Full text

Turn on search term navigation

1. Introduction

Sesame (Sesamum indicum L.; 2n = 2x = 26) belongs to the family Pedaliaceae. It is a predominantly self-pollinating crop [1]. Sesame cultivation dates back some 5500 years ago in the Harappa valley of India [2]. Sesame seed oil and derived products serve the food, feed, and cosmetics industry globally. Sesame has higher seed oil content ranging from 40% to 60% when compared to soybean (~20%), rapeseed (~40%), sunflower (~45%), and groundnut (45–56%) [3,4,5,6,7]. Sesame oil comprises about 85% unsaturated and 15% saturated fatty acids [6]. The unsaturated fatty acids include linoleic acid (~46%) and oleic acid (~38%), while the saturated fatty acids are palmitic acid (~12%) and stearic acid (~4%) [6,8,9]. The higher quantity of unsaturated fatty acids present in sesame oil has human health benefits believed to minimize the risks of cardiovascular diseases, cancer, brain, and liver damage [10,11].

Sesame is widely traded in local, regional, and international markets [12]. A global total of 2.4 million tons of sesame grain was traded in 2020 with a monetary value of 3.2 trillion USD [13]. Likewise, sesame consumption is steadily increasing due to high demands related to its unique nutritional values such as higher contents of vitamins (e.g., A and E), minerals, fiber, desirable fatty acids, carbohydrate (~13.5%), and protein (~24%) [12]. Furthermore, population pressure, urbanization, and the changing lifestyle have increased the global demand for sesame products [12].

About 70% of the world’s sesame seed is processed to produce food oil, while the seedcake left after oil processing is used to prepare livestock meals [12]. The global annual human consumption of sesame is about 65% and 35% in the form of processed food oil and grain, respectively [14]. In 2020, world sesame grain production was 7.25 million tons [13]. Sudan is the largest sesame grain-producing country with 1.52 million tons per annum, followed by China (0.89 million tons), Myanmar (0.74 million tons), the United Republic of Tanzania (0.71 million tons), India (0.65 million tons), Nigeria (0.49 million tons), Burkina Faso (0.27 million tons), and Ethiopia (0.26 million tons) [13].

The actual mean seed yield of sesame in sub-Saharan Africa is <0.6 ton·ha−1, which is far below the attainable yield of the crop, reaching up to 4.00 tons·ha−1 [13]. Relatively higher sesame seed yield productivity is reported in Lebanon (3.29 tons·ha−1), Jordan (2.38 tons·ha−1), Israel (2.04 tons·ha−1), China (1.62 tons·ha−1), Tajikistan (1.59 tons·ha−1), and Uzbekistan (1.52 tons·ha−1) [13]. The low yield level in sub-Saharan Africa is attributable to the use of unimproved traditional varieties or landraces. Moreover, sesame yields are hindered by the indeterminate growth habit of some varieties, capsule shattering, and excessive seed loss pre- and post-harvest [12,15,16,17]. Nearly all the global sesame varieties are prone to capsule shattering, and they are not suitable for machine harvesting [12,18,19]. Langham and Wiemers [18] reported a pre-harvest yield loss of 50% in some sesame varieties due to capsule shattering. Hence, manual sesame harvesting is the method of choice globally, which significantly increases the production and market costs of the produce [12,18,19].

Ethiopia is the center of genetic diversity of sesame [20,21]. The Ethiopian Biodiversity Institute (EBI) maintains about 5000 accessions of sesame germplasm collections [22]. The production and productivity of the crop in East Africa, including Ethiopia, are severely constrained by the lack of high-yielding and locally adapted varieties, susceptibility to capsule shattering and poor seed retention, the prevalence of several biotic and abiotic stresses, and a lack of modern production and pre- and post-harvest technologies [8]. In the region, sesame production relies on unimproved traditional varieties or landraces [22]. The landrace varieties are highly preferred by growers, consumers, and markets due to unique aroma and taste. These attributes make the traditional varieties attractive to growers, breeders, and local, regional, and international markets. Hence, landrace varieties are an excellent source of genetic variation for sesame pre-breeding and breeding programs globally.

Current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, amenability to machine harvesting, and other industrially essential oil and fatty-acid profiles for multiple utilities. This can be achieved by integrating the conventional breeding methods, genetic and genomic techniques such as mutation breeding, genomics-assisted breeding, and genome editing. Therefore, the objective of this review is to document the breeding progress, opportunities, and challenges of sesame with regard to genetic improvement and variety release and deployment. The review highlights sesame’s economic values, production status, major production constraints, conventional breeding methods, and genomics-assisted breeding and their integration for accelerated breeding and cultivar development with enhanced seed yield and related agronomic traits, as well as oil content and fatty acid compositions. Information presented in the paper serves as a guide for current and future sesame research and development programs.

2. Global Sesame Production

Sesame is widely cultivated in tropical and subtropical agro-ecologies of the world. The major production regions are Africa, Asia, Latin America, and Europe, with production share of 59.05%, 36.47%, 4.22%, and 0.26%, respectively, during 2020 (Table 1). The global production area increased from 7.72 to 14.24 million ha during the last 21 years [13]. The increased sesame production was mainly attributed to the expansion of farmlands and the market values of sesame products [13]. The leading sesame-producing countries with total production area, share of production, and yield are summarized in Table 2. Sudan is the leading sesame producer, followed by China, Myanmar, the United Republic of Tanzania, India, Nigeria, Burkina Faso, and Ethiopia, with global shares of 21.02%, 12.36%, 10.20%, 9.78%, 9.07%, 6.76%, 3.72%, and 3.59%, respectively, in 2020 [13].

There has been steady development in the total global sesame production in the past 21 years (1999 to 2020). For instance, Sudan witnessed the most significant outputs that increased from 0.33 million tons (1999) to 1.53 million tons (2020), followed by Burkina Faso (0.012 to 0.27 million tons) and the United Republic of Tanzania (40,000.00 to 0.71 million tons) [13]. During the same period, the total sesame of production in Ethiopia, Nigeria, Myanmar, and India increased from 0.02 to 0.26, 0.07 to 0.49, 0.25 to 0.74, and 0.48 to 0.66 million tons, respectively [13].

Reportedly, Afghanistan, Sudan, Egypt, India, Myanmar, Paraguay, the United Republic of Tanzania, Nigeria, Burkina Faso, and Ethiopia recorded a rapid increase in both cultivated area and total production between 1999 and 2020 [13]. Contrastingly, sesame production declined in the Central African Republic, El Salvador, Iraq, Kenya, Morocco, and South Korea between 1999 and 2020 [13].

In the past 21 years, variable sesame yields per unit production area have been recorded globally [13]. For example, the yield records in Lebanon increased from 2.08 tons·ha−1 (1999) to 3.30 tons·ha−1 (2020), while those in Jordan increased from 0.92 tons·ha−1 (1999) to 2.38 tons·ha−1 (2020). According to FAOSTAT [13], sesame yields in Mozambique and Venezuela declined between 1999 and 2020 from 0.64 to 0.46 and 0.61 to 0.38 tons·ha−1, respectively, due to limitation of access to improved technologies and extension services. The lowest average sesame yields were reported in Côte d’Ivoire, Guinea, Central African Republic, and Angola at 0.19, 0.23, 0.24, and 0.26 tons·ha−1, respectively, from 1999 to 2020. Lebanon, Jordan, Israel, and China recorded the highest average yields (>1.0 tons·ha−1) during the same years [13]. In the past 10 years, the total annual global sesame production increased from 5.32 million tons (2011) to 7.30 million tons (2020), while the corresponding seed yield varied from 0.78 to 0.79 tons·ha−1 (Figure 1) [13]. Therefore, the average sesame yield is low and stagnant globally. The increasing trend in total sesame production emanated mainly from the expansion of farmlands rather than seed yield productivity per unit area. The low yield gains of the crop suggest the need for a concerted effort for global sesame genetic improvement to boost seed yield and oil production to meet the soaring demand for oil and derived products.

3. Constraints to Sesame Production

The major constraints to sesame production and productivity are a lack of high-yielding and locally adapted varieties, capsule shattering and seed loss, uneven maturity, biotic stresses (insect pests and diseases), abiotic stresses (e.g., drought, waterlogging, salinity, and frost), the use of traditional production technologies, and poor pre- and post-harvest infrastructure [8,15,17,23,24,25,26,27,28,29].

Field insect pests cause a yield loss of 25% in sesame [30]. The major insect pests of sesame crop are webworm (Antigastra catalaunalis), gall midge (Asphondylia sesame), and seed bug (Elasmolomus sordidus) [31]. The seed bug is both a field and a storage insect pest that causes up to 50% yield loss at storage [32]. Moreover, most sesame varieties are attacked by diseases caused by bacteria (e.g., blight caused by Xanthomonas campestris pv. sesame), fungi (e.g., charcoal rot caused by Macrophomina phaseolina, stem anthracnose (Colletotrichum spp.), mildew (Erysiphe cichoracearum), Fusarium wilt caused by Fusarium oxysporum f.sp. sesame (Fos), and root rot (Rhizoctonia solani)), and viruses (e.g., phyllody, Orosius albicinctus) [12].

Among the fungal diseases, charcoal rot is the most devastating disease of sesame caused by soil-borne necrotrophic fungus Macrophomina phaseolina (Tassi) Goid [33]. This fungus causes pre- and post-emergence damage in more than 500 plant families, including sesame. Furthermore, Fusarium wilt is one of the most economically important soil-borne diseases of sesame globally causing 15–30% 1yield loss [34,35]. For instance, root rot caused by Rhizoctonia solani is one of the most damaging fungal diseases in Egypt [36,37]. Drought stress is the main yield-limiting constraint in sesame during the vegetative and flowering growth stages [12,38,39,40]. Yousif et al. [41] and Tripathy et al. [28] reported that sesame is sensitive to waterlogging, salinity, and low-temperature conditions. Waterlogging leads to reduced plant growth, leaf axils per plant, biomass, net photosynthesis, and seed yield [42,43].

Cultivation of sesame using varieties with indeterminate growth habits and that are susceptible to capsule shattering leads to yield penalty [8,12,15,17,24,25,26,27]. Globally, 99% of sesame varieties are susceptible to capsule shattering [12,18,19]. Langham and Wiemers [18] reported a 50% pre-harvest yield loss owing to capsule shattering and seed loss.

Sesame seed loss is common during pre-harvest (e.g., field crop stand) and post-harvest (e.g., harvesting, stacking, drying, threshing, transporting, storage, seed cleaning, and packaging) [44]. Pre- and post-harvest losses are the confounding factors of reduced yield loss and high market price in sesame production.

Lack of access to post-harvest infrastructure and low and variable market prices during harvest are among the critical challenges in sesame value chains [12,17,24]. For instance, in Ethiopia, a 100 kg of sesame grain is traded at 1000–3000 ETB (about 22.3–67 USD) during the harvest period (October to December), while the price is at 3000–3500 ETB (about 67–78 USD) during the off-season (January to September) [17].

4. Sesame Breeding

The main goals in sesame breeding programs include high seed yield, seed oil quantity and quality, capsule shattering resistance, high seed retention rate, uniform maturity, and tolerance to biotic and abiotic stresses. However, breeding gains in sesame are low and stagnant compared to other oilseed crops such as groundnut and sunflower [45]. Selection for improved seed yield and yield components remains the key breeding strategy. The main yield-related traits include early and uniform maturity, reduced plant height, higher number of capsules per plant, number of branches per plant, number of seeds per capsule, and heavier 1000-seed weight. Thus far, most sesame breeding programs have largely focused on germplasm characterization and recommendation using the conventional breeding methods. There is a need to complement phenotyping with other modern breeding strategies such as identifying and discovering new genes, genomic-assisted breeding, and gene editing, which are described below.

Progress and Achievements in Sesame Genetic Improvement

In the past 20 years, sesame research and development have benefited from conventional breeding methods, including pure line and mass selection, hybridization and mutation breeding. This has led to the development of improved sesame varieties. In the last 40 years, more than 200 improved sesame varieties with high yields, oil quantity and quality, early maturity, and resistance to diseases and insect pests were developed and released globally.

Genetic and genomic techniques such as genomics-assisted breeding and genome editing have been markedly used in oil crop research such as in groundnut and rapeseed crops. There has been rapid development of genetic tools, particularly molecular markers, and their application in genetic diversity studies, marker-assisted breeding, chloroplast genome sequencing, haplotype mapping, database development, association mapping, genome-wide association studies (GWAS), gene discovery and functional studies, genetic mapping, and genomics-assisted breeding [45,46,47]. Nevertheless, these genomic resources have been widely used in most sesame genetic improvement programs.

