemical analysis results

The median specific alpha, beta and pNPA esterase activities were calculated as 0.242 EU/mg protein, 0.328 EU/ mg protein and 0.265 EU/mg protein in susceptible reference strain, respectively. Median specific enzyme activities for alpha esterase, beta esterase and pNPA ranged between 0.325 EU/mg protein and 1.041 EU/mg protein; 0.508 EU/ mg protein and 0.915 EU/mg; 0.754 EU/ mg protein and 1.526 EU/mg protein in the Mediterranean region populations of Cx. pipiens, respectively. Median specific alpha esterase, beta esterase and pNPA activities were significantly increased in all of the Mediterranean populations in relation to reference strain (p < 0.05) except the Manavgat population in which median alpha and beta esterase activities were not altered significantly and the Golhisar population in which alpha esterase and PNPA activities were not significantly increased comparing to reference strain (p > 0.05).

Median specific enzyme activities for alpha esterase, beta esterase and pNPA ranged between 0.599 EU/mg protein and

1.590 EU/mg protein; 0.630 EU/mg protein and 1.384 EU/mg; 0.942 EU/mg protein and 1.649 EU/mg protein in the Aegean region populations of Cx. pipiens, respectively. All of the populations had significantly higher median alpha, beta and pNPA activities in relation to the reference strain (p < 0.05). Median alpha and beta esterase and pNPA activities of the populations are given in Fig. 4, Fig. 5 and Fig. 6, respectively.

The median specific MFO activity was calculated as 2.605 ug cytochrome-c/mg protein in susceptible reference strain. Median MFO activities ranged from 5.310 and 11.373 ug cytochrome-c/mg protein and 9.643 and 21.059 ug cytochrome-c/ mg protein in the Mediterranean and Aegean populations, respectively. All tested populations displayed increased MFO levels (p < 0.05) except the Golhisar population which did not have significantly increased MFO levels in accordance to reference strain (p> 0.05) (Fig. 7).

The median specific GST activity was calculated as 0.138 EU/mg protein in susceptible reference strain. Median specific GST activities changed between 0.217 EU/ mg protein and 0.743 EU/mg protein in the Mediterranean and between 0.261 EU/ mg protein and 0.795 EU/mg protein in the Aegean region Cx. pipiens populations.

All of the Mediterranean and the Aegean populations had significantly higher median specific GST activities (p < 0.05) except the Tarsus, Manavgat and Golhisar populations in the Mediterranean and the Honaz population in the Aegean region (p > 0.05) (Fig. 8).

The median specific remaining AChE rate was calculated as 7.2% in susceptible reference strain. Median remaining AChE rates ranged between 36.9% and 17.4% in the Mediterranean region while they were ranged between 30.5% and 21.3% in the Aegean region. The Tarsus and Karatas. populations had insensitive AChE rates which are higher than 30% (p < 0.05) while the others did not have significantly altered AChE levels in the Mediterranean region (p > 0.05). Median remaining AChE rates changed between 21.3% and 30.5% in the Aegean region. The only populations were the Dalaman and Soke which had insensitive AChE rates expressed as higher than 30% critical level (p < 0.05). All of the remaining Aegean populations had sensitive AChE rates (p > 0.05). (Fig. 9).

Median levels of detoxifying enzyme activities and p values against control were given in Table 2.

Molecular test results

Both 1014L (TTA) and 1014F (TTT) alleles were detected in the Mediterranean and Aegean populations of Cx. pipiens. The highest L1014F allele frequency was calculated in the Golhisar population as 0.8, however, the population did not show a statistically significant deviation from HW balance (p > 0.05). The L1014F allele frequencies were 0.56, 0.55, 0.62, 0.45 in the Dortyol, Karata§, Manavgat and Tarsus populations, respectively. All of the populations were in HW balance (p > 0.05) except the Manavgat and Tarsus populations which had lower heterozygosity rate (p < 0.05).

