1. Introduction
The common bean (Phaseolus vulgaris L.) is one of the most important legumes for human consumption worldwide and is an important source of vegetable protein, minerals, antioxidants, and bioactive compounds [1,2,3]. Bean common mosaic virus (BCMV) and bean common mosaic necrosis virus (BCMNV) are aphid-transmitted viruses that can also be seed-transmissible in common beans with an efficiency of up to 80%, depending on the bean cultivar and viral strain [4]. An infection by phytopathogens, including plant viruses, can cause significant losses to the common bean in terms of both yield and quality. BCMV and the closely related BCMNV are the most destructive viruses of the common bean, which cause the common bean mosaic disease and the so-called “black root” disease. Since their discovery in 1917, BCMV and BCMNV have been reported in 57 countries and regions and have become two of the most important biological factors affecting common bean production [5,6,7,8,9]. Both BCMV and BCMNV belong to the genus Potyvirus in the family Potyviridae, the largest family of known plant RNA viruses, which are classified into 12 genera (Arepavirus, Bevemovirus, Brambyvirus, Bymovirus, Celavirus, Ipomovirus, Macluravirus, Poacevirus, Potyvirus, Roymovirus, Rymovirus, and Tritimovirus) [10,11,12,13].
Understanding the molecular biology of BCMV and BCMNV and the plant antiviral mechanism is a prerequisite for the development of effective management strategies. Over the last two decades, several advances have been made in this field. For instance, the strain composition of BCMV has been well documented, infectious cDNA has been successfully developed for analyzing the pathogenicity of BCMV, and several resistance genes in the common bean have been successfully identified and utilized in breeding practices [14,15,16,17,18,19,20,21,22,23,24]. In this short review, we summarize the current knowledge on BCMV and BCMNV, including genome organization, strain composition, evolution, and resistance in the common bean. Moreover, we highlight the areas that are particularly worthy of further investigation and the potential methods for developing novel antiviral strategies with broad-spectrum, efficient, sustainable, and environmentally friendly resistance.
2. Biological Characteristics of BCMV
2.1. Genome Structure
Both BCMV and BCMNV have a positive-sense single-stranded RNA (+ssRNA) genome of approximately 9600 nucleotides (nt) that is encapsulated in non-enveloped, flexuous, and filamentous virions of 750 nm long and 11–13 nm in diameter [25,26,27]. The 3′ end of the genome is polyadenylated, whereas the 5′ end is covalently linked to the viral genome-linked protein (VPg) [28]. Similar to other potyviruses, the genomes of BCMV and BCMNV encode a large open reading frame (ORF), which is translated into a polypeptide of approximately 350 kDa [29]. This polypeptide is hydrolyzed by three viral proteinases into ten mature proteins; from the N- to C-termini are protein 1 (P1), a helper component-protease (HC-Pro), protein 3 (P3), 6-kilodalton protein 1 (6K1), a cylindrical inclusion (CI), 6-kilodalton protein 2 (6K2), viral protein genome-linked (VPg), nuclear inclusion a-protease (NIa-Pro), nuclear inclusion b (NIb), and a coat protein (CP) [30]. Additionally, a polymerase slippage motif (GAAAAAA) within the P3 cistron allows the expression of an additional short polypeptide, which is hydrolyzed into three mature proteins, namely P1, HC-Pro, and P3 N-terminal fused with the pretty interesting Potyviridae ORF (P3N-PIPO), which shares the same N-terminal domain as P3, but has a different C-terminal domain [31,32,33,34]. These proteins function similarly to their counterparts in the genus Potyvirus [35]. In addition, precursors such as P1-HcPro, 6K2-VPg, and P3-6K1 also exist in virus-infected cells via partial hydrolysis [36,37]. These precursors may play important roles in virus proliferation [38,39,40,41,42,43,44,45,46,47,48,49,50,51,52,53,54,55,56,57,58,59,60,61]. The cleavage of P1 may play dual roles in viral infectivity [62,63], and HC-Pro has been shown to play a role in virus movement and aphid transmission [64,65], while P3 has been associated with virus replication, systemic infection, and cell-to-cell movement [66,67,68]. Moreover, the 6K2 protein has been shown to play a pivotal role in the formation of the virus replication complex [69,70], Vpg has been shown to bind eukaryotic translation initiation factor 4E(eIF4E) and its isoform eIF(iso)4E and to enhance viral translation in plants [29], and 6K1 binding to the membrane is involved in replication and viral movement between cells [61].