Modern sesame genotypes reported with agronomic and other valuable traits are summarized in Table 3. India and China have each developed more than 50 improved cultivars over the last 40 years [48]. A total of 32 improved sesame varieties have been developed and released by the Ethiopian Institute of Agricultural Research (EIAR) through mass selection from among the local germplasm collections since 1976 [49]. Among the EIAR’s released varieties, Humera-1 and Setit-1 are widely grown by farmers for their early maturity, better yield response (about 1 ton/ha), and broad adaptability [17]. However, the yield response of these varieties is below the reportedly attainable yields of the crop. Some 29 sesame varieties were released in Myanmar in the past 42 years. These varieties were bred for early maturity, white seed color, high yield, and seed oil content [12]. In Myanmar, the following varieties were released: Ju-Ni-Poke, Me-Daw-Let-The, Gwa-Taya, and Gwa-KyawNet. The varieties reportedly had stable yields. Ju-Ni-Poke, Shark-Kale, Hnan-Ni 25/160, Yoe-Sein, Boat-Hmway, Kye-Ma-Shoung, Selin-Boat-Taung, Magway-Ni 50/2, and Nyaung-Aing had relatively higher seed oil content (≥ 55%) [12]. In Bulgaria, four sesame varieties, namely, Victoria, Aida, Valya, and Nevena, were successfully developed for amenable to mechanized harvesting with a mean grain yield of 1.35 tons·ha−1 through a research collaboration between plant breeders and agricultural engineers over the last 30 years [50]. In Kenya, sesame cultivars such as SIK 031 and SIK 013 showed resistance to the white leaf spot disease, whereas SIK 031 and SPS 045 showed resistance to angular leaf spot disease [51]. The two varieties were released by the department of crop science, the University of Nairobi [52].

5. Sesame Genetic Resources and Gene Banks

Sesame genetic resources are the key sources of genetic variation that lead to the selection of desirable traits for current and future genetic improvement programs. Genetically diverse sesame germplasm resources are collected and maintained by different local and international gene banks in sesame improvement programs (Table 4).

A significant number of sesame genetic materials involving cultivated and wild species are maintained in different gene banks globally (Table 4) [59]. About 95% of the sesame genetic resources are maintained in Asia, while 5% are maintained in the United States of America (Table 4). The major sesame gene banks are the National Bureau of Plant Genetic Resources (NBPGR) in India, the National Agrobiodiversity Center, Rural Development Administration in South Korea [60], the Oil Crops Research Institute, Chinese Academy of Agricultural Sciences in China, and the US Department of Agriculture—Agricultural Research Service—Plant Genetic Resource Unit (USDA-ARS-PGRU) in the United States of America [61].

A total of 27,283 sesame genetic materials are preserved in the gene banks in India, South Korea, China, and the United States of America (Table 4). Several African countries, such as Ethiopia, Nigeria, and Sudan, have small-scale gene banks [22,45]. The African sesame gene banks have reservoirs of a reasonable amount of genetic resources, but vital core collections (CCs) are yet required in the region for efficient exploration and utilization of novel genetic variation [62]. Currently, there are three CCs of sesame globally, of which 362 accessions are in India [63], 453 are in China [64], and 278 are in South Korea [60]. The collected accessions are a source of valuable genetic variation for genetic improvement and analysis of useful traits. The Asian sesame genetic resources have been relatively well characterized and preserved compared to African germplasms [65]. Therefore, there is a need to collect the cultivated and wild forms of the sesame species from Africa. This will lead to an establishment of CCs for efficient conservation and exploitation of the novel genetic variation in Africa and internationally.

6. Landraces and Improved Sesame Varieties

Landraces are a valuable source of genetic diversity and possess important traits for pre-breeding and breeding programs [66]. Landraces are widely cultivated in developing countries, often using traditional farming systems in various harsh growing environments and diseases and insect pest pressures [67]. Landraces are useful to integrate unique traits into elite lines and pipeline breeding programs. This enhances sustainable sesame production to meet the standard quality requirements of the local and international markets, as well as for environmental adaption and mitigation against climate change.

Despite the economic value of sesame in the food and oil industries and export market, sesame remains largely under-researched and underutilized in Africa, including Ethiopia [22]. For instance, in Ethiopia, the current sesame production relies on a limited number of genetically unimproved landrace varieties selected by farmers. The landrace variety “Hirhir” is widely cultivated by smallholder and medium-to-large commercial farmers in the country. The variety has a low yield level but possesses novel seed oil quality characteristics, such as aroma and taste [22].

Sehr et al. [68] characterized Ugandan sesame landraces and reported a narrow genetic variation when assayed with morphological and molecular data. Promising sesame landraces were selected amongst Myanmar collections that possessed useful traits such as high seed yield, as well as oil quality and quantity [12]. In China, novel genome sequence data have been generated for two sesame landraces Baizhima and Mishuozhima and two modern cultivars Zhongzhi 13 and Yuzhi 11, in addition to Swetha in India. The genome sequence of these genetic resources is a useful reference for sesame breeders, geneticists and biologists [35]. The sequence information revealed that modern varieties contain genes mainly related to yield and quality, while the landraces contain genes involved in environmental adaptation. The two landraces were originally cultivated in Hainan and Zhejiang provinces in China [61]. The sesame landrace genetic resources present in the centers of origin or diversity need to be systematically collected and evaluated on the basis of seed yield and yield-related traits, as well as oil quantity and quality, for breeding and conservation.

7. Breeding Methods and Associated Technologies for Sesame Improvement

7.1. Conventional Breeding

Sesame improvement and variety development are dependent on conventional breeding methods [69]. In the past, limited genomic tools were used due to limited access to the technology and a lack of a consolidated genetic database on important agronomic traits and genes conditioning key traits [45].

Conventional sesame breeding has been the source of creating new genetic variations [60,61,62,63,64,65,66,67,68]. Previous reports indicated the presence of genetic variation for important traits such as reduced days to 50% flowering, days to 75% maturity, capsule filling period, short plant height, greater internode length, a higher number of primary branches per plant, number of secondary branches per plant, number of capsules per plant, number of seeds per capsule, increased capsule length, capsule width, stem height to first branch, distance from lowest branch to first capsule, 1000-seed weight, biomass yield per hectare, harvesting index, and seed yield per hectare in sesame. These traits are useful for sesame variety descriptions, agro-morphological and genetic analyses, and breeding programs [70,71,72,73,74,75,76,77,78]

Understanding the prevailing genetic variability, magnitude of heritability, and correlation of agronomic traits plays a vital role in the effective use of germplasm [12]. Heritability estimates measure the extent of genetic variation and advancement through phenotypic selection [79]. High heritability and high genetic advances are preconditions for effective phenotypic selection in conventional breeding [80]. Divya et al. [81] in India and Aye and Htwe [82] in Myanmar reported high heritability and genetic advances for plant height and the number of capsules per plant in sesame.

The magnitude of association amongst economic phenotypes guides the selection efficiency in sesame breeding. Highly correlated traits ensure higher selection response and yield gains [83]. Sesame seed yield exhibits a highly significant positive correlation with plant height, number of primary and secondary branches, number of capsules per plant, and 1000-seed weight [22,71,74,77,82]. Dossa et al. [6] assessed the contents of oil, protein, and fatty acid among 139 sesame genotypes collected from Africa and Asia. The authors reported a negative correlation between seed oil and oleic acid contents, corroborating with Teklu et al. [84] when assaying 100 Ethiopian sesame germplasm collections. Additionally, a negative correlation was recorded between oleic acid and linoleic acid contents in sesame genotypes [6,60,84]. Analyzing trait correlations in sesame breeding populations is vital for effective selection for seed yield, yield components, and oil content and profiles.

7.2. Mutation Breeding

Mutation breeding is helpful in enhancing genetic variation to complement conventional breeding programs [85,86]. Induced mutagenesis has made significant contributions to sesame breeding. Some 147 sesame mutants with desirable economic traits were registered through improvement programs globally [87,88].

Table 5 lists some of the reportedly improved sesame varieties with economic traits derived through mutation induction globally. For example, Senai white 48 and Cairo white 8 mutant varieties were developed and released in Egypt [87]. These varieties are grown by the farmers for their white seed color and nonbranching habits. In India, the variety Usha was developed through chemical mutagenesis and released for its increased yield. Lee and Choi [89] reported sesame mutant varieties with high oil content and disease resistance in South Korea. Kang [90] reported higher oleic content and phytophthora blight tolerance in a mutant variety Seodun in South Korea. In Sri Lanka, the mutant variety ANK-2 was developed and released, possessing adequate disease resistance [91]. Capsule shattering is amongst the low-yield-attributing factors in sesame [17]. Hence, future mutation breeding programs should target this grand challenge.

7.3. Genomics-Assisted Breeding

Genomic tools and techniques are key for trait discovery and molecular breeding [92]. Various databases for sesame genomics are summarized in Table 6. A study by Wei et al. [35] reported a genome size of 554.05 Mbp in sesame, of which the core and dispensable genomes were 258.79 and 295.26 Mbp, respectively. The sesame genome consists of 26,472 orthologous gene clusters, of which 15,890 genes are variety-specific [93]. The sesame pangenome, the entire set of genes, is a vital genomic resource for sesame improvement programs and genetic analysis.

7.3.1. Genetic Diversity Analysis

Molecular markers are highly reliable genetic tools that complement phenotypic selection for breeding [100]. Knowledge on the genetic diversity and population structure of germplasm collections is vital for genetic analysis, breeding, and conservation [101]. Genetic diversity in sesame has been explored using several DNA markers. Various studies have assessed the genetic diversity of sesame accessions globally using amplified fragment length polymorphism (AFLP) [102,103], random amplified polymorphic DNA (RAPD) [15,104,105], inter simple sequence repeat (ISSR) [25,26,106], microsatellites or simple sequence repeat (SSR) [22,35,59,65,107,108,109,110], and single-nucleotide polymorphisms (SNPs) [111,112]. The SSR markers are widely used in sesame genetic analysis and breeding for their ability to detect higher degrees of polymorphism, higher reproducibility, codominance, and abundant genome coverage [35].

Table 7 lists of some polymorphic SSR markers developed for sesame breeding. SSR markers play an important role in genetic diversity research, population genetics, linkage mapping, comparative genomics, and association analysis [41,53,65,109,113]. Some SSR primers such as ZM_20, ZM_21, and ZM_22, followed by ZM_11, and ZM_45, are more polymorphic (with polymorphic information content (PIC) of ≥0.80).

Frary et al. [114] conducted a genetic diversity study using morphological traits and RAPD markers among 137 Turkish sesame germplasms which led to the selection of a core collection. A total of 121 Ugandan sesame landraces were investigated using 24 SSR markers, and the results showed incongruence between morphological and molecular data [68]. Anyanga et al. [27] reported a medium genetic differentiation among 85 test germplasms sourced from different countries at the National Semi-Arid Resources Research Institute (NaSARRI) in eastern Uganda. Moreover, Pandey et al. [53] analyzed a worldwide germplasm collection predominantly of Indian accessions and reported a high genetic diversity within the germplasm. However, there were nonsignificant correlations between phenotypic and molecular marker information. Pham et al. [115] reported a substantial amount of genetic diversity present in 12 Vietnamese and Cambodian populations. Twenty-seven Iranian sesame accessions were characterized that revealed large genetic variability [116]. Teklu et al. [22] reported a wide genetic diversity among 100 Ethiopian sesame genotypes when assessed using 27 SSR markers.

The genetic diversity among 100 Ethiopian germplasm collections was assessed using seed oil, fatty acid compositions, and SSR markers [84]. The authors reported wide genetic variation for the contents of seed oil and fatty acid profiles among the test lines. The contents of oil in the assessed lines varied from 44.30% to 55.60%, with a mean of 49.84%, followed by oleic acid ranging from 36.70% to 48.80% and a mean of 42.90%, and linoleic acid (36.60% to 47.10%, mean 41.70%) [84].

Limited genetic studies have been conducted on wild related species of the genus Sesamum [40]. Nyongesa et al. [25] reported a high genetic diversity within wild sesame species using six ISSR markers. Uncu et al. [117] discovered a high rate of SSR marker transferability between S. indicum and S. malabaricum, supporting the designation of the two taxa as cultivated and wild forms of the same species. The wild species of sesame possess genes related to resistance to biotic and abiotic stresses, as well as broad adaptability [118]. In sesame, the introgression of valuable genes from wild related species into cultivars through conventional breeding has not been so far successful due to the post-fertilization barrier [119].

7.3.2. Quantitative Trait Locus (QTL) Analysis

Quantitative trait locus (QTL) analysis detects major genetic regions of a target quantitative trait in a population [120]. Table 8 summarizes some quantitative trait loci (QTLs) of target traits identified for sesame breeding. QTL maps are useful for discovering, dissecting, and manipulating the genes responsible for simple and complex traits in crop plants [121]. A high-quality genetic map improves genome assembly and provides a foundation for gene mapping that underlie agronomic traits of important oil crops such as sesame [122].

7.3.3. Next-Generation Sequencing

Next-generation sequencing (NGS) has revolutionized genomic and transcriptome research. Sequencing tools are valuable for the discovery, validation, and assessment of genetic markers in diverse populations [133]. Quantitative trait locus (QTL) NGS technologies have significantly enhanced the efficiency and costs of genotyping in several model and crop plants [133].