The highest L1014F allele frequency was calculated as 1.00 in the Honaz population in which L1014F allele was fixed. The L1014F allele frequency was 0.90 in the

Soke, Hacihaliller and Dinar and 0.85 in the Dalaman populations. All of the Aegean populations were in HW balance (p > 0.05). The kdr genotype, allele frequencies and Fisher's exact test results of Cx. pipiens populations along the Mediterranean and Aegean region are given in Table 3.

No Ace-1 mutation was found in either in the Mediterranean or in the Aegean Cx. pipiens populations based on RFLP analyses by using Alu-I restriction endonuclease. Sequence analysis results confirmed RFLP results and did not detect any G119S allele in the study area.

F290V mutation frequency was changed between 0-0.075% within the Cx. pipiens populations collected from both the Mediterranean and Aegean region.

Genotypes and allele frequencies of F290V mutations are given in Table 4.

Discussion

TheMediterraneanandAegeanregionsare located in the west and south part of Turkey and both have favourable climate conditions for mosquito survival. The availability of vast and fertile soils within this geographic area leads high agricultural activities therein. In addition to that, intensive human activity, tourism and industrialization induce wide spread of mosquito species and accordingly mosquito-borne diseases. Since chemical insecticide-based control management is the primary method for mosquito control efforts in Turkey, understanding the insecticide resistance levels of the mosquito populations and underlying mechanisms are crucial for the deployment of appropriate insecticides. In this study, insecticide resistance levels of Cx. pipiens populations from the Aegean and Mediterranean region against various insecticides were investigated.

Results indicated that all of the populations were resistant to DDT even though DDT use was banned in the 1980s in Turkey. DDT resistance has been recorded in many mosquito populations both in Turkey and the world since it was used extensively in the fight against malaria until the 1960s (22-25). Several researchers have previously reported that GSTs that are involved in xenobiotic detoxification, some MFOs that are capable of metabolizing DDT (for example cyp6zl) and a kdr mutation causing receptor structure change in voltage-gated ion channels are all responsible for DDT resistance (26-27). All of the Mediterranean and Aegean Cx. pipiens populations showed significantly high GST activity profile except the Antalya and Golhisar populations, indicating that DDT resistance is still maintained through increased GST activities in most of the populations. However, the Manavgat and Golhisar populations support the hypothesis that more than one mechanism might play a role rather than the fact that GST alone is responsible for DDT resistance. Increased MFO levels and L1014F allele frequency in the Manavgat population indicates that DDT resistance might be maintained through high MFO levels and kdr mutation even if the GST level is not increased. Similarly, increased mortality rate against DDT, Permethrin and Deltamethrin after treatment with piperonyl butoxide (PBO) in Cx. pipiens populations of Mersin demonstrates that MFO is responsible for both DDT and pyrethroid resistance of the Mersin populations (11). Interestingly, high DDT resistance seems to be sustained via L1014F mutation alone in the Golhisar population in which MFO and GST levels are not significantly increased.

Another interesting conclusion about the Golhisar population is that both kdr mutation and decreased MFO levels, which are thought to be responsible for pyrethroid resistance in addition to DDT resistance, which is still sensitive to Permethrin and Deltamethrin. In addition to the Golhisar population, when we consider the Dinar and Soke populations that are sensitive to pyrethroids and have high kdr frequencies because of the DDT resistance, the question of what is the usability of pyrethroids for control purposes comes to mind.

Allele specific primers indicated that mechanism causing kdr resistance of Cx. /'/pz'em'populationsinboth the Mediterranean and Aegean regions is the increase of L1014F mutation frequencies. However, Ta§kin et al. (12) reported that the kdr resistance responsible for DDT and pyrethroid resistance is maintained by both L1014F and L1014C mutations in Cx. pipiens populations collected from the Aegean region. Studies on kdr alleles responsible for DDT and pyrethroid resistance have been conducted in Cx. pipiens populations obtained from many countries of the world. For example, both L1014F and L101C kdr mutations were detected in Cx. pipiens populations in Greece (28). Additionally, high L1014F allele frequency was reported in Cx. pipiens populations obtained from Morocco and Mohammadiye cities of Morocco (29). The Kdr mutation is maintained by L1014S allele in Cx. pipiens quinquefasciatus populations obtained from some parts of China (30) by L1014F allele in Cx. pipiens populations of New Jersey (31) and by L1014C in Cx. pipiens populations of China (32).