2.2. Transmission
BCMV and BCMNV can be transmitted through seeds, pollen, aphids, and mechanical friction [71,72]. The seed transmission rate of BCMV is between 3% and 95%, depending on the viral strain and host variety [73,74]. The high seed transmission rate is one of the major reasons for the global BCMV epidemic and is the primary virus resource in the field. BCMV is limited to the seed coat of bean varieties with a low transmission rate; however, it can invade the seeds (embryos) of bean varieties with high transmission rates. Generally, BCMV infects seeds via the endosperm [75]. However, it can also infect seeds through pollen. BCMV can survive for more than 30 years in seeds grown under suitable conditions. However, the gene(s) involved in seed transmission and the molecular mechanisms of seed transmission remain elusive [75]. It has been reported that 36 aphids in 21 genera, including Acyrthosiphon pisum, Aphisfabae, Myzus persica, and Aphis craccivoracan, effectively transmit BCMV [76,77,78,79]. Studies have shown that BCMV-infected plants are more attractive to aphids than healthy plants [80], indicating that BCMV may modulate the jasmonic acid pathway to reduce anti-insect defenses to benefit the aphid vector. BCMV can also be transmitted to new plants via mechanical inoculation [80,81]. Pathogen infection can induce changes in plant morphology and traits, such as wrinkled, curled, and yellowed leaves, increased or decreased glandular trichome density, callose deposition, and increased or decreased leaf thickness. These changes may affect the feeding and transfer of vector insects to host plants. Most viruses can cause yellowing or light-green symptoms in the host leaves. Vector insects are more inclined to select yellow and light green plant tissues, which may have been formed by the long-term evolution of virus–host plant-vector insects [82,83,84,85,86]. However, mechanical inoculation may not contribute significantly to the natural spread of BCMV.
2.3. Host Range and Symptoms
Potyviruses collectively exhibit a broad host range; however, the host range of their individual members is usually limited to a few plants. For instance, the host range of the soybean mosaic virus (SMV), a phylogenetically related potyvirus, is restricted to two plant species of a single genus: cultivated soybean (Glycine max) and wild soybean (G. soja) [87]. Interestingly, BCMV has a much wider host range, including over 100 plants in 44 genera, such as the common bean, peanut (Arachis hypogaea Linn.), pigeonpea (Cajanuscajan (Linn.) Millsp), jack bean (Phaseolus lunatus L.), sickle senna (Cassia tora Linn.), chickpea (Cicer arietinum Linn.), showy crotalaria (Crotalaria spectabilis Roth), common lentil (Lens culinaris Medic.), white lupine (Lupinus albus L.), soybean (Glycine max), white sweet clover (Melilotus albus Medic. ex Desr), broad bean (Vicia faba L.), bingdou (Lens culinaris Medic.), and sesame (Sesamum indicum L.). It is one of the most widespread plant viruses infecting legumes under natural conditions, with the common bean being the most affected host [76,88,89,90].
The symptoms induced by BCMV in the common bean include leaf mosaic, chlorosis, deformation and etiolation, plant retardation, local or systematic necrosis, and even whole-plant death [91,92,93,94,95,96]. The symptoms are mainly affected by three factors: host plants, environmental conditions, and viral strains [97,98,99,100] (Figure 1). BCMV can seriously affect the common bean’s yield reduction or even total failure. Even mild or symptomless infections can decrease crop yield by 50% [101]. An infection by the BCMV strains NL2 and NL6 on common bean cultivars carrying the I gene at a high temperature will result in systemic necrosis symptoms that are typically known as “black root” disease. However, all BCMNV strains cause systemic necrosis symptoms in I-gene-containing bean cultivars, regardless of the temperature [91,92,96].