NGS allowed for the rapid construction of high-density or ultra-dense single-nucleotide polymorphism (SNP) genetic maps for gene identification [134,135,136,137]. Genetic research on sesame has steadily progressed in the last few years with the development of the NGS technology. Six high-density molecular genetic maps have been constructed and are currently being used for sesame genome assembly and map-based gene cloning [96,122,123,125,126,138,139]. Ultra-dense SNP genetic maps using whole-genome re-sequencing are used to enhance gene cloning and genomics research in sesame [126,140]. Two sesame genes, Sidt1 controlling inflorescence determinacy and Sicl1 controlling leaf curling and capsule indehiscence, were successfully cloned using the linkage mapping method and candidate variant screening [126,140]. The NGS platform in sesame breeding programs can assist in the rapid development of genomic tools for genetic improvement, cultivar development, and commercialization.

Sesame is an indeterminate type with a long flowering duration which is more than 1 month in some varieties [126]. Flowering time affects adaptation, agronomic traits, and seed yield [45]. Reduced days to 50% flowering and days to 75% maturity are yield-contributing traits in sesame. The low seed yield of sesame is attributable to indeterminate flowering habits compared to other oilseed crops [141]. Wei et al. [61] reported two candidate genes of loci SiDOG1 (SIN_1022538) and SiIAA14 (SIN_1021838) conditioning flowering time. Zhang et al. [126] reported that the gene SiDt (DS899s00170.023) conferred determinate growth habits in sesame. The determinate trait is desirable for shortening the flowering time, enhancing capsule ripening and uniform maturity, easing mechanical harvesting, reducing capsule shattering and seed loss, and increasing seed yield [126].

7.3.4. Genetic Engineering and Genome Editing

Genetic engineering techniques involve various innovative approaches that can complement conventional breeding in sesame [12]. Genetic transformation of traits would be an ideal opportunity to transfer some functional genes into sesame’s elite cultivars, including capsule shattering resistance. Some successful efforts have been made toward sesame genetic transformation, including target gene insertion and new variety development [142,143,144]. The authors reported up to 42.66% transformation efficiency using the Agrobacterium-mediated transformation technique. Improved transformation efficiency will enhance sesame genetic engineering for precision and speeding breeding. Studies in the transfer of candidate genes conditioning oil quality traits and abiotic stress tolerance into elite sesame cultivars are in progress at the Oil Crops Research Institute of the Chinese Academy of Agricultural Sciences (OCRI-CAAS), China [45]. The first study on the functional analysis in transgenic sesame for tolerance to drought, salinity, oxidative stresses, and the charcoal rot pathogen was reported by Chowdhury et al. [132].

Genome editing, also known as targeted gene modification, is a technique for generating new allelic variants in the genomes, including crop plants [145]. The clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing systems, such as CRISPR/Cas9, CRISPR/Cpf1, base-editing system, and prime editing system, have brought promise for genetic improvement programs of crop plants, including sesame [146]. CRISPR-based genome editing technology can alter single or multiple target genes, including polyploid oil crops such as canola/rapeseed (Brassica napus L., 2n = 4× = 38, AACC). CRISPR-based genome editing has led to the development of stably inherited knockout mutants of canola [147]. The CRISPR technology has shown promise in oil crop genetic improvement, including canola/rapeseed and groundnut crops [148]. Nevertheless, there are limited reports on CRISPR-based genome editing technology in sesame and sunflower owing to their unique genomes and recalcitrance to genetic transformation [148].

8. Waterlogging and Drought Tolerance

Sesame is highly susceptible to waterlogging, which is high soil water saturation. Waterlogging stress reduces plant height, leaf axil development, biomass production, net photosynthesis and seed yield [42,43]. Wang et al. [149] reported some 13,307 differentially expressed genes (DEGs) in sesame under waterlogging stress conditions. Of these genes, 1379 were functional for waterlogging resistance [124]. Additionally, 66 candidate genes were reported encoding improved waterlogging tolerance in sesame. The QTLs qEZ09ZCL13, qWH09CHL15, qEZ10ZCL07, qWH10ZCL09, qEZ10CHL07, and qWH10CHL09 and the SSR marker ZM428 were identified to be effective for marker-assisted selection for waterlogging tolerance [129].

Sesame is relatively a drought-tolerant crop thriving under water-limited agro-ecologies where most crops could fail [150]. Drought stress is the main yield-limiting constraint in sesame during the vegetative and flowering growth stages [12,38,39,40]. Currently, limited genomic or proteomic studies have been reported regarding drought tolerance in sesame. Dossa et al. [131] reported 75 candidate genes enriched in transcription factors (TFs) in the sesame conditioning drought tolerance. The authors subsequently isolated two significant TF families (AP2/ERF and HSF) [30,151] responsible for drought tolerance. The relatively high number of drought tolerance genes reported in the early sesame studies showed this trait’s genetic complexity for conventional breeding. In RNA-seq analysis, 722 genes were found to be the main focal genes involved in drought responses, while 61 candidate genes were important for greater drought tolerance in sesame [152]. Transgenic sesame plants with the Osmotin-like gene (SindOLP) had increased tolerance to drought, salinity, and charcoal rot disease [132].

9. Insect Pest Resistance in Sesame

Field insect pests cause a yield loss of 25% in sesame [30]. The major insect pests of sesame are webworm (Antigastra catalaunalis), gall midge (Asphondylia sesame), and seed bug (Elasmolomus sordidus) [31]. The seed bug causes up to 50% yield loss in storage [32]. Webworm causes leaf webbing, as well as capsule and seed damage [31]. Simoglou et al. [153] reported more than 50% yield loss due to webworm damage and premature opening of the infested capsules. Most released sesame varieties are susceptible to the major diseases caused by bacteria (e.g., blight caused by Xanthomonas campestris pv. sesame), fungi (e.g., charcoal rot caused by Macrophomina phaseolina, stem anthracnose (Colletotrichum spp.), and mildew (Erysiphe cichoracearum)), and viruses (e.g., phyllody and Orosius albicinctus) [12]. Phyllody causes a yield loss of 34% to 100% [154,155]. Phyllody has been reported in several countries, including Burkina Faso, Ethiopia, India [155,156], Iraq, Israel, Mexico, Myanmar [157], Nigeria, Oman, Pakistan, Sudan, Taiwan [158], Tanzania, Thailand, Turkey [159], Venezuela, and Uganda [160]. Crop management systems reportedly reduce field insect pests of sesame. For instance, intercropping sesame with legumes and cereals reduced the damage caused by webworms [161]. Sesame is widely intercropped with sorghum, maize, and groundnut in Ethiopia [17], as well as with sorghum and millet in Senegal and Mali [24], for multiple benefits.

10. Market-Driven Breeding in Sesame

The success of a crop breeding program is measured by the adoption rate of the new varieties by farmers and their markets. Farmers are the main actors in agriculture enterprises, with a wealth of indigenous knowledge about their crops, farming systems, and production constraints and they have their own coping mechanism and means to adopt a technology [162]. Plant breeders are required to incorporate the knowledge and opinions of farmers in the planning and management of their breeding programs [163]. Several socioeconomic studies were conducted on sesame to document the production opportunities and constraints, as well as farmer- and market-preferred varieties and traits, as a guide for large-scale production and breeding. Dossa et al. [24] in Senegal and Mali examined the socioeconomic aspects of sesame to guide production, research, and policies. The authors identified a lack of marketing, a decline in soil fertility, limited access to land, drought stress, backward agricultural implements, a lack of extension services, and limited access to agricultural inputs as the essential constraints on sesame production in both countries. In Myanmar, the use of low-yielding varieties, insect pests, post-harvest loss, drought, and salinity stresses were regarded as the overriding sesame production constraints [12]. A recent participatory rural appraisal study conducted in Ethiopia identified lack of access to improved seeds, low yield, diseases, low market price, insect pests, lack of market information, and high cost of improved seed as the most important production constraints to sesame [17]. White seed color, increased seed size, true-to-type seed, high oil content, and increased 1000-seed weight are identified as the most critical sesame market-preferred traits in Ethiopia [17].

11. Conclusion and Outlook

Breeding gains for sesame seed oil yields and fatty acid composition are relatively low due to the limited research and development support compared with other traditional oilseed crops. A limited number of improved sesame varieties with high yields, oil quantity and quality, early maturity, and resistance to diseases and insect pests have been developed and released globally. Sesame improvement has primarily focused on conventional breeding through germplasm characterization, selection, and variety recommendation. More importantly, a number of functional genes, QTLs, and molecular markers associated with these traits are now available and can be employed in sesame breeding programs. There is need to develop new-generation, climate-smart, abiotic and biotic stress-resistant, capsule shattering-resistant sesame varieties that meet the quality requirements of the local and international markets. Therefore, current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, machine harvesting, and other industrially essential attributes for multiple utilities. This can be achieved by integrating the conventional and mutation breeding methods and genomic techniques such as molecular breeding, genomic-assisted breeding, and genome editing. Additionally, there is a need for vibrant public and private sector sesame breeding programs and seed industries. Genetic and advanced genomic resources, as well as increased investment for research and development by public and private sectors, will enhance the dissemination and adoption of improved production technologies for sustainable production and economic gains from sesame enterprises.

Author Contributions

D.H.T., conceptualization, study design, and writing—original draft; H.S., supervision, conceptualization, study design, and writing—review and editing; S.A., writing—review and editing. All authors have read and agreed to the published version of the manuscript.

 Data Availability Statement

Not applicable.

 Acknowledgments

The Agricultural Transformation Institute (ATI) of Ethiopia is thanked for the PhD study support to the first author.

 Conflicts of Interest

The authors declare no conflict of interest.

Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Figure and Tables
View Image - Figure 1. Total sesame production (million tons) and seed yield (tons ha−1) from 2011 to 2020 globally (adapted from FAOSTAT [13]).Enlarge this image.

Figure 1. Total sesame production (million tons) and seed yield (tons ha−1) from 2011 to 2020 globally (adapted from FAOSTAT [13]).

Regions of global sesame production in 2020.

Region/Continent Area(× 103 ha) Production(× 103 tons) % of WorldProduction Average Yield(tons·ha−1)
Africa 9692.17 4282.99 59.05 0.54
Asia 4064.40 2645.23 36.47 1.13
Latin America 462.37 306.37 4.22 0.71
Europe 25.56 18.69 0.26 0.88
Australia NA NA NA NA
World 14,244.50 7253.28 NA 0.79

Source: FAOSTAT [13]; NA = data not available.

The top 10 sesame-producing countries in 2020 with the total area, production, and yield globally.

Country Area(× 103 ha) Production(× 103 tons) % of WorldProduction Yield(tons·ha−1)
Sudan 5173.52 1525.10 21.02 0.29
China 554.97 896.63 12.36 1.62
Myanmar 1500.00 740.00 10.20 0.49
The United Republic of Tanzania 960.00 710.00 9.78 0.74
India 1520.00 658.00 9.07 0.43
Nigerian 621.41 490.00 6.76 0.79
Burkina Faso 450.00 270.00 3.72 0.60
Ethiopia 369.90 260.26 3.59 0.70
Chad 392.24 202.07 2.79 0.52
South Sudan 608.16 189.72 2.61 0.31
World 14,244.50 7253.28 NA 0.79

Source: FAOSTAT [13]; NA = data not available.

Modern sesame varieties reported globally with desirable agronomic and seed oil traits.

Variety Pedigree Trait Country Year of Release References
Sin-Yadana 4 - Good export quality China 1994 [12]
Ju-Ni-Poke - Stable yield and high oil content Myanmar 1994 [12]
Me-Daw-Let-The - Stable yield and high oil content 1994
Gwa-Taya - Stable yield 1994
Gwa-Kyaw-Net - Stable yield 1994
Humera-1 ACC.038 sel.1 Early maturity, better yield and broad adaptability Ethiopia 2010 [17]
Setit-1 Col sel p#1 Early maturity, better yield and oil content and broad adaptability 2010
Dangur E.W.013.(8) High oil content Ethiopia 2015 [49]
BaHaNecho W-109/WSS/(Acc-EW-012(5) Better yield and oil content 2016
BaHaZeyit W- 119/WSM/(Acc-EW-023(1) Better yield and oil content 2016
Setit-2 J-03 Early maturity, better yield, and broad adaptability 2016
Setit-3 HuARC-4 Early maturity, better yield and oil content, and broad adaptability 2017
Waliin BG-004-1 Better yield and oil content 2017
Gida Ayana Ass-acc-29 Late maturity, better yield and oil content, and broad adaptability 2018
Hagalo EW002 × Obsa22-1 Late maturity, better yield, resistance to bacterial blight, and broad adaptability 2019
Yale EW002 × Dicho 5-3 Late maturity, better yield and oil content, resistance to bacterial blight, and broad adaptability 2019
RAMA ‘Khosla’ local Medium seed size and brown seed color India 1989 [53]
OSC-593 - White seed color 1995
TKG-352 - White seed color 1995
TMV 1 - Erect, fairly bushy with moderate branching, 4-loculed, red brown to black seeds, and better oil content 1939 [54]
TMV 2 Nagpur white × Sattur Open, moderate branching, 6–8-loculed, cylindrical big sized capsules, and dark brown to black seedsSuitable for cold weather conditions and better oil content 1942
TMV 3 South Arcot variety × Malabar Variety Bushy with profuse branching, 4-loculed, dark brown to black seeds, and better oil content 1943
KRR 1 - Bushy with profuse branching, 4-loculed, brown seeds, and better oil content 1967
KRR 2 Karur local × Bombay white Bushy with profuse branching, 4-loculed, better oil content, and white seeds 1970
TMV 4 - Bushy with profuse branching, 4-loculed, brown seeds, and better oil content 1977
TMV 5 - Erect with moderate branching, 4-loculed, brown seeds, and better oil content 1978
TMV 6 - Erect with moderate branching, 4-loculed, brown seeds, and better oil content 1980
CO 1 (TMV 3 × Si 1878) × Si 1878 Bushy plant, 4-loculed, black warty seeds, and better oil content 1983
Paiyur 1 Si2511 × Si 2314 Resistance to powdery mildew, 4-loculed, bushy, suitable for irrigated condition, black seeds, and better oil content 1990
SVPR 1 - White seeds, 4-loculed, high yield, suitable for irrigated conditions, and better oil content 1992
VRI 1 - Early maturity, 4-loculed, and better oil content 1995
VRISV2 US9003 × TMV6 Moderate resistance to shoot webber, 4-loculed, and higher oil content 2005
TMV (Sv) 7 High yield, 4-loculed, tolerance to root rot disease, lustrous brown testa, and higher oil content 2009
VRI 3 SVPR 1 × TKG 87 Moderate resistance to phyllody and root rot diseases, white seed, and higher oil content 2017

MoA = Minstry of Agriculture; - = data not available.