Following the occurrence of DDT resistance, in the 1970s, CB and OP insecticides such as Malathion, Fenitrothion, and Bendiocarb and Propoxur began to be applied instead of DDT in the mosquito control studies (33). Bioassay results showed that all Cx. pipiens populations from the Mediterranean and Aegean Region are resistant to both OP and CB insecticides. This situation can be explained by the intensive use of OP and CB insecticides, especially Malathion, in the control of agricultural pests and as a result, creates a high selection pressure in agricultural areas (34). Similar to Turkish Cx. pipiens populations, several researchers from neighbouring countries such as Iran, Russia and Greece reported high insecticide resistance against different insecticides. For instance, Kioulos et al. (2014) reported Temephos and Deltamethrin resistance in some parts of Greece (35). Fenitrothion, DDT, Dieldrin, Propoxur, Bendiocarb, Malathion, Deltamethrin and Permethrin resistance has been reported in Cx. pipiens populations collected from the centre of Moscow (36). Resistance t oDDT, Malathion, Bendiocarb, Propoxur, Fenitrothion, Deltamethrin, Permethrin, Lamda-cyhalothrin, Etofenprox and Cyfluthrin has been reported from Iranian Cx. pipiens populations (37).

The significant increase in esterase enzyme activity in all Cx. pipiens populations of the Mediterranean region except the Manavgat population, indicates that OP and CB resistance is maintained with general esterases in populations of this species. Regarding OP ve CB resistance, molecular and biochemical data results were consistent with each other. ACHE insensitivity was generally lower along populations except the Adana Karata§, Mersin Tarsus, Mugla Dalaman and Aydin Soke populations which had slightly high remaining AChE activity. Consistently, PCR-RFLP did not detect any G119S allele in any of the populations indicating that Ace-1 G119S mutation is not responsible for the OP and CB resistance in Cx. pipiens populations. Additionally, OP and CB resistance could not be explained by Ace-1 F290V mutations since the frequency of F290V mutation was also too low. Several researchers reported that individuals carrying Ace-1 mutation (G119S and F290V) have a fitness cost including longer period time, reduced owerwintering survival, smaller adult size and increased risk of predation (38-41). This might explain why Culex pipiens populations in the study area had low Ace-1 (G119S and F290V) mutations. It has been reported that fitness cost might be diminished by duplication of the Ace-1 gene in some Culex pipiens populations (42-43). However, we were lack of duplication data set in that study. Similarly, G119S mutation frequency was found to be 0.11 and 0.08 and F290V mutation frequency was found to be 0.05 and 0.06 in Cx. pipiens populations obtained from the Aegean and Marmara Regions of our country in 2012 and 2013, respectively (12). The Ace-1 (G119S and F290V) mutations leading to insensitivity to organophosphates and carbamates were detected at low frequencies in Cx. pipiens populations in Greece (28). In addition to that, in Cx. pipiens populations obtained from urban and rural populations of Morocco, G119S mutation was found to be at a higher frequency in urban areas compared to rural areas due to Temephos (OP) used to fight Cx. pipiens larvae. However, the absence of G119S mutation in some individuals who did not die after being treated with OP shows that the only mechanism underlying OP resistance is not the G119S mutation (44). Similarly, Tmimi et al. (2018) found that the G119S mutation frequency was very low in Cx. pipiens populations of Morocco (29).

This study demonstrates that multiple insecticide resistance exists in Cx. pipiens populations from the Mediterranean and Aegean regions of Turkey. Medium to high kdr (L1014F) mutation frequency and extremely low F290V mutation frequency detected in these populations. However, no G119S mutation was detected within these populations as well as low AChE activity levels have been detected. Effective implementation of insecticide resistance management strategies is needed in order to delay the fixation of resistance alleles currently occurrs within these populations. The data obtained from this study will be valuable for vector control interventions in Turkey.