3. Diversity and Evolution of BCMV and BCMNV
3.1. Strain Composition
According to the symptoms of BCMV and BCMNV on eleven bean cultivars (Dubbele Witte (DW), Stringless Green Refugee (SGR), Redland’s Greenleaf “C” (RGLC), Redland’s Greenleaf “B” (RGLB), Sanilac, UI35, IVT-7214, Jubila, Amamda, US1006, and IVT7233), Drifjhout divided BCMV into seven pathotypes, namely I–VII [18,19,91,92,93,94,95]. Recently, Feng discovered a new pathotype, VIII [102]. The symptoms caused by strains of the same pathogenic type may also differ. For example, the BCMV strains 3PF and A1 are both pathogenic type PG I, but 3PF causes mild mosaic on “DW”, while the A1 strain can cause systemic necrosis on “DW”, causing plant death [103,104]. Clearly, not all pathotypes have been characterized, and new pathotypes may be discovered in the future [102,103,104,105].
Historically, BCMV isolates have been divided into two serotypes, serotypes A and B, based on serological reactions [106]. Serotype A includes pathotypes III and VI, which are strains that cause temperature-sensitive necrotic spots on bean plants carrying the I gene, including TN1, NL3, NL5, and NL8, whereas serotype B includes all isolates of other pathotypes, such as CH2, NL1, NL4, NL6, NL7, PR1, RU1, and US1-US10. Subsequent high-performance liquid chromatography (HPLC) and gene sequence analyses demonstrated that the serotypes A and B belong to different virus species [107]. McKern et al. [106] initially named members of the serotype A bean necrosis mosaic virus, which was later renamed the bean common mosaic necrosis virus (BCMNV) based on its typical symptoms and serological characteristics by the International Committee on Taxonomy of Viruses (ICTV). Recently, some soybean-infecting potyviruses, such as the blackeye cowpea mosaic virus (BlCMV), azuki bean mosaic virus (AzMV), peanut strip virus (PStV), and cowpea-aphid-borne mosaic virus (CABMV), have been classified as strains of BCMV based on their serological characteristics and genome sequences [107].
There are many BCMV and BCMNV isolates; however, the identification of the BCMV strains in China and abroad has not been unified. Currently, there are eighty-six full-length genomes of BCMV in the GenBank database, including seven from cowpeas (Vigna unguiculata), one from yam beans (Pachyrhizus erosus), one from phaseolus riukiuensis (Vigna riukiuensis), twenty-eight from common beans (Phaseolus vulgaris), one from the common nandina (Nandina domestica), two from mung beans (Vigna radiata), one from sesame (Sesamum indicum L.), one from azuki beans (Abrus precatorius L.), one from tricuspid cudrania (Cudrania tricuspidate), thirty-two from soybeans (Glycine max), two from peanuts (Arachis hypogaea), one from hyacinth beans (Lablab purpureus), and one from purple bushbeans (Macroptilium atropurpureum) (Figure 2 and Figure 3). A phylogenetic analysis showed that Chinese isolates of BCMV derived from soybeans, cowpeas, peanuts, sesame, and yam beans clustered into the same clade. Four cowpea isolates from China clustered with one soybean isolate, and one mung bean isolate clustered with another clade. The common bean isolates from India, South Korea, Colombia, Iran, Tanzania, and the United States clustered in the same clade as one cowpea strain from Iran. Another clade contained BCMV isolates from the common bean, cowpea, azuki bean, mung bean, purple bushbean, common nandina, and tricuspid cudrania. Members of this clade are widely distributed in the USA, Mexico, Australia, Germany, Iran, Tanzania, and Asian countries such as China, Japan, South Korea, and India. There are twenty-two full-length genomes of BCMNV in the GenBank database, including nineteen from the common bean (Phaseolus vulgaris), one from Fabaceae (Fabaceae Lindl.), and one from the benth (Nicotiana benthamiana). A phylogenetic analysis showed that these BCMNV isolates were clustered into two major clades: one clade contained the Indian isolate from the common bean, and the other contained the remaining BCMNV isolate. The BCMV lineage probably originated in South and East Asia. The BCMV sequence was first provided by Spain in 1992 [108,109,110,111], and the BCMNV sequence was first provided by the USA in 1995 [112]. In general, BCMV isolates from the same host exhibit a close genetic relationship. At the same time, the reported clustering between BCMV strains is closely related to the region, indicating a high frequency of gene communication between strains in the same country or region and vice versa.