The major sesame gene banks globally.

Country Institution Total Number of Accessions Website Reference
India National Bureau of Plant Genetic Resources 10,359 www.nbpgr.ernet.in (accessed on 5 December 2021) [55]
China Oil Crops Research Institute >8000 http://www.sesame-bioinfo.org/phenotype/index.html (accessed on 5 December 2021) [56]
South Korea National Agrobiodiversity Center, Rural Development Administration 7698 http://www.rda.go.kr/foreign/ten/ (accessed on 5 December 2021) [57]
United States of America USDA-ARS-PGRU 1226 www.ars.usda.gov (accessed on 5 December 2021) [58]

USDA-ARS-PGRU = United States Department of Agriculture—Agricultural Research Service—Plant Genetic Resource Unit.

Some sesame varieties developed through induced mutation with traits descriptions.

Variety Name Trait Country Year of Release Reference
NIAB-Pearl Higher capsules per plant Pakistan 2017 [88]
NIAB-Sesame 2016 High oil content 2016
Binatil-3 High yield Bangladesh 2013 [88]
Cairo white 8 Nonbranching Egypt 1992 [87]
Senai white 48 Seed color 1992
Kalika Short stature India 1980 [87]
UMA Uniform maturity 1990
USHA Higher yield 1990
Babil Earliness Iraq 1992 [87]
Rafiden Earliness 1992
Eshtar Capsule size 1992
Ahnsan Disease resistance South Korea 1985 [87]
Suweon Lodging and disease resistance 1991
Yangbaek Higher oil content 1995
Pungsan Determinate growth habit and high seed retention 1996
Seodun Higher oleic acid content and phytophthora blight tolerance 1997
ANK-2 Disease resistance Sri Lanka 1995 [87]

MVD = Mutant Variety Database.

Online genomic resources for sesame.

Database Website Utility Reference
Sinbase http://www.ocri-genomics.org/Sinbase/index.html. (accessed on 9 August 2022) Genomics, comparative genomics, genetics, phenotypes, etc. [94]
SesameHapMap http://202.127.18.228/SesameHapMap/ (accessed on 9 August 2022) Genome-wide SNP [61]
SesameFG http://www.ncgr.ac.cn/SesameFG (accessed on 9 August 2022) Genomics, evolution, breeding, comparative genomics, molecular markers, phenotypes, transcriptomics [95]
SisatBase http://www.sesame-bioinfo.org/SisatBase/ (accessed on 9 August 2022) Genome-wide SSR -
The Sesame Genome Project http://www.sesamegenome.org (accessed on 9 August 2022) Genomics [96]
Sesame Germplasm Resource Information Database http://www.sesame-bioinfo.org/phenotype/index.html (accessed on 9 August 2022) Plant phenotype -
NCBI∗ http://www.ncbi.nlm.nih.gov/genome/?term=sesame (accessed on 9 August 2022) Versatile -
ocsESTdb∗ http://www.ocri-genomics.org/ocsESTdb/index.html (accessed on 9 August 2022) Seed expression sequence tags, comparative genomics [97]
PTGBase∗ http://www.ocri-genomics.org/PTGBase/index.html (accessed on 9 August 2022) Tandem duplication, evolution [98]
PMDBase∗ http://www.sesame-bioinfo.org/PMDBase (accessed on 9 August 2022) SSR information [99]

* these databases involve several species including sesame.

Some polymorphic SSR markers developed for genetic analysis in sesame.

Marker Sequence
Primers Forward Primer Sequence Reverse Primer Sequence References
GBssr-sa-05 TCATATATAAAAGGAGCCCAAC GTCATCGCTTCTCTCTTCTTC [46]
GBssr-sa-08 GGAGAAATTTTCAGAGAGAAAAA ATTGCTCTGCCTACAAATAAAA
Sesame-09 CCCAACTCTTCGTCTATCTC TAGAGGTAATTGTGGGGGA
GBssr-sa-33 TTTTCCTGAATGGCATAGTT GCCCAATTTGTCTATCTCCT
GBssr-sa-123 GCAAACACATGCATCCCT GCCCTGATGATAAAGCCA
GBssr-sa-182 CCATTGAAAACTGCACACAA TCCACACACAGAGAGCCC
GBssr-sa-184 TCTTGCAATGGGGATCAG CGAACTATAGATAATCACTTGGAA
SSR-ES-12 GCTGAGGAGTCTTGAAGCAGA CAAAATCCCCCAACTCGATA [53]
SSR-ES-15 TGCAGGAATGAACTCAAGGA ACCTTATTCCCAGCCCACTT
ZM_2 CTTCTTGAAGTTCTGGTGTTG ATTCTTGGAGAAAGAGTGAGG [111]
ZM_3 ATCACCACACACTGACACAG CGTGTCTGAGAATCCAATATC
ZM_6 GGTGTGTTCTCTCTCTCACAC GGGCTGCTCAATAAATGTAG
ZM_7 ATCCTCTGCTCCTAACTTCAT TCTGGTACTATCCTCAAGCAA
ZM_10 ATGCCCATCTCCATATACTCT AATTCTTGCCTGACTCTACG
ZM_11 GGATTCTCTAGACATGGCTTT AACGCAGAATTCTCTCCTACT
ZM_12 ATTGCTGTGCAATCCTTATC ATCTCTTTCTACCACCACGTT
ZM_13 GCAGAAGGCAATAAAGTCAT G GCGTCAGAAGAAAAATACTG
ZM_14 GGAAGGCGAGTTGATAGATAA CATGGGATGTTCAAAGAACT
ZM_17 CTTGCTTCCTCTTTTCTCTCT ACACTGTACTCAGCGGATTT
ZM_18 AATACCCTTCAGTATTCAGGTG CAACAACACAAACACTGCTAC
ZM_20 GGGATGTTGATAGAGATGTTG TCTTTCACTCTCACACACACA
ZM_21 CTCTCTCTCTCTGCTGTTTCA GCCATACGATCTCAAAATCAC
ZM_22 ACCACCGATCTACTCACTTTT CCACTGCACACTACAGTTTTT
ZM_30 CACTCCACTCATTATCCAAAG CAAGACACAACTGACACGTAA
ZM_34 AAGTCCCTTTTCAAGCAATC GAGAGAGGAAAATGCAGAGAG
ZM_39 AGAGGCAGAGGAGTTGATAAT CTTAACTGTAACTCCCTTTTCG
ZM_40 CGAAAAGGGAGTTACAGTTAAG CTTCCTCTCCTATCATCCTGT
ZM_44 GTCTTAAGCCCTCTTAGTTCC GAAAACCTTCAATGTCAGGA
ZM_45 GCAAAATCTCTGTTGTCTCAG GTGTTCCTACCACTCAACACA
ZM_47 GTTTCCAGGTCTATTCCTTTG AGGTAGAGCTAATCCTTACCG

Quantitative trait loci (QTLs) and associated phenotypic traits in sesame.

Traits Name of QTL Markers Type Marker Code/Number Mapping Population Reference
Production Enhancement
Grain yield Qgn-1, Qgn-6, SLAF 9378 150 BC1 [96,122,123]
Number of seeds per capsule Qgn-12
1000-seed weight Qtgw-11
Seed coat color QTL-1, QTL11-1, QTL11-2, QTL13-1
Seed coat color qSCa-8.2, qSCb-4.1, qSCb-8.1,qSCb-11.1, qSCl-4.1, qSCl-8.1, qSCl-11.1, qSCa-4.1 and qSCa-8.1 SLAFSNP 1233 107 F2 430 recombinant inbred lines (RILS, F8) -
Seed coat color SiPPO (SIN_1016759) SSR 400 500 RILs (F6) [35]
Plant height Qph-6 and Qph-12 SNP 1,800,000 705 worldwide accessions [61]
Semi-dwarf plant phenotype QTL (qPH-3.3), Gene SiGA20ox1 (SIN_1002659) SNPSSR 400 430 RILS (F8)500 RILs (F6) [35,124]
Plant height SiDFL1 (SIN_1014512) andSiILR1 (SIN_1018135) SNP 1,800,000 705 worldwide accessions [61]
Number of capsules per plant Qcn-11 SNP SSR InDels 119022 18 224 (RIL), F8:9 [125]
First capsule height Qfch-4, Qfch-11, and Qfch-12
Capsule axis length Qcal-5 and Qcal-9
Capsule length Qcl-3, Qcl-4, Qcl-7, Qcl-8, and Qcl-12
Number of capsules per axil SiACS (SIN_1006338) SNP 1,800,000 705 worldwide accessions [61]
Mono flower vs. triple flower SiFA SLAF (Marker58311, Marker34507, Marker36337) 9378 150 BC1 [123]
Flowering time SiDOG1 (SIN_1022538) and SiIAA14 SNP - 705 sesame accessions [61]
Determinate growth habit Gene SiDt (DS899s00170.023) NP 30,193 120 F2 [126]
Branching habit SiBH SLAF (Marker129539, Marker41538, Marker31462) 9378 150 BC1 [126]
Recessive GMS Recessive GMS geneSiMs1 AFLP markers P01MC08, P06MG04, P12EA14 - 237 NILs (near-isogenic lines) [127]
Dominant GMS SBM298 and GB50 SSR 1500 Noval GMS line W1098A (backcrossing and sib-mating); BC2F6 [128]
Stress-Related
Waterlogging tolerance qEZ09ZCL13, qWH09CHL15, qEZ10ZCL07, qWH10ZCL09, qEZ10CHL07, and qWH10CHL09 SSR (ZM428) closely linked toqWH10CHL09 113 206 RIL F6 [122,129]
Drought tolerance TF (transcription factor) families (AP2/ERF and HSF) - - - [130,131]
Tolerance to drought, salinity, oxidative stresses, and charcoal rot Osmotin-like gene (SindOLP) - - - [132]
Gene for Oil Traits
Sesamin production SiDIR (SIN_1015471), SiPSS (SIN_1025734) SNP 1,800,000 705 worldwide accessions [61]
Oil content SIN_1003248, SIN_1013005, SIN_1019167, SIN_1009923 SiPPO (SIN_1016759) SiNST1 (SIN_1005755)
Fatty acid composition SiKASI (SIN_1001803), SiKASII (SIN_1024652), SiACNA (SIN_1005440), SiDGAT2 (SIN_1019256), SiFATA (SIN_1024296), SiFATB (SIN_1022133), SiSAD (SIN_1008977), SiFAD2 (SIN_1009785)
Sesamin and sesamolin content SiNST1 (SIN_1005755)
Protein content SiPPO (SIN_1016759)

SLAF: specific length amplified fragment sequencing; SNP: single-nucleotide polymorphism; SSR: simple sequence repeat; AFLP: amplified fragment length polymorphism; Indels: insertions–deletions; GMS: genetic male sterility.