Conclusion

Understanding the resistance mechanisms and monitoring resistance patterns of the populations regularly are crucial for insecticide resistance management. We used both WHO's bioassay tests, biochemical assays and molecular markers at the same time to evaluate the insecticide resistance status and underlying mechanisms forthefirst time for Cx. pipiens populations collected from the Mediterranean and Aegean region of Turkey. The Mediterranean and Aegean regions are important agricultural regions as well as high tourism activities. As a result of high insecticide use in these regions, we hypothesised the occurrence of high resistance status against different classes of insecticides which have been used until today. We showed the complicated role of detoxification enzymes. However, one of an important limitation of our study was the absence of synergist assays to get more reliable data set regarding the biochemical mechanisms. We also detected mild to high frequency of kdr L1014F allele frequency as a result of DDT and/or pyrethroid use. However, we did not detect any other kdr alleles probably because of the restricted ability of allele-specific primers to detect different kinds of alleles. Interestingly, we did not detect Ace-1 G119S allele in any populations. Furthermore, we detected too low Ace-1 F290V mutations and insensitive acetylcholinesterase levels in some of the populations. Further studies with higher sample sizes are needed to establish insecticide resistance profiles in order to evaluate more accurately and avoid resistance problems before it is spread to the whole mosquito populations.

Acknowledgements

This research was funded by the Scientific Research department of Aydin Adnan Menderes University (Project Number: BAP-FEF-15005). We are also grateful to Professor Oguz Tiirkozan for proofreading for his support in statistical analyses.

A

Ethical approval

This article does not contain any studies with animals performed by any of the authors.

Declaration of Competing Interest

The authors declare that they have no conflict of interest.

References

References

1. Benelli G , Jeffries C L , Walk- er T(2016) Biological Control of Mosquito Vectors: Past. Present, and Future. Insects. 7(4):52.

2. Caraballo H, King K(2014) Emergen- cy Department Management of Mosquito-Borne Illness: Malaria, Dengue, and West Nile Virus. Emerg Med Pract. 16(5): 1-23.

3. World Health Organization (2012) Global Plan for Insecticide Resistance Management in Malaria Vectors (GPIRM). Geneva.

4. Hemingway J(2014) The role of vector control in stopping the transmission of malaria: Threats and opportunities. Philos Trans R Soc Lond B Biol Sci. 369(1645):20130431.

5. Brugman VA, Hernandez-Tri- ana LM, Medlock JM , Fooks AR, Carpenter S, Johnson N(2018) The role of Culex pipiens L. (Diptera: Culicidae) in virus transmission in Europe. Int J Environ Res Public Health. 15(2):389.

6. European Centre for Disease Prevention and Control (2019) West Nile virus infection. Annual epidemiological report for 2018. Stockholm.

7. Ozkul A, Ergunay K, Koy- suren A, Alkan F, Arsava EM, Tez- can S, Emekdas G, Hacioglu S, Tur- an M, Durdal Us (2013) Concurrent occurrence of human and equine West Nile virus infections in Central Anatolia, Turkey: the first evidence for circulation of lineage 1 viruses. Int J Infect Dis. 17(7):e546-51.

8. Kalaycioglu H, Korukluoglu G, Ozkul A, On- cul 0, Tosun S, Karabay O, Gozalan A, Uyar Y, Caglayik D Y, Atasoylu G, Altas A B, Yolbakan S, Ozden T N, BayrakdarF, SezakN, Pehtli T S, Kurtcebe Z 0, Aydin E, Ertek M (2012) Emergence of West Nile virus infections in humans in Turkey, 2010 to 2011. Euro Surveill. 17(21):20182.

9. Denholm I, Rowland M W (1992) Tactics for managing pesticide resistance in arthropods: Theory and practice. Annu Rev Entomol. 37:91-112.

10. AkinerMM, §im§ekFM, Caglar SS (2009) Insecticide resistance ofCulex pipiens (Diptera: Culici-dae) in Turkey. J Pest Sci. 34(4): 259-264.

11. Akiner MM, Eksj E (2015) Evaluation of insecticide resistance and biochemical mechanisms of Culexpipiens L. in four localities of east and middle mediterranean basin in Turkey. Int J Mosq Res. 2(3): 39-44.