3.2. Evolution
It is well known that mutation is the key factor driving the rapid evolution of RNA viruses and generating genetic diversity to adopt different hosts and environments for survival and transmission [113,114,115,116,117,118]. The situation is the same as that of BCMV: it has been shown that mutation is the major factor allowing BCMV to quickly overcome multiple resistance genes in the common bean [109,119,120]. Recombination is another major source of plant virus evolution, as it benefits viruses by allowing them to obtain new genetic information and optimize their existing biological characteristics through gene expression, increasing the possibility of breaking through host resistance to cause a successful infection [121]. Studies have shown that recombination between different BCMV or BCMNV strains is common [113,122,123]. For example, US10 is a recombinant isolate containing segments derived from the strains US1 or RU-1. Thus, interspecific recombination with other potyviruses is possible. For example, NL-3K is a natural recombinant strain of the BCMV strain RU-1 with the BCMNV strain NL-3D’s derived sequence at the 5′ end [22,23]. RU1-OR is a new strain produced by the recombination of BCMV RU-1 with another unknown member of the Potyvirus genus [124]. The current hotspots of BCMV recombination are mainly centered on the 5′ end of the genome, including the 5′ non-coding region (5′-UTR) and its adjacent P1 and HC-Pro protein-coding regions [22,23,124]. It has been shown that P1 is associated with the pathogenicity and host specificity of potyviruses, such as the plum pox virus (PPV) and SMV [125,126]. For instance, a recombinant SMV isolate containing a watermelon mosaic virus (WMV)’s 5′-UTR was able to infect Nicotiana benthamiana, a non-host for normal SMV isolates [127]. However, the effect of recombination on the biological characteristics of BCMV and BCMNV requires further investigation.
4. Resistance Resources
4.1. Dominate Resistance
Hitherto, only one dominant resistance gene has been identified in common bean germplasm resources. The I gene, which was initially described in 1950 by Ali, confers a high resistance or even complete immunity to most strains of BCMV at temperatures below 30 ℃ [128]. Consequently, it has been rapidly used for breeding, and most commercially available common bean cultivars contain this gene. However, when the temperature exceeds 30 ℃, BCMV induces temperature-dependent systemic necrosis symptoms. Therefore, the use of common bean cultivars harboring the I gene often leads to plant death in high-temperature areas, such as Africa and South America [91,92,96]. Studies have shown that BCMV can replicate and move intercellularly in I-gene-containing common bean cultivars without causing the plant to express any viral symptoms [91]. However, the molecular mechanisms underlying the temperature-induced necrosis induced by BCMV remain elusive. It has been proposed that the expression of the I gene is negatively regulated by temperature. As a result, the amount of I protein is too low to confer reliable resistance at high temperatures. Alternatively, immune responses induced by the I gene may be attenuated at high temperatures [91,92,96]. Moreover, an infection with BCMNV stimulates systemic necrosis in common bean cultivars harboring the I gene. Several closely linked molecular markers have been successfully developed in the BeanCAP diversity panel for breeding practices [15,16,21]. Additionally, six single nucleotide polymorphisms (SNPs) that are closely associated with the I gene were identified, and two kompetitive allele-specific PCR(KASP) and CAPS molecular markers were developed to accurately detect the I gene (Table 1). The I gene likely encodes a nucleotide-binding domain leucine-rich repeat-containing protein (NLR), which has been mapped to the end of the arm of chromosome 2. A total number of seven potential NLR genes were found in the resistance locus [21]. However, further studies are needed to clone the I gene and elucidate the mechanism against BCMV [15,21,129].