References

1. Ashri, A. Sesame breeding. Plant Breeding Reviews; Janick, J. John Wiley: Oxford, UK, 2010; Volume 16.

2. Bedigian, D.; Harlan, J. Evidence for cultivation of sesame in the ancient world. Econ. Bot.; 1986; 40, pp. 137-154. [DOI: https://dx.doi.org/10.1007/BF02859136]

3. De la Vega, A.J.; Hall, A.J. Effect of planting date, genotype, and their interactions on sunflower yield: II. Components of oil yield. Crop Sci.; 2002; 42, pp. 1202-1210. [DOI: https://dx.doi.org/10.2135/cropsci2002.1202]

4. Zheljazkov, V.D.; Vick, B.A.; Ebelhar, M.W.; Buehring, N.; Baldwin, B.S.; Astatkie, T.; Mille, J.F. Yield, oil content, and composition of sunflower grown at multiple locations in Mississippi. Agron. J.; 2008; 100, pp. 635-639. [DOI: https://dx.doi.org/10.2134/agronj2007.0253]

5. Wei, W.; Zhang, Y.; Lv, H.; Li, D.; Wang, L.; Zhang, X. Association analysis for quality traits in a diverse panel of Chinese sesame (Sesamum indicum L.) germplasm. J. Integr. Plant Biol.; 2013; 55, pp. 745-758. [DOI: https://dx.doi.org/10.1111/jipb.12049] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23570323]

6. Dossa, K.; Wei, X.; Niang, M.; Liu, P.; Zhang, Y.; Wang, L.; Liao, B.; Cissé, N.; Zhang, X.; Diouf, D. Near-infrared reflectance spectroscopy reveals wide variation in major components of sesame seeds from Africa and Asia. Crop J.; 2018; 6, pp. 202-206. [DOI: https://dx.doi.org/10.1016/j.cj.2017.10.003]

7. Gulluoglu, L.; Arioglu, H.; Bakal, H.; Onat, B.; Kurt, C. The Effect of Harvesting on Some Agronomic and Quality Characteristics of Peanut Grown in the Mediterranean Region of Turkey. Turk. J. Field Crop; 2016; 21, pp. 224-232. [DOI: https://dx.doi.org/10.17557/tjfc.20186]

8. Were, B.A.; Onkware, A.O.; Gudu, S.; Welander, M.; Carlsson, A.S. Seed oil content and fatty acid composition in East African sesame (Sesamum indicum L.) accessions evaluated over 3 years. Field Crops Res.; 2006; 97, pp. 254-260. [DOI: https://dx.doi.org/10.1016/j.fcr.2005.10.009]

9. Anastasi, U.; Sortino, O.; Tuttobene, R. Agronomic performance and grain quality of sesame (Sesamum indicum L.) landraces and improved varieties grown in a Mediterranean environment. Genet. Resour. Crop Evol.; 2017; 64, pp. 127-137.

10. Yen, G.C. Influence of seed roasting process on the changes in composition and quality of sesame (Sesame indicum L.) oil. J. Sci. Food Agric.; 1990; 50, pp. 563-570. [DOI: https://dx.doi.org/10.1002/jsfa.2740500413]

11. Yol, E.; Toker, R.; Golukcu, M.; Uzun, B. Oil Content and fatty acid Characteristics in mediterranean sesame core collection. Crop Sci.; 2015; 55, pp. 2177-2185. [DOI: https://dx.doi.org/10.2135/cropsci2014.11.0771]

12. Myint, D.; Gilani, S.A.; Kawase, M.; Watanabe, K.N. Sustainable Sesame (Sesamum indicum L.) Production through Improved Technology: An Overview of Production, Challenges, and Opportunities in Myanmar. Sustainability; 2020; 12, 3515. [DOI: https://dx.doi.org/10.3390/su12093515]

13. FAOSTAT. The Food and Agriculture Organization Corporate Statistical Database (FAOSTAT), Rome, Italy. 2020; Available online: http://www.fao.org/faostat/en/#data/QC (accessed on 16 March 2022).

14. Morris, J.B. Food, industrial, nutraceutical, and pharmaceutical uses of sesame genetic resources. Trends in News Crops and New Uses; Janick, J.; Whipkey, A. ASHS Press: Alexandria, Egypt, 2002; pp. 153-156.

15. Abdellatef, E.; Sirelkhatem, R.; Ahmed, M.M.; Radwan, K.H.; Khalafalla, M.M. Study of genetic diversity in Sudanese sesame (Sesamum indicum L.) germplasm using random amplified polymorphic DNA (RAPD) markers. Afr. J. Biotechnol.; 2008; 24, pp. 4423-4427.

16. Uzun, B.; Çagirgan, M.I. Identification of molecular markers linked to determinate growth habit in sesame. Euphytica; 2009; 166, pp. 379-384. [DOI: https://dx.doi.org/10.1007/s10681-008-9818-y]

17. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Abady, S. Appraisal of the sesame production opportunities and constraints, and farmer-preferred varieties and traits, in Eastern and Southwestern Ethiopia. Sustainability; 2021; 13, 11202. [DOI: https://dx.doi.org/10.3390/su132011202]

18. Langham, D.R.; Wiemers, T. Progress in mechanizing sesame in the US through breeding. Trends in New Crops and New Uses; Janick, J.; Whipkey, A. ASHS Press: Alexandria, Egypt, 2002; pp. 157-173.

19. Khidir, M.O. Natural cross-fertilization in sesame under Sundan conditions. Exp. Agric.; 1972; 8, pp. 55-59. [DOI: https://dx.doi.org/10.1017/S0014479700023498]

20. Bedigian, D. Origin, diversity, exploration and collection of sesame. Sesame: Status and Improvement. Proceedings of the Expert Consultation, Rome, Italy, 8–12 December 1980; FAO Plant Production and Protection Paper: Rome, Italy, 1981; Volume 29, pp. 164-169.

21. Seegeler, C.J. Oil Seeds in Ethiopia: Their Taxonomy and Agricultural Significance; Centre for Agricultural Publication and Documentation: Wageningen, The Netherlands, 1983.

22. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Mashilo, J.; Zhang, X.; Zhang, Y.; Dossa, K.; Shayanowako, A.I.T. Genetic variability and population structure of Ethiopian sesame (Sesamum indicum L.) germplasm assessed through phenotypic traits and simple sequence repeats markers. Plants; 2021; 10, 1129. [DOI: https://dx.doi.org/10.3390/plants10061129]

23. Were, B.A.; Lee, M.; Stymne, S. Variation in seed oil content and fatty acid composition of Sesamum indicum L. and its wild relatives in Kenya. Swed. Seed Assoc.; 2001; 4, pp. 178-183.

24. Dossa, K.; Konteye, M.; Niang, M.; Doumbia, Y.; Cissé, N. Enhancing sesame production in West Africa’s Sahel: A comprehensive insight into the cultivation of this untapped crop in Senegal and Mali. Agric. Food Secur.; 2017; 6, 68. [DOI: https://dx.doi.org/10.1186/s40066-017-0143-3]

25. Nyongesa, B.O.; Were, B.A.; Gudu, S.; Dangasuk, O.G.; Onkware, A.O. Genetic diversity in cultivated sesame (Sesamum indicum L.) and related wild species in East Africa. J. Crop Sci. Biotechnol.; 2013; 16, pp. 9-15. [DOI: https://dx.doi.org/10.1007/s12892-012-0114-y]

26. Woldesenbet, D.T.; Tesfaye, K.; Bekele, E. Genetic diversity of sesame germplasm collection (Sesamum indicum L.): Implication for conservation, improvement and use. Int. J. Biotechnol. Mol. Biol. Res.; 2015; 6, pp. 7-18.

27. Anyanga, W.O.; Hohl, K.H.; Burg, A.; Gaubitzer, S.; Rubaihayo, P.R.; Vollmann, J.; Gibson, P.T.; Fluch, S.; Sehr, E.M. Genetic variability and population structure of global collection of sesame (Sesamum indicum L.) germplasm assessed through phenotypic traits and simple sequence repeats markers for Uganda. J. Agric. Sci.; 2017; 9, pp. 13-14.

28. Tripathy, S.K.; Kar, J.; Sahu, D. Advances in Sesame (Sesamum indicum L.) Breeding. Advances in Plant Breeding Strategies: Industrial and Food Crops; Al-Khayri, J.M.; Jain, S.M.; Johnson, D.V. Springer: Cham, Switzerland, 2019; pp. 577-635.

29. Yol, E.; Uzun, B. Inheritance of indehiscent capsule character, heritability and genetic advance analyses in the segregation generations of dehiscent x indehiscent capsules in sesame. Tarim Bilim. Derg.; 2019; 25, pp. 79-85. [DOI: https://dx.doi.org/10.15832/ankutbd.539005]

30. Weiss, E.A. Sesame. Oilseed Crops; 2nd ed. Blackwell Science: London, UK, 2000.

31. Gebregergis, Z.; Dereje, A.; Fitwy, I. Assessment of incidence of sesame webworm (Antigastra catalaunalis (Duponchel)) in Western Tigray, North Ethiopia. J. Agric. Ecol. Res. Int.; 2016; 9, pp. 1-9. [DOI: https://dx.doi.org/10.9734/JAERI/2016/28483]

32. Ministry of Agriculture (MoA). Crop extension Package and Manual; MOA: Addis Ababa, Ethiopia, 2018; pp. 126-132.

33. Thiyagu, K.; Kandasamy, G.; Manivannan, N.; Muralidharan, V.; Manoranjitham, S.K. Identification of resistant genotypes to root rot disease (Macrophomina phaseolina) of sesame (Sesamum indicum L). Agric. Sci. Digest.; 2007; 27, pp. 34-37.

34. Li, D.; Wang, L.; Zhang, Y.; Lv, H.; Qi, X.; Wei, W.; Zhang, X. Pathogenic variation and molecular characterization of Fusarium species isolated from wilted sesame in China. Afr. J. Microbiol. Res.; 2012; 6, pp. 149-154. [DOI: https://dx.doi.org/10.5897/AJMR11.1081]

35. Wei, X.; Zhu, X.; Yu, J.; Wang, L.; Zhang, Y.; Li, D. Identification of sesame genomic variations from genome comparison of landrace and variety. Front. Plant Sci.; 2016; 7, 1169. [DOI: https://dx.doi.org/10.3389/fpls.2016.01169] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27536315]

36. El-Barougy, E.S. Pathological Studies on Sesame (Sesamum indicum L.) Plant in Egypt. Master’s Thesis; Agriculture and Botany Department, Faculty of Agriculture, Seuz Canal University: Ismailia, Egypt, 1990; 145.

37. El-Shakhess, S.A.M. Inheritance of some economic characters and disease reaction in some sesame (Sesamum indicum L.). Ph. D. Thesis; Agronomy Department, Faculty of Agriculture, Cario University: Cario, Egypt, 1998; 135.

38. Boureima, S.; Oukarroum, A.; Diouf, M.; Cisse, N.; Van Damme, P. Screening for drought tolerance in mutant germplasm of sesame (Sesamum indicum) probing by chlorophyll A inflorescence. Environ. Exp. Bot.; 2012; 81, pp. 37-43. [DOI: https://dx.doi.org/10.1016/j.envexpbot.2012.02.015]

39. Kadkhodaie, A.; Zahedi, M.; Razmjoo, J.; Pessarakli, M. Changes in some anti-oxidative enzymes and physiological indices among sesame genotypes (Sesamum indicum L.) in response to soil water deficits under field conditions. Acta Physiol. Plant; 2014; 36, pp. 641-650. [DOI: https://dx.doi.org/10.1007/s11738-013-1442-3]

40. Aye, M.; Khaing, T.T.; Hom, N.H. Morphological characterization and genetic divergence in myanmar sesame (Sesamum indicum L.) germplasm. Int. J. Curr. Adv. Res.; 2018; 6, pp. 297-307. [DOI: https://dx.doi.org/10.21474/IJAR01/6858]

41. Yousif, H.Y.; Bingham, F.T.; Yermason, D.M. Growth, mineral composition, and seed oil of sesame (Sesamum indicum L.) as affected by NaCl. Soil Sci. Soc. Am. J.; 1972; 36, pp. 450-453. [DOI: https://dx.doi.org/10.2136/sssaj1972.03615995003600030025x]

42. Uçan, K.; Kıllı, F.; Gençoglan, C.; Merdun, H. Effect of irrigation frequency and amount on water use efficiency and yield of sesame (Sesamum indicum L.) under field conditions. Field Crops Res.; 2007; 101, pp. 249-258. [DOI: https://dx.doi.org/10.1016/j.fcr.2006.11.011]

43. Sun, J.; Zhang, X.R.; Zhang, Y.X.; Wang, L.H.; Huang, B. Effects of waterlogging on leaf protective enzyme activities and seed yield of sesame at different growth stages. Chin. J. Appl. Environ.; 2009; 15, pp. 790-795. [DOI: https://dx.doi.org/10.3724/SP.J.1145.2009.00790]

44. Gebretsadik, D.; Haji, J.; Tegegne, B. Sesame post-harvest loss from small-scale producers in Kafta Humera District, Ethiopia. J. Dev. Agric. Econ.; 2019; 11, pp. 33-42.

45. Dossa, K.; Diouf, D.; Cissé, N. Genome-Wide investigation of Hsf genes in Sesame reveals their segmental duplication expansion and their active role in drought stress response. Front. Plant Sci.; 2016; 7, 1522. [DOI: https://dx.doi.org/10.3389/fpls.2016.01522]

46. Dixit, A.; Jin, M.H.; Chung, J.W.; Yu, J.W.; Chung, H.K.; Ma, K.H. Development of polymorphic microsatellite markers in sesame (Sesamum indicum L.). Mol. Ecol. Resour.; 2005; 5, pp. 736-738. [DOI: https://dx.doi.org/10.1111/j.1471-8286.2005.01048.x]

47. Wang, L.; Zhang, Y.; Qi, X.; Gao, Y.; Zhang, X. Development and characterization of 59 polymorphic cDNA-SSR markers for the edible oil crop Sesamum indicum L. (Pedaliaceae). Am. J. Bot.; 2012; 99, pp. 394-398. [DOI: https://dx.doi.org/10.3732/ajb.1200081]

48. Hodgkin, T.; Qingyuan, G.; Xiurong, Z.; Ying-zhong, Z.; Xiang-yun, F.; Gautam, P.L.; Mahajan, R.; Bisht, I.S.; Loknathan, T.R.; Mathur, P.N. et al. Developing sesame core collections in China and India. Core Collections for Today and Tomorrow; International Plant Genetic Resources Institute: Rome, Italy, 1999.