12. Taskin BG, Dogaroglu T, Kilic S, Dogac E, Taskin V(2015) Pesticide biochemistry and physiology, seasonal dynamics of insecticide resistance, multiple resistance, and morphometric variation in field populations of Culex pipiens. Pestic Biochem Physiol. 129:14-27.

13.Guz N , Cagatay NS, Fotakis EA, Durmusoglu E, Vontas J(2020) Detection of diflubenzuron and pyrethroid resis- tance mutations in Culex pipiens from Mugla, Tur- key. Acta Trop. 203:105294.

14. Alten SB, Caglar SS (1998) Vektor Ekolojisi ve Mticadelesi: Sitma Vektoriinun Biyo-Ekoloji-si Mticadele Organizasyonu ve Yontemleri. TC Saglik Bakanligi Sitma Savas. Daire Ba§kanligi ve Saglik Projesi Genel Koordinatorlugii Bizim Btiro Basimevi. Ankara.

15. Becker N, Petric D, Zgomba M, Boase C, Dahl C, Lane J, Kaiser A (2003) Mosquitoes and Their Control. Kluwer academic and Plenum publishers, New York.

16. World Health Organization (1998) Techniques to detect insecticide resistance mechanisms (field and laboratory manual). WHO/CDS/CPC/ MAL/98.6. WHO Department of Disease Prevention and Control WHO communicable diseases. Geneva.

17. World Health Organization (2016) Test procedures for insecticide resistance monitoring in malaria vector mosquitoes. 2nd edition. Geneva.

18. Bradford MM (1976) Arapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248-54.

19. Brogdon W G, McAllister J C, Vulule J (1997) Haem peroxidase activity in single mosquitoes identifies individuals expressing an elevated oxi- dase for insecticide resistance. J Am Mosq Control Assoc. 13(3):233-7.

20. Martinez-Torres D, Chevillon C, Brun-Barale A, Berge JB, Pasteur N, Pauron D (1999) Voltage-de- pendent Na+ channels in pyrethroid- resistant Culex pipiens L mosquitoes. Pestic Sci. 55: 1012- 1020.

21. Weill M, Fort P, Berthom- ieu A, Pierre Dubois M, Pasteur N, Raymond M(2002) A novel acetylcholinesterase gene in mosquitoes codes for the insecticide target and in non-homologous to the ace gene in Dro- sophila. Proc Biol Sci. 269(1504)2007-16.

22. Rodriguez M M , Bisset J A, Fernan- dez D (2007) Levels of insecticide resistance and resistance mechanisms w. Aedes aegypti from some Latin American countries. J Am Mosq Control Assoc. 23(4):420-9.

23.0campo C B , Salazar-Terreros M J, Mina N J, McAllister J, Brogdon W (2011) Insecticide resistance status of Aedes aegypti in 10 localities in Colombia. Acta Trop. 118(l):37-44.

24. Akiner MM, Caglar S S, Simsek FM(2013) Year- ly changes of insecticide susceptiblity and possible insecticide resistance mechanisms of Anopheles maculipennis Meigen (Diptera: Culicidae) in Tur- key. Acta Trop. 126(3)280-5.

25. Yava§oglu SI, Yaylagiil EO, Mu- hammet Mustafa Akiner MM, Ulger C, Caglar SS, §im§ek FM(2019) Current insecticide resistance status in Anopheles sacharovi and Anopheles superpictus populations in former malaria endemic areas of Turkey. Acta Trop. 193:148-157.

26. Hemingway J, Ranson H (2000) Insecticide resis- tance in insect vector of human disease. AnnuRev Entomol. 45:371-91.

27. Chiu T, Wen Z, Rupas- inghe SG, Schuler MA(2008) Comparative mo- lecular modeling of Anopheles gambiae CYP6Z1, a mosquito P450 capable of metabolizing DDT. Proc Natl Acad Sci USA. 105(26):8855-60.