Moreover, several dominant resistance genes have been identified in several soybean cultivars [130,131,132]. In the soybean cultivars Suweon 97 and Raiden, the BCMV resistance locus was mapped to a region within the complex SMV-resistance locus Rsv1 on chromosome 13 [130,131]. However, the resistance gene in the soybean cultivar V94-5152 has been mapped to a genetic region in proximity to the SMV-resistance locus Rsv4. Rsv4 on chromosome 2 encodes an RNase H family protein with substrate specificity for double-stranded RNA, which confers resistance to all SMV isolates [133]. Therefore, Rsv4 confers resistance against both SMV and BCMV. Breeding resistant common bean cultivars using soybean-derived dominant genes via horizontal transfer is a promising direction for future breeding research.
4.2. Recessive Resistance
A total number of five strain-specific recessive resistance genes have been identified, namely bc-1, bc-2, bc-3, bc-4, and bc-ud [18,92]. Scientists have long believed that the Bc-1 locus contains a pair of highly linked alleles (bc-1 and bc-12). However, a recent study suggests that bc-1 and bc-12 are actually the same resistance gene, and that different resistance phenotypes are caused by the bc-ud gene [19]. The bc-1 gene was mapped to chromosome 3 using a genome-wide association analysis, and three candidate, receptor-like kinases (RLKs) (Phus.003G038700, Phus.003G038700, and Phus.003G038800 1) have been proposed (Table 2). bc-1 alone confers resistance to the NL-8 strain of BCMNV, but requires other recessive resistance genes, such as bc-2 and bc-u, to resist other strains [19,134]. It has been proposed that the symptom induction and systematic movement, but not replication, of BCMV and BCMNV are limited in bc-1 genotype common bean cultivars [103,105]. However, the identity of bc-1 is still unknown at the present.
Genome-wide associations have mapped bc-2 on chromosome 11, and several specific molecular markers have been developed to identify bc-2 (Table 1). A sequence alignment between the common bean genome of G19833 v2.1 and UI 111 v1.1 showed that UI 111 v1.1 has a 10 kb depletion in the Bc-2 locus [18]. A common bean with the mesoamerican genotype has a frameshift mutation at the Bc-2 locus [18]. Both mutations involve the same gene, Phvul.011G092700, which encodes vacuolar protein sorting 4 (Vps4) AAA + ATPase required for the endosomal sorting complexes used for transport (ESCRT) (Table 2). ESCRT plays a critical role in many important physiological processes in plants, including endosomal trafficking to lysosomes, organelle biogenesis, DNA replication, protein folding, and proteolysis [135]. Although the bc-2 gene has a minor influence on BCMV replication and intercellular movement, it can significantly inhibit the efficacy of the systemic movement of the virus [103]. However, bc-2 alone cannot confer resistance to BCMV; it can confer resistance to most BCMV strains except for PG-V in the presence of bc-4, or resistance to all strains of BCMV (except PG-VI) and BCMNV in the presence of bc-ud [18]. The cucumber homolog of the Vps4 AAA + ATPase was identified as a candidate gene for zymA192-18, providing recessive resistance against the zucchini yellow mosaic virus (ZYMV), a potyvirus infecting cucurbitaceous plants [136]. Interestingly, the host’s ESCRT-related mechanism is also required for the replication of tomato bushy stunt virus (TBSV), an +ssRNA virus from the genus Tombusvirus of the family Tombusviridae [137]. Thus, it is possible that the ESCRT, including Vps4 AAA + ATPase, plays an essential role in the proliferation of varied RNA viruses.