49. Ministry of Agriculture (MoA). Plant variety release. Protection and seed quality control directorate. Crop Variety Register; MoA: Addis Ababa, Ethiopia, 2019; Volume 22, 330.

50. Stamatov, S.; Velcheva, N.; Deshev, M. Introduced sesame accessions as donors of useful qualities for breeding of Introduced sesame accessions as donors of useful qualities for breeding of mechanized harvesting cultivars. Bulg. J. Agric. Sci.; 2018; 24, pp. 820-824.

51. Nyanapah, J.O.; Ayiecho, P.O.; Nyabundi, J.O. Evaluation of sesame cultivars for resistance to Cercospora leaf spot. East Afr. Agric. J.; 1995; 60, pp. 115-121. [DOI: https://dx.doi.org/10.1080/00128325.1995.11663231]

52. Ayiecho, P.O.; Nyabundi, J.O. Yield Improvement of Kenyan Sesame Varieties Using Induced Mutations; 1st year report to IAEA Department of Crop Science, University of Nairobi: Nairobi, Kenya, 1994.

53. Pandey, S.K.; Das, A.; Rai, P.; Dasgupta, T. Morphological and genetic diversity assessment of sesame (Sesamum indicum L.) accessions differing in origin. Physiol. Mol. Biol. Plants.; 2015; 21, pp. 519-529. [DOI: https://dx.doi.org/10.1007/s12298-015-0322-2]

54. Chellamuthu, M.; Subramanian, S.; Swaminathan, M. Genetic potential and possible improvement of Sesamum indicum L. IntechOpen; 2020; 11, pp. 1-18. [DOI: https://dx.doi.org/10.5772/intechopen.94885]

55. NBPGR. National Bureau of Plant Genetic Resources, India. 2021; Available online: www.nbpgr.ernet.in (accessed on 5 December 2021).

56. OCRI. Oil Crops Research Institute, China. 2021; Available online: http://www.sesame-bioinfo.org/phenotype/index.html (accessed on 5 December 2021).

57. NACRDA. National Agrobiodiversity Center, Rural Development Administration, South Korea. 2021; Available online: http://www.rda.go.kr/foreign/ten/ (accessed on 5 December 2021).

58. USDA-ARS-PGRU. United States Department of Agriculture-Agricultural Research Service-Plant Genetic Resource Unit, USA. 2021; Available online: https://www.ars.usda.gov/ (accessed on 5 December 2021).

59. Zhang, Y.; Zhang, X.; Che, Z.; Wang, L.; Wei, W.; Li, D. Genetic diversity assessment of sesame core collection in China by phenotype and molecular markers and extraction of a mini-core collection. BMC Genet.; 2012; 13, 102. [DOI: https://dx.doi.org/10.1186/1471-2156-13-102] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23153260]

60. Park, J.; Suresh, S.; Raveendar, S.; Baek, H.; Kim, C.; Lee, S. Development and evaluation of core collection using qualitative and quantitative trait descriptor in sesame (Sesamum indicum L.) germplasm. Korean J.; 2015; 60, pp. 75-84. [DOI: https://dx.doi.org/10.7740/kjcs.2014.60.1.075]

61. Wei, X.; Liu, K.; Zhang, Y.; Feng, Q.; Wang, L.; Zhao, Y. Genetic discovery for oil production and quality in sesame. Nat. Commun; 2015; 6, 8609. [DOI: https://dx.doi.org/10.1038/ncomms9609]

62. Hodgkin, T.; Brown, A.H.D.; Hintum, T.J.L.V.; Morales, E.A.V. Core Collections of Plant Genetic Resources; A co-publication with the International Plant Genetic Resources Institute (IPGRI) and Sayce publishing: London, UK, 1995.

63. Bisht, I.S.; Mahajan, R.K.; Loknathan, T.R.; Agarwal, R.C. Diversity in Indian sesame collection and stratification of germplasm accessions in different diversity groups. Genet. Resour. Crop Evol.; 1998; 45, pp. 325-335. [DOI: https://dx.doi.org/10.1023/A:1008652420477]

64. Zhang, X.; Zhao, Y.; Cheng, Y.; Feng, X.; Guo, Q.; Zhou, M. Establishment of sesame germplasm core collection in China. Genet. Resour. Crop Evol.; 2000; 47, pp. 273-279. [DOI: https://dx.doi.org/10.1023/A:1008767307675]

65. Dossa, K.; Wei, X.; Zhang, Y.; Fonceka, D.; Yang, W.; Diouf, D. Analysis of genetic diversity and population structure of sesame accessions from Africa and Asia as major centers of its cultivation. Genes; 2016; 7, 14. [DOI: https://dx.doi.org/10.3390/genes7040014]

66. Lopes, M.S.; El-Basyonim, I.; Baenziger, P.S.; Singh, S.; Royo, C.; Ozbek, K.; Aktas, H.; Ozer, E.; Ozdemir, F.; Manickavelu, A. Exploiting genetic diversity from landraces in wheat breeding for adaptation to climate change. J. Exp. Bot.; 2015; 66, pp. 3477-3486. [DOI: https://dx.doi.org/10.1093/jxb/erv122]

67. Pícha, K.; Navrátil, J.; Švec, R. Preference to local food vs. Preference to “national” and regional food. J. Food Prod. Mark.; 2018; 24, pp. 125-145. [DOI: https://dx.doi.org/10.1080/10454446.2016.1266549]

68. Sehr, E.M.; Okello-Anyanga, W.; Hasel-Hohl, K.; Burg, A.; Gaubitzer, S.; Rubaihayo, P.R. Assessment of genetic diversity amongst Ugandan sesame (Sesamum indicum L.) landraces based on agro-morphological traits and genetic markers. J. Crop Sci. Biotechnol.; 2016; 19, pp. 117-129. [DOI: https://dx.doi.org/10.1007/s12892-015-0105-x]

69. Ashri, A. Report on FAO/IAEA. Expert consultation on breeding improved sesame cultivars; Hebrew University: Jerusalem, Israel, 1987.

70. Furat, S.; Uzun, B. The use of agro-morphological characters for the assessment of genetic diversity in sesame (Sesamum indicum L.). Plant Omics; 2010; 3, pp. 85-91.

71. Akbar, F.; Rabbani, M.A.; Shinwari, Z.K.; Khan, S.J. Genetic divergence in sesame (Sesamum Indicum L.) landraces based on qualitative and quantitative traits. Pak. J. Bot.; 2011; 43, pp. 2737-2744.

72. Gidey, Y.T.; Kebede, S.A.; Gashawbeza, G.T. Extent and pattern of the genetic diversity for morpho-agronomic traits in Ethiopian sesame landraces (Sesamum indicum L.). Asian J. Agric. Res.; 2012; 6, pp. 118-128. [DOI: https://dx.doi.org/10.3923/ajar.2012.118.128]

73. Teklu, D.H.; Kebede, S.A.; Gebremichael, D.E. Assessment of genetic variability, genetic advance, correlation, and path analysis for morphological traits in sesame genotypes. Asian J. Agric. Res.; 2014; 7, pp. 118-128. [DOI: https://dx.doi.org/10.3923/ajar.2014.181.194]

74. Hika, G.; Geleta, N.; Jaleta, Z. Correlation and divergence analysis for phenotypic traits in sesame (Sesamum indicum L.) Genotypes. Sci. Technol. Arts Res. J.; 2014; 3, pp. 1-9. [DOI: https://dx.doi.org/10.4314/star.v3i4.1]

75. Hika, G.; Geleta, N.; Jaleta, Z. Genetic variability, heritability and genetic advance for the phenotypic sesame (Sesamum indicum L.) Populations from Ethiopia. Sci. Technol. Arts Res. J.; 2015; 4, pp. 20-26. [DOI: https://dx.doi.org/10.4314/star.v4i1.3]

76. Abdou, R.I.Y.; Moutari, A.; Ali, B.; Basso, Y.; Djibo, M. Variability study in sesame (Sesamum indicum L.) cultivars based on agro-morphological characters. Int. J. Agric. Fish.; 2015; 6, pp. 237-242.

77. Harfi, M.E.; Jbilou, M.; Hanine, H.; Rizki, H.; Fechtali, M.; Nabloussi, A. Genetic Diversity Assessment of Moroccan Sesame (Sesamum indicum L.) Populations Using Agro-morphological Traits. J. Agric. Sci. Technol.; 2018; 8, pp. 296-305. [DOI: https://dx.doi.org/10.17265/2161-6256/2018.05.005]

78. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Mashilo, J. Genetic diversity and association of yield-related traits in sesame. Plant Breed.; 2021; 40, pp. 331-341. [DOI: https://dx.doi.org/10.1111/pbr.12911]

79. Johnson, M.W.; Robinson, H.F.; Comstock, R.E. Genotypic and phenotypic correlations in soybeans and their implication in selection. Agron. J.; 1955; 47, pp. 477-483. [DOI: https://dx.doi.org/10.2134/agronj1955.00021962004700100008x]

80. Panse, V.G. Genetics of quantitative characters in relation to plant breeding. Indian J. Genet. Plant Br.; 1957; 17, pp. 318-346.

81. Divya, K.; Rani, T.S.; Babu, T.K.; Padmaja, D. Assessment of genetic variability, heritability and genetic gain in advanced mutant breeding lines of sesame (Sesamum indicum L.). Int. J. Curr. Microbiol. Ap.; 2018; 71, pp. 565-1574. [DOI: https://dx.doi.org/10.20546/ijcmas.2018.706.187]

82. Aye, M.; Htwe, N.M. Trait association and path coefficient analysis for yield traits in myanmar sesame (Sesamum indicum L.). Germplasm. J. Exp. Agric. Int.; 2019; 4, pp. 1-10. [DOI: https://dx.doi.org/10.9734/jeai/2019/v41i330402]

83. Abraha, M.; Shimelis, H.; Laing, M.; Assefa, K. Performance of tef [Eragrostis tef (Zucc.) Trotter] genotypes for yield and yield components under drought-stressed and non-stressed conditions. Crop Sci.; 2016; 56, pp. 1799-1806. [DOI: https://dx.doi.org/10.2135/cropsci2015.07.0449]

84. Teklu, D.H.; Shimelis, H.; Tesfaye, A.; Shayanowako, A.I.T. Analyses of genetic diversity and population structure of sesame (Sesamum indicum L.) germplasm collections through seed oil and fatty acid compositions and SSR markers. J. Food Compos. Anal.; 2022; 110, 104545. [DOI: https://dx.doi.org/10.1016/j.jfca.2022.104545]

85. Maluszynski, M.; Ahloowalia, B.S.; Sigurbjornsson, B. Application of in vivo and in vitro mutation techniques for crop improvement. Euphytica; 1995; 85, pp. 303-315. [DOI: https://dx.doi.org/10.1007/BF00023960]

86. Muduli, K.C.; Mishra, R.C. Efficacy of mutagenic treatments in producing useful mutants in finger millet (Eleusine coracana Gaertn.). Indian J. Genet. Plant Breed.; 2007; 67, pp. 232-237.

87. Ashri, A. Induced Mutations in Sesame Breeding. Proceedings of 2nd FAO/IAEA, Co-Ordinated Research Project Organized by the Joint FAO/IAEA Division of Nuclear Techniques in Food and Agriculture. Sesame Improvement by Induced Mutations. IAEA, Vienna, Austria, 1997, 13–20; Available online: https://inis.iaea.org/collection/NCLCollectionStore/_Public/32/007/32007909.pdf (accessed on 9 August 2022).

88. Mutant Variety Database (MVD). The Joint FAO/IAEA Mutant Variety Database. 2022; Available online: https://mvd.iaea.org/ (accessed on 23 March 2022).

89. Lee, J.I.; Choi, B.H. Progress and prospects of sesame breeding in Korea. Sesame and Safflower: Status and Potential; Ashri, A. FAO Plant Production and Protection Paper 66: Rome, Italy, 1985; pp. 137-144.

90. Kang, C.W. Breeding for diseases and shatter resistant high yielding varieties using induced mutations in sesame. Proceedings of the 2nd FAO/IAEA Res. Coord. Mtg, Induced Mutations for Sesame Improvement; IAEA: Vienna, Austria, 1997; pp. 48-57.