28. Fotakis EA, Chaskopou- lou A, Grigoraki L, Tsiaman- tas A, Kounadi S, Georgiou L, Vontas J (2017) Analysis of population structure and insecticide resistance in mosquitoes of the genus Culex, Anopheles and Aedes from different environments of Greece with a history of mosquito borne disease transmission. Acta Trop. 17429-37.

29. Tmimi F, Faraj C, Bkhache M, Mounaji K, Fail-loux A, SarihM(2018) Insecticide resis- tance and target site mutations (G119S ace-1 and L1014F kdr) of Culex pipiens in Morocco. Parasit Vectors. 11(1):51.

30. Xu Q, Wang H, Zhang L, Liu N(2016) Kdr allelic variation in pyrethroid re- sistant mosquitoes, Culex quinquefasciatus (S.). Biochem Biophys Res Commun. 345(2):774-80.

31. Johnson BJ, Fonseca DM(2016) Insec- ticide resistance alleles in wetland and residential populations of the West Nile virus vector Culex pipiens in New Jersey. PestManag Sci. 72(3):481-8.

32. WangZM, Li CX, XingD, YuYH, LiuN,Xue RD, Dong YD, Zhao TY(2012) Detection and widespread distribution of sodium channel alleles characteristic of insecticide resistance in Culex pipiens complex mosquitoes in China. Med Vet Entomol. 26(2)228-32.

33.Ramsdale CD, Herath PR, Davidson G (1980) Recent developments of insecticide resistance in some Turkish Anophelines. J Trop Med Hyg. 83(l):ll-9.

34. Kasap H, Kasap M, Alptekin D, Liileyap U, Herath P R (2000) Insecticide resistance in Anopheles sacharovi Favre in southern Turkey. Bull World Health Organ. 78(5):687-92.

35.Kioulos I, Kampouraki A, Morou E, Skavdis G, Vontas J(2014) Insecticide resistance status in the major West Nile virus vector Culex pipiens from Greece. PestManag Sci. 70(4):623-7.

36. Sorokin N N, Zharov A A (1992) Insecticide resistance and irritability of Culex pipiens in Moscow. MedParazitol (Mosk). (3):35-8.

37.Rahimi S, Vatandoost H, Abai MR, Raeisi A, Hana- fi-Bojd AA(2019) Status of resistant and knockdown of West Nile vector, Culex pipiens complex to different pesticides in Iran. J Arthropod Borne Dis. 13(3):284-296.

38. Berticat C, Boquien G, Ray- mond M, Chevillon C(2002) Insecticide re- sistance genes induce a mating competition cost in Culex pipiens mosquitoes. Genet Res. 79(l):41-7.

39. Berticat C, Duron 0, Heyse D, Raymond M (2004) Insecticide resistance genes confer a pre-dation cost on mosquitoes, Culex pipiens. Genet Res. 83(3):189-96.

40. BourguetD, GuillemaudT, Chevillon C, Raymond M(2004) Fitness costs of insecticide resistance in natural breeding sites of the mosquito Culex pipiens. Evolution. 58(1): 128-35.

41. Gazave E, Chevillon C, Lenormand T, Mar- quine M, Raymond M (2001) Dissecting the cost of insecticide resistance genes during the overwintering period of the mosquito Culex pipiens. Heredity (Edinb). 87(Pt4):441-8.

42.Labbe P, Berthomieu A, Ber- ticat C, Alout H, Raymond M, Lenormand T, Weill M(2007) Independent duplications of the acetylcholinesterase gene con- ferring insecticide resistance in the mosquito Cu lex pipiens. Mol Biol Evol. 24(4): 1056-67.

43.Labbe P, Berticat C, Berth- omieu A, Unal S, Bernard C, Weill M, Lenormand T(2007) Forty years of erratic insecticide resistance evolution in the mosquito Culex pipiens. PLoS Genet. 3(ll):e205.

44. Bkhache M, Tmimi F, Charafeddine 0, Fila- li OB, Lemrani M, Labbe P, Sarih M(2019) G119S ace-1 mutation conferring in- secticide resistance detected in the Culex pipiens complex in Morocco. PestManag Sci. 75(1):286- 291.