The bc-3 gene is the most well-studied recessive gene, and it encodes the eukaryotic translation initiation factor 4E (eIF4E) on chromosome 6 [17]. Several KASPar allele-specific SNP and CAPS molecular markers have been developed for the rapid identification of it in the common bean [93,95]. The eIF4E and its isomer, eIF(iso)4E, are essential for normal protein translation in all eukaryotes by binding to the 5′ terminal cap of the mRNA [138]. In potyviruses, the 5′ termini are covalently linked to the viral VPg protein, which responds to eIF4E or eIF(iso)4E binding for protein translation [139]. A mutation in eIF4E that blocks VPg interaction will result in the impediment of viral protein translation and the complete loss of infectivity [70,140,141,142,143,144,145]. Given its obvious application value in breeding, the interaction between VPg and eIF4E has been extensively studied, and the structure of the complex has been successfully determined recently [140,141,142,146,147,148,149]. Indeed, it is the main source of potyvirus resistance in many crops [150]. In the common bean, non-silent mutations in codons 53, 65, 76, and 111 of eIF4E have been identified in common bean cultivars carrying the bc-3 gene, indicating that this region is required for the interaction between eIF4E and the VPg protein [93,95,151,152]. The combination of bc-3 and bc-ud can protect the common bean from infection by all BCMV strains, except BCMV-1755a [92,102]. However, potyviruses can overcome eIF4E-mediated resistance by introducing mutations in the VPg coding regions [139].
The bc-4 gene was mapped on chromosome 5 of the common bean using a genome-wide association study [18]. Specific molecular markers have been developed to identify bc-4 (Table 1). Phus.005G125100 is the best candidate gene for bc-4, which also encodes Vps4 AAA + ATPase. Similar to bc-2, bc-4 cannot act alone, but requires other recessive resistance genes for resistance to BCMV. For instance, bc-4 and bc-3 are required for the bean variety IVT7214 to inhibit C1YVV, and bc-1 and bc-3 are required for the common bean cultivar USCR-8 to resist infection by C1YY, BCMV, and BCMNV (except for the strain NL-3K) [22,153]. Thus, bc-4 may negatively regulate bc-3 resistance through an unknown molecular mechanism [18].
The bc-u gene has always been recognized as a nonspecific assistant gene required for other recessive resistance genes [92,94]. Recently, Soler et al. remapped bc-u on chromosome 5 in a genome-wide association study (GWAS). Furthermore, this gene has been confirmed in the common bean varieties host group (HG)-3, -6, -10, and -11, but not HG-2, -4, -5, or -7, using specific molecular markers (Table 1 and Table 3). After amending the genetic background of each HG cultivar, the bc-u gene was renamed bc-ud [19]. Phvul.005G124100 was identified as the candidate gene of bc-ud, which encodes a basic Leucine Zipper (bZIP) transcription factor [19]. The bc-ud gene in the Durango Diversity Panel (DDP) carries a non-synonymous mutation at codon 14 of the first exon (Pv05: 36,114,516 bases), which results in premature termination [19]. Reports have shown that bZIP is involved in regulating many important plant physiological processes and is a crucial component of the plant regulatory network in response to biotic stresses [154,155,156,157]. For instance, AtbZIP10 in Arabidopsis thaliana is a positive regulator of pathogen-induced hypersensitive response (HR) [154]. bZIP can also interact with the non-expressor of pathogenesis-related 1 (NPR1) in tobacco (Nicotiana tabacum), which is the receptor of salicylic acid and is required for resistance to the tobacco mosaic virus (TMV) in tobacco [158]. Moreover, bc-ud can improve the resistance of the bc-1 or I gene against BCMNV-NL3 and NL-8 in the common bean [19].
5. Future Prospects
The most cost-effective method for controlling BCMV infections is breeding resistant cultivars [159,160,161,162,163]. Indeed, the dominant I gene and recessive genes have been extensively used to breed resistant varieties [164,165,166]. However, pyramiding all the resistance into one cultivar is extremely time-consuming. The development of rapid DNA molecular markers, including Random Amplified Polymorphic DNA (RAPD), Restriction Fragment Length Polymorphism (RFLP), Amplified Fragment Length Polymorphism (AFLP), and Simple sequence repeat (SSR), will accelerate the identification of resistance genes in common bean populations for breeding purposes [167]. Viruses tend to escape resistance through the accumulation of mutations. Therefore, it is necessary to identify new dominant or recessive resistance genes in the common bean and related legumes. For instance, the translationally controlled tumor protein (TCTP) is required for the proliferation of several potyviruses [168,169]. Therefore, the counterpart in the common bean may also be a suitable candidate for resisting BCMV and BCMNV.
BCMV is naturally spread by aphids, and the control of the aphid population by chemical spraying is another method for controlling the outbreak of BCMV or BCMNV in the common bean [170]. However, special attention should be paid to the potential contamination of beans with pesticides and their influence on the environment. Recent developments in the biosafety of pesticides have shed new light on the control of aphids. Worrall et al. [171] developed a BioClayTM as the carrier of dsRNA that is a homolog to BCMV CP, which can effectively inhibit the spread of BCMV. Another study showed that 0.9% chitosan could effectively inhibit the population quality and change the feeding preference of Aphis craccivora, reducing BCMV transmission efficiency [172]. Biological prevention can effectively reduce the incidence and severity of viral diseases [27,173,174,175]. Seed transmission capacity is a key survival strategy for many potyviruses, including BCMV and BCMNV. However, the molecular mechanisms underlying seed transmission are largely unknown at the present. Therefore, it is necessary to investigate the molecular mechanisms of seed transmission and develop an efficient tissue culture method to obtain virus-free common been seeds.
Table 1List of resistance gene markers.
| BCMV Resistance Alleles | ID Marker | Sequence | Reference | |
|---|---|---|---|---|
| I | SW-13 | F | CACAGCGACATTAATTTTCCTTTC | [176] |
| R | CACAGCGACAGGAGGAGCTTATTA | |||
| S02_48908259 | Fa | gcgggcCAAAGTGCTAGAGGCATGATCA | [19] | |
| R | TGGTTATCATTCATTGTGAAGTCAATG | |||
| Fb | gcgggcagggcggcAATCTTATGCTTGAAGCAGTGAAAGC | |||
| BCMV_48289723_ |
F | AGGAGGAAGAACGGTGGTC | [15] | |
| R | TTTGGTGGTAATTTGAAAATGG | |||
| OW13690 | RAPD marker | CACAGCGACA | [177] | |
| bc-1 | SBD-5 | F | GTGCGGAGAGGCCATCCATTGGTG | [134] |
| R | GTGCGGAGAGTTTCAGTGTTGACA | |||
| S03_4203361 | Fa | gcgggcTGGTCAGTTTGTCTTCCCTAACT | [19] | |
| R | TGCAGAAGAGCTCAACTCGAAG | |||
| Fb | gcgggcagggcggcGGTCAGTTTGTCTTCCCTAACA | |||
| bc-2 | Pvvps4_del | Fa | AGACCGTTTGCTAGGTTCACAA | [18] |
| R | TGTAGGCAATAAGGCGACGTTT | |||
| Fb | AAATTATAAACATGTGTTGGCGAGC | |||
| Pvmit-2_C_del | Fa | gcgggcagggccATTTCTGCGTGATTGCCTCT | [18] | |
| R | CTTCAAAACGCACCTCAAGTATGA | |||
| Fb | gcgggcTCTGCGTGATTGCCTCC | |||
| bc-3 | ROC11 | F | CCAATTCTCTTTCACTTGTAACC | [177] |
| R | GCATGTTCCAGCAAACC | |||
| eIF4E | F | ACCGATGAGCAAAACCCTA | [17] | |
| R | CAACCAACTGGTATCGGATT | |||
| OAD19690 | RAPD marker | CTTGGCACGA | [178] | |
| OS13660 | RAPD marker | GTCGGTTCCTG | [178] | |
| PveIF4E1,3,4_ |
Fa | gcgggcCAATCTTATGCTTGAAGCAGTGAAAGT | [19] | |
| R | ATTTACAATAACATTCACCACCCGAGCAA | |||
| Fb | gcgggcagggcggcAATCTTATGCTTGAAGCAGTGAAAGC | |||
| bc-4 | Pvmit1_T_G | Fa | gcgggcCGAAAGCGTTCCCTCTCTACAT | [18] |
| R | GCGTGATGGCTTCCTTGATCTT | |||
| Fb | gcgggcagggcggcCGAAAGCGTTCCCTCTCTACAG | |||
| bc-ud | Pvbzip1_A_C | Fa | gcgggcTAGGAGAACTTGGTTTGTCTGAGTA | [19] |
| R | GCACTCCATAAGGGATGTGGT | |||
| Fb | gcgggcagggcggcGGAGAACTTGGTTTGTCTGAGTC |
Note: Fa and Fb: allele specific positive primers; F: forward primer; R: reverse primer.
Table 2Candidate BCMV resistance genes in common bean.
| BCMV |
Location | Candidate Genes | Reference |
|---|---|---|---|
| I | Pv02: 48,908,259 | Phvul.002G323000~Phvul.002G323,500 Phvul.002G323800 | [15,21] |
| bc-1 | Pv03: 4,203,361 | Side-by-side receptor-like |
[19] |
| bc-2 | Pv11: 9,272,542 -9,262,459 | Phus.011G092700 | [18] |
| bc-3 | Pv06: 27,204,768 | Phvul.006G168400 | [176] |
| bc-4 | Pv05: 36,225,550 | Phus.005G125100 | [18] |
| bc-ud | Pv05: 36,114,516 | Phvul.005G124100 | [19] |
List of BCMV and BCMNV pathotypes.
| Bean |
Resistance Genes | PG-I | PG-II | PG-III | PG-IV | PG-V | PG-VI | PG-VII | PG-VIII |
|---|---|---|---|---|---|---|---|---|---|
| DW | / | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ |
| Poncho |
bc-ud | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ | +/+ |
| RGLC | bc-1 | -/- | +/+ | -/- | +/+ | +/+ | +/+ | +/+ | -/- |
| RGLB | bc-1, bc-? | -/- | -/- | -/- | +/+ | -/- | +/+ | +/+ | -/- |
| Sanilac | bc-2, bc-4 | -/- | -/- | +/+ | -/- | +/+ | +/+ | -/- | +/+ |
| UI35 | bc-ud, bc-1, bc-2 | -/- | -/- | -/- | -/- | -/- | -/- | +/+ | -/- |
| IVT7214 | bc-3, bc-4, bc-2? | -/- | -/- | -/- | -/- | -/- | -/- | -/- | +/+ |
| Jubila | I, bc-1 | -/- | -/- | -/- | -/- | -/- | -/- | -/- | -/- |
| Amanda | I, bc-1, bc-? | -/- | -/- | -/- | -/- | -/- | -/- | -/- | -/- |
| US1006 | I, bc-ud, bc-2 | -/- | -/- | -/- | -/- | -/- | -/- | -/- | -/- |
| IVT7233 | I, bc-ud, bc-2 | -/- | -/- | -/- | -/- | -/- | -/- | -/- | -/- |
Note: Pathotype determination criterion: symptoms appear after each strain inoculation/TAS-ELISA test result. For example, if a symptom is presented and tested as BCMV-positive, it is marked as +/+, and vice versa, it is marked as -/-. bc-? indicates a helper gene other than bc-ud, and work characterizing these other genes is in progress.
M.T.: Writing original draft preparation; Literature search and chart making; X.F.: Writing—review and editing; funding acquisition. All authors made direct and intellectual contributions to the manuscript. All authors have read and agreed to the published version of the manuscript.
Not applicable.
We would like to thank KetengEdit (
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Symptoms of bean common mosaic virus (BCMV) in different bean cultivars. (A) Crinkling and leaf rolling of Dubbele Witte seedlings; (B) mild mottling of Stringless Green Refugee seedlings; (C) leaf deformation and rolling of IVT-7214 seedlings; (D) crinkling of Redland’s Greenleaf “C” seedlings; (E) leaf rolling, chlorotic spots, and leaf deformation of Sanilac seedlings; and (F) leaf vein necrosis of SGR seedlings.
Enlarge this image.Figure 2. Maximum-likelihood phylogenetic tree for BCMV and BCMNV whole-genome sequences.
Enlarge this image.Figure 3. Phylogenetic tree produced through Bayes methods for BCMV and BCMNV whole-genome sequences.
References
1. Graham, P.; Ranalli, P. Common bean (Phaseolus vulgaris