91. Pathirana, R. Gamma ray-induced field tolerance to Phytophthora blight in sesame. Plant Breed.; 1992; 108, pp. 314-319. [DOI: https://dx.doi.org/10.1111/j.1439-0523.1992.tb00136.x]

92. Khan, A.W.; Garg, V.; Roorkiwal, M.; Golicz, A.A.; Edwards, D.; Varshney, R.K. Super-Pangenome by integrating the wild side of a species for accelerated crop improvement. Trends Plant Sci.; 2020; 25, pp. 148-158. [DOI: https://dx.doi.org/10.1016/j.tplants.2019.10.012]

93. Yu, J.; Golicz, A.A.; Lu, K.; Dossa, K.; Zhang, Y.; Chen, J.; Wang, L.; You, J.; Fan, D.; Edwards, D. et al. Insight into the evolution and functional characteristics of the pan-genome assembly from sesame landraces and modern cultivars. Plant Biotechnol. J.; 2019; 17, pp. 881-892. [DOI: https://dx.doi.org/10.1111/pbi.13022]

94. Wang, L.; Yu, S.; Tong, C.; Zhao, Y.; Liu, Y.; Song, C. Genome sequencing of the high oil crop sesame. Genome Biol.; 2014; 15, R39. [DOI: https://dx.doi.org/10.1186/gb-2014-15-2-r39]

95. Wei, X.; Gong, H.; Yu, J.; Liu, P.; Wang, L.; Zhang, Y. Sesame FG: An integrated database for the functional genomics of sesame. Sci. Rep.; 2017; 7, 2342. [DOI: https://dx.doi.org/10.1038/s41598-017-02586-3] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28539606]

96. Zhang, Y.; Wang, L.; Xin, H.; Li, D.; Ma, C.; Ding, X.; Hong, W.; Zhang, X. Construction of a high-density genetic map for sesame based on large scale marker development by specific length amplified fragment (SLAF) sequencing. BMC Plant Biol.; 2013; 13, 141. [DOI: https://dx.doi.org/10.1186/1471-2229-13-141] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24060091]

97. Ke, T.; Yu, J.; Dong, C.; Mao, H.; Hua, W.; Liu, S. OcsESTdb: A database of oil crop seed EST sequences for comparative analysis and investigation of a global metabolic network and oil accumulation metabolism. BMC Plant Biol.; 2015; 15, 19. [DOI: https://dx.doi.org/10.1186/s12870-014-0399-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25604238]

98. Yu, J.; Ke, T.; Tehrim, S.; Sun, F.; Liao, B.; Hua, W. PTGBase: An integrated database to study tandem duplicated genes in plants. Database; 2015; 2015, bav017. [DOI: https://dx.doi.org/10.1093/database/bav017] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25797062]

99. Yu, J.; Dossa, K.; Wang, L.; Zhang, Y.; Wei, X.; Liao, B. PMDBase: A database for studying microsatellite DNA and marker development in plants. Nucleic Acids Res.; 2016; 45, pp. D1046-D1053. [DOI: https://dx.doi.org/10.1093/nar/gkw906] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27733507]

100. Jones, N.; Ougham, H.; Thomas, H.; Pasakinskiene, I. Markers and mapping revisited: Finding your gene. New Phytol.; 2009; 183, pp. 935-966. [DOI: https://dx.doi.org/10.1111/j.1469-8137.2009.02933.x]

101. Thomson, M.J.; Septiningsih, E.M.; Suwardjo, F.; Santoso, T.J.; Silitonga, T.S.; McCouch, S.R. Genetic diversity analysis of traditional and improved Indonesian rice (Oryza sativa L.) germplasm using microsatellite markers. Theor. Appl. Genet.; 2007; 114, pp. 559-568. [DOI: https://dx.doi.org/10.1007/s00122-006-0457-1]

102. Laurentin, E.H.; Karlovsky, P. Genetic relationship and diversity in a sesame (Sesamum indicum L.) germplasm collection using amplified fragment length polymorphism (AFLP). BMC Genet.; 2006; 7, 10. [DOI: https://dx.doi.org/10.1186/1471-2156-7-10]

103. Laurentin, H.; Karlovsky, P. AFLP fingerprinting of sesame (Sesamum indicum L.) cultivars: Identification, genetic relationship and comparison of AFLP informativeness parameters. Genet. Resour. Crop Evol.; 2007; 54, pp. 1437-1446. [DOI: https://dx.doi.org/10.1007/s10722-006-9128-y]

104. Bhat, K.V.; Babrekar, P.P.; Lakhanpaul, S. Study of genetic diversity in Indian and exotic sesame (Sesamum indicum L.) germplasm using random amplified polymorphic DNA (RAPD) markers. Euphytica; 1999; 110, pp. 21-33. [DOI: https://dx.doi.org/10.1023/A:1003724732323]

105. Ercan, A.G.; Taskin, M.; Turgut, K. Analysis of genetic diversity in Turkish sesame (Sesamum indicum L.) populations using RAPD markers. Genet. Resour. Crop Evol.; 2004; 51, pp. 599-607. [DOI: https://dx.doi.org/10.1023/B:GRES.0000024651.45623.f2]

106. Kim, D.H.; Zur, G.; Danin-Poleg, Y.; Lee, S.W.; Shim, K.B.; Kang, C.W.; Kashi, Y. Genetic relationships of sesame germplasm collection as revealed by inter-simple sequence repeats. Plant Breed.; 2002; 121, pp. 259-262. [DOI: https://dx.doi.org/10.1046/j.1439-0523.2002.00700.x]

107. Gebremichael, D.E.; Parzies, H.K. Genetic variability among landraces of sesame in Ethiopia. Afr. Crop Sci. J.; 2011; 19, pp. 1-13. [DOI: https://dx.doi.org/10.4314/acsj.v19i1.68656]

108. Wei, X.; Wang, L.; Zhang, Y.; Qi, X.; Wang, X.; Ding, X.; Zhang, J.; Zhang, X. Development of Simple Sequence Repeat (SSR) Markers of Sesame (Sesamum indicum L.) from a Genome Survey. Molecules; 2014; 19, pp. 5150-5162. [DOI: https://dx.doi.org/10.3390/molecules19045150] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24759074]

109. Asekova, S.; Kulkarni, K.P.; Oh, K.W.; Lee, M.H.; Oh, E.; Kim, J.I.; Yeo, U.; Pae, U.S.; Ha, T.J.; Kim, S.U. Analysis of molecular variance and population structure of sesame (Sesamum indicum L.) genotypes using SSR markers. Plant Breed. Biotechnol.; 2018; 6, pp. 321-336. [DOI: https://dx.doi.org/10.9787/PBB.2018.6.4.321]

110. Araújo, E.D.S.; Arriel, N.H.C.; Santos, R.C.D.; Lima, L.M.D. Assessment of genetic variability in sesame accessions using SSR markers and morpho agronomic traits. Aust. J. Crop Sci.; 2019; 13, pp. 45-54. [DOI: https://dx.doi.org/10.21475/ajcs.19.13.01.p1157]

111. Basak, M.; Uzun, B.; Yol, E. Genetic diversity and population structure of the Mediterranean sesame core collection with use of genome-wide SNPs developed by double digest RAD-Seq. PLoS ONE; 2019; 14, e0223757. [DOI: https://dx.doi.org/10.1371/journal.pone.0223757]

112. Tesfaye, T.; Tesfaye, K.; Keneni, G.; Ziyomo, C.; Alemu, T. Genetic diversity of Sesame (Sesamum indicum L.) using high throughput diversity array technology. J. Crop Sci. Biotechnol.; 2022; 25, pp. 359-371. [DOI: https://dx.doi.org/10.1007/s12892-021-00137-x]

113. Wei, W.; Qi, X.; Wang, L.; Zhang, Y.; Hua, W.; Li, D.; Lv, H.; Zhang, X. Characterization of the sesame (Sesamum indicum L.) global transcriptome using Illumina paired-end sequencing and development of EST-SSR markers. BMC Genom.; 2011; 19, pp. 12-451. [DOI: https://dx.doi.org/10.1186/1471-2164-12-451]

114. Frary, A.; Tekin, P.; Celik, I.; Furat, S.; Uzun, B.; Doganlar, S. Morphological and molecular diversity in Turkish sesame germplasm and selection of a core set for inclusion in the national collection. Crop Sci.; 2014; 54, pp. 702-711. [DOI: https://dx.doi.org/10.2135/cropsci2012.12.0710]

115. Pham, T.D.; Geleta, M.; Bui, T.M.; Bui, T.C.; Merker, A.; Carlsson, A.S. Comparative analysis of genetic diversity of sesame (Sesamum indicum L.) from Vietnam and Cambodia using agro-morphological and molecular markers. Hereditas; 2011; 148, pp. 28-35. [DOI: https://dx.doi.org/10.1111/j.1601-5223.2010.02196.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21410468]

116. Tabatabaei, I.; Pazouki, L.; Bihamta, M.R.; Mansoori, S.; Javaran, M.J.; Niinemets, Ü. Genetic variation among Iranian sesame (Sesamum indicum L.) accessions vis-à-vis exotic genotypes on the basis of morpho-physiological traits and RAPD markers. Aust. J. Crop Sci.; 2011; 11, pp. 1396-1407.

117. Uncu, A.O.; Gultekin, V.; Allmer, J.; Frary, A.; Doganlar, S. Genomic simple sequence repeat markers reveal patterns of genetic relatedness and diversity in sesame. Plant Genome.; 2015; 8, pp. 1-12. [DOI: https://dx.doi.org/10.3835/plantgenome2014.11.0087] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33228311]

118. Joshi, A.B. Sesamum; Indian Central Oilseed Committee: Hyderabad, India, 1961.

119. Tiwari, S.; Kumar, S.; Gontia, I. Biotechnological approaches for sesame (Sesamum indicum L.) and Niger (Guizotia abyssinica L.f. Cass.). Asia Pac. J. Mol. Biol. Biotechnol.; 2011; 19, pp. 2-9.

120. Zhang, X.; Zhang, K.; Wu, J.; Guo, N.; Liang, J.; Wang, X. QTL-Seq and sequence assembly rapidly mapped the gene BrMYBL2.1 for the purple trait in Brassica rapa. Sci. Rep.; 2020; 10, 2328. [DOI: https://dx.doi.org/10.1038/s41598-020-58916-5] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32047197]

121. Tanksley, S.D.; Ganal, M.W.; Prince, J.P.; de Vicente, M.C.; Bonierbale, M.W.; Broun, P. High density molecular linkage maps of the tomato and potato genomes. Genetics; 1992; 132, pp. 1141-1160. [DOI: https://dx.doi.org/10.1093/genetics/132.4.1141]

122. Wang, L.; Xia, Q.; Zhang, Y.; Zhu, X.; Zhu, X.; Li, D.; Ni, X.; Gao, Y.; Xiang, H.; Wei, X. et al. Updated sesame genome assembly and fine mapping of plant height and seed coat color QTLs using a new high-density genetic map. BMC Genom.; 2016; 17, 31. [DOI: https://dx.doi.org/10.1186/s12864-015-2316-4]

123. Mei, H.; Liu, Y.; Du, Z.; Wu, K.; Cui, C.; Jiang, X. High-density Genetic map construction and gene Mapping of basal branching habit and flowers per leaf axil in Sesame plant materials and trait investigation. Front. Plant Sci.; 2017; 8, 636. [DOI: https://dx.doi.org/10.3389/fpls.2017.00636]

124. Wang, L.; Li, D.; Zhang, Y.; Gao, Y.; Yu, J.; Wei, X.; Zhang, X. Tolerant and susceptible sesame genotypes reveal waterlogging stress response patterns. PLoS ONE; 2016; 11, e0149912. [DOI: https://dx.doi.org/10.1371/journal.pone.0149912]

125. Wu, K.; Liu, H.; Yang, M.; Tao, Y.; Ma, H.; Wu, W.; Zuo, Y.; Zhao, Y. High-density genetic map construction and QTLs analysis of grain yield-related traits in Sesame (Sesamum indicum L.) based on RAD-Seq technology. BMC Plant Biol.; 2014; 14, pp. 1-14. [DOI: https://dx.doi.org/10.1186/s12870-014-0274-7]

126. Zhang, H.; Miao, H.; Li, C.; Wei, L.; Duan, Y.; Ma, Q.; Kong, J.; Xu, F.; Chang, S. Ultra-dense SNP genetic map construction and identification of SiDt gene controlling the determinate growth habit in Sesamum indicum L. Sci. Rep.; 2016; 6, 31556. [DOI: https://dx.doi.org/10.1038/srep31556] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27527492]

127. Zhao, Y.; Yang, M.; Wu, K.; Liu, H.; Wu, J.; Liu, K. Characterization and genetic mapping of a novel recessive genic male sterile gene in sesame (Sesamum indicum L.). Mol. Breed.; 2013; 32, pp. 901-908. [DOI: https://dx.doi.org/10.1007/s11032-013-9919-8]

128. Li, C.; Miao, H.; Wei, L.; Zhang, T.; Han, X.; Zhang, H. Association Mapping of Seed Oil and Protein Content in Sesamum indicum L. Using SSR Markers. PLoS ONE; 2014; 9, e105757. [DOI: https://dx.doi.org/10.1371/journal.pone.0105757] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25153139]

129. Yan-xin, Z.; Lin-hai, W.; Dong-hua, L.I.; Yuan, G.A.O.; Hai-xia, L.Ü.; Xiu-rong, Z. Mapping of Sesame Waterlogging Tolerance QTL and Identification of Excellent Waterlogging Tolerant Germplasm. Sci. Agric. Sin.; 2014; 47, pp. 422-430.

130. Dossa, K.; Niang, M.; Assogbadjo, A.E.; Cisse, N.; Diouf, D. Whole genome homology-based identification of candidate genes for drought tolerance in sesame (Sesamum indicum L.). Afr. J. Biotechnol.; 2016; 15, pp. 1464-1475.

131. Dossa, K.; Diouf, D.; Wang, L.; Wei, X.; Zhang, Y.; Niang, M.; Fonceka, D.; Yu, J.; Mmadi, M.A.; Yehouessi, L.W. et al. The Emerging Oilseed Crop Sesamum indicum Enters the “Omics” Era. Front. Plant Sci.; 2017; 8, 1154. [DOI: https://dx.doi.org/10.3389/fpls.2017.01154]

132. Chowdhury, S.; Basu, A.; Kundu, S. Overexpression of a new osmotinlike protein gene (SindOLP) confers tolerance against biotic and abiotic stresses in sesame. Front. Plant Sci.; 2017; 8, 410. [DOI: https://dx.doi.org/10.3389/fpls.2017.00410]

133. Davey, J.W.; Hohenlohe, P.A.; Etter, P.D.; Boone, J.Q.; Catchen, J.M.; Blaxter, M.L. Genome-wide genetic marker discovery and genotyping using next-generation sequencing. Nat. Rev. Genet.; 2011; 17, pp. 499-510. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21681211][DOI: https://dx.doi.org/10.1038/nrg3012]

134. Ganal, M.W.; Durstewitz, G.; Polley, A.; Berard, A.; Buckler, E.S.; Charcosset, A.; Clarke, J.D.; Graner, E.M.; Hansen, M.; Joets, J. et al. A large maize (Zea mays L.) SNP genotyping array: Development and germplasm genotyping, and genetic mapping to compare with the B73 reference genome. PLoS ONE; 2011; 6, e28334. [DOI: https://dx.doi.org/10.1371/journal.pone.0028334]

135. Sim, S.C.; Durstewitzm, G.; Plieske, J.; Wieseke, R.; Ganal, M.W.; Deynze, A.V.; Hamilton, J.P.; Buell, C.R.; Causse, M.; Wijeratne, S. et al. Development of a large SNP genotyping array and generation of high-density genetic maps in tomato. PLoS ONE; 2012; 7, e40563.

136. Wang, S.; Chen, J.; Zhang, W.; Hu, Y.; Chang, L.; Fang, L.; Wang, Q.; Lv, F.; Wu, H.; Si, Z. et al. Sequence-based ultra-dense genetic and physical maps reveal structural variations of allopolyploid cotton genomes. Genome Biol.; 2015; 16, 108. [DOI: https://dx.doi.org/10.1186/s13059-015-0678-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26003111]

137. Zhao, X.; Han, Y.; Li, Y.; Liu, D.; Sun, M.; Zhao, Y.; Lv, C.; Li, D.; Yang, Z.; Huang, L. et al. Loci and candidate gene identification for resistance to Sclerotinia sclerotiorum in soybean (Glycine max L. Merr.) via association and linkage maps. Plant J.; 2015; 82, pp. 245-255. [DOI: https://dx.doi.org/10.1111/tpj.12810] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25736370]

138. Zhang, H.; Miao, H.; Wei, L.; Li, C.; Zhao, R.; Wang, C. Genetic analysis and QTL mapping of seed coat color in sesame (Sesamum indicum L.). PLoS ONE; 2013; 8, e63898.

139. Miao, H. The genome of Sesamum indicum L. Proceedings of the Plant and Animal Genome XXII Conference. Plant and Animal Genome; San Diego, CA, USA, 7–13 January 2016.

140. Zhang, H.; Miao, H.; Wei, L.; Li, C.; Duan, Y.; Xu, F.; Qu, W.; Zhao, R.; Ju, M.; Chang, S. Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening. BMC Plant Biol.; 2018; 18, 296. [DOI: https://dx.doi.org/10.1186/s12870-018-1503-2] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30466401]

141. Yol, E.; Uzun, B. Geographical patterns of sesame (Sesamum indicum L.) accessions grown under Mediterranean environmental conditions, and establishment of a core collection. Crop Sci.; 2012; 52, pp. 2206-2214. [DOI: https://dx.doi.org/10.2135/cropsci2011.07.0355]

142. Yadav, M.; Sainger, D.C.M.; Jaiwal, P.K. Agrobacterium tumefaciensmediated genetic transformation of sesame (Sesamum indicum L.). Plant Cell Tissue Organ Cult.; 2010; 103, pp. 377-386. [DOI: https://dx.doi.org/10.1007/s11240-010-9791-8]

143. Al-Shafeay, A.F.; Ibrahim, A.S.; Nesiem, M.R.; Tawfik, M.S. Establishment of regeneration and transformation system in Egyptian sesame (Sesamum indicum L.) cv Sohag1. GM Crops.; 2011; 2, pp. 182-192. [DOI: https://dx.doi.org/10.4161/gmcr.2.3.18378] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22179191]

144. Chowdhury, S.; Basu, A.; Kundu, S. A new high-frequency Agrobacterium-mediated transformation technique for Sesamum indicum L. using de-embryonated cotyledon as explant. Protoplasma; 2014; 251, pp. 1175-1190. [DOI: https://dx.doi.org/10.1007/s00709-014-0625-0]

145. David, V.; Řepková, J. Application of next-generation sequencing in plant breeding. Czech J. Genet. Plant Breed.; 2017; 53, pp. 89-96. [DOI: https://dx.doi.org/10.5897/AJPS2014.1260]

146. Zhu, H.; Li, C.; Gao, C. Applications of CRISPR–Cas in agriculture and plant biotechnology. Nat. Rev. Mol. Cell Biol.; 2020; 21, pp. 661-677. [DOI: https://dx.doi.org/10.1038/s41580-020-00288-9]

147. Zhang, K.; Nie, L.; Cheng, Q.; Yin, Y.; Chen, K.; Qi, F.; Zou, D.; Liu, H.; Zhao, W.; Wang, B. Effective editing for lysophosphatidic acid acyltransferase 2/5 in allotetraploid rapeseed (Brassica napus L.) using CRISPR-Cas9 system. Biotechnol. Biofuels.; 2019; 12, 225. [DOI: https://dx.doi.org/10.1186/s13068-019-1567-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31548867]

148. He, J.; Zhang, K.; Tang, M.; Zhou, W.; Chen, L.; Chen, Z.; Li, m. CRISPR-based genome editing technology and its applications in oil crops. Oil Crop Sci.; 2021; 6, pp. 105-113. [DOI: https://dx.doi.org/10.1016/j.ocsci.2021.07.002]

149. Wang, L.; Zhang, Y.; Qi, X.; Li, D.; Wei, W.; Zhang, X. Global gene expression responses to waterlogging in roots of sesame (Sesamum indicum L.). Acta Physiol. Plant.; 2012; 34, pp. 2241-2249. [DOI: https://dx.doi.org/10.1007/s11738-012-1024-9]

150. Ashri, A. Sesame (Sesamum indium L.). Genetic Resources, Chromosome Engineering, and Crop Improvement; Singh, R.J. CRC Press: Boca Raton, FL, USA, 2007; Volume 4, pp. 231-289.

151. Dossa, K.; Wei, X.; Li, D.; Zhang, Y.; Wang, L.; Fonceka, D.; Zhang, Y.; Wang, L.; Yu, J.; Boshuo, L. et al. Insights into the AP2/ERF transcription factor superfamily in sesame (Sesamum indicum) and expression profiling of the DREB subfamily under drought stress. BMC Plant Biol.; 2016; 16, 171. [DOI: https://dx.doi.org/10.1186/s12870-016-0859-4]

152. Dossa, K.; Li, D.; Wang, L.; Zheng, X.; Yu, J.; Wei, X.; Fonceka, D.; Zhang, Y.; Wang, L.; Yu, J. et al. Dynamic transcriptome landscape of sesame (Sesamum indicum L.) under progressive drought and after rewatering. Genomic Data; 2017; 11, pp. 122-124. [DOI: https://dx.doi.org/10.1016/j.gdata.2017.01.003]

153. Simoglou, K.B.; Anastasiades, A.I.; Baixeras, J.; Roditakis, E. First report of Antigastra catalaunalis on sesame in Greece. Entomol. Hell.; 2017; 26, pp. 6-12. [DOI: https://dx.doi.org/10.12681/eh.14824]

154. Ramanujam, S. The cytogenetics of an amphidiploid Sesamum orientale and S. prostratum. Curr. Sci.; 1944; 13, pp. 40-41.

155. Rao, G.P.; Un, N.S. MadhuPriya. Overview on a century progress in research on sesame phyllody disease. Phytopathogenic Mollicutes; 2015; 5, pp. 74-83. [DOI: https://dx.doi.org/10.5958/2249-4677.2015.00064.X]

156. Rao, G.P.; Kumar, A.; Baranwal, V.K. Classification of sesame phytoplasma strain in India at 16Sr subgroup level. J. Plant Pathol.; 2015; 3, pp. 523-528. [DOI: https://dx.doi.org/10.4454/JPP.V97I3.032]

157. Win, N.K.K.; Back, C.; Jung, H.Y. Phyllody phytoplasma infecting sesame in Myanmar belongs to group 16SrI and subgroup 16SrI-B. Tropical. Plant Pathol.; 2010; 35, pp. 310-313. [DOI: https://dx.doi.org/10.1590/S1982-56762010000500006]

158. Tseng, Y.W.; Deng, W.L.; Chang, C.J.; Huang, J.W.; Jan, F.J. First report on the association of a 16SrII-A phytoplasma with sesame (Sesamum indicum) exhibiting abnormal stem curling and phyllody in Taiwan. Plant Dis.; 2014; 98, 990. [DOI: https://dx.doi.org/10.1094/PDIS-12-13-1212-PDN] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30708865]

159. Catal, M.; Ikten, C.; Yol, E.; Ustun, R.; Uzun, B. First report of a 16SrIX group (pigeon pea witches’-broom) phytoplasma associated with sesame phyllody in Turkey. Plant Dis.; 2013; 97, 835. [DOI: https://dx.doi.org/10.1094/PDIS-11-12-1100-PDN] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30722602]

160. Singh, P.K.; Akram, M.; Vajpeyi, M.; Srivastava, R.L.; Kumar, K.; Naresh, R. Screening and development of resistant sesame varieties against phytoplasma. Bull. Insectol.; 2007; 60, pp. 303-304.

161. Ahirwar, R.M.; Banerjee, S.; Gupta, M.P. Insect pest management in sesame crop by intercropping system. Ann. Plant Sci.; 2009; 17, pp. 225-226.

162. Altieri, M.A.; Koohafkan, P. Enduring Farms: Climate Change, Smallholders and Traditional Farming Communities. Environment and Development Series 6; Third World Network: Pulau Pinang, Malaysia, 2008.

163. Chambers, R. Rapid Appraisal: Rapid, Relaxed and Participatory IDS Discussion Paper; Institute of Development Studies: Brighton, UK, 1992; Volume 311, 90.

Word count: 12936

Show less

© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.

Abstract

Sesame production and productivity are severely constrained by a lack of high-yielding and locally adapted varieties, susceptibility to capsule shattering and low seed retention, biotic and abiotic stresses, and a lack of modern production and pre- and post-harvest technologies. Unimproved landraces are widely cultivated in sub-Saharan Africa, including Ethiopia. The landrace varieties are low yielders (<0.6 tons·ha−1), but they possess intrinsic seed oil quality characteristics, such as unique aroma and taste. Therefore, current and future sesame genetic improvement programs should integrate yield- and quality-promoting traits, local adaptation, amenability to machine harvesting, and other industrially essential food and feed attributes for multiple utilities. This can be achieved by integrating the conventional breeding methods, as well as genetic and genomic techniques such as mutation breeding and genomics-assisted breeding. Therefore, the objective of this review is to document the breeding progress, opportunities, and challenges of sesame with regard to genetic improvement, variety release, and deployment with enhanced seed yield and related agronomic traits, as well as oil content and fatty acid compositions. The review highlights sesame’s economic values, production status, major production constraints, conventional breeding methods, and genomics-assisted breeding, as well as their integration, for accelerated breeding and cultivar development with market-preferred traits.

Details

Title
Genetic Improvement in Sesame (Sesamum indicum L.): Progress and Outlook: A Review
Author
Teklu, Desawi Hdru 1   VIAFID ORCID Logo  ; Hussein Shimelis 2   VIAFID ORCID Logo  ; Abady, Seltene 3 

1  African Centre for Crop Improvement, University of KwaZulu Natal, Private Bag X01, Scottsville, Pietermaritzburg 3209, South Africa; Ethiopian Agricultural Transformation Institute, Addis Ababa P.O. Box 708, Ethiopia 
2  African Centre for Crop Improvement, University of KwaZulu Natal, Private Bag X01, Scottsville, Pietermaritzburg 3209, South Africa 
3  African Centre for Crop Improvement, University of KwaZulu Natal, Private Bag X01, Scottsville, Pietermaritzburg 3209, South Africa; School of Plant Sciences, Haramaya University, Dire Dawa P.O. Box 138, Ethiopia 
First page
2144
Publication year
2022
Publication date
2022
Publisher
MDPI AG
e-ISSN
20734395
Source type
Scholarly Journal
Language of publication
English
DOI
https://doi.org/10.3390/agronomy12092144
ProQuest document ID
2716479604
Copyright
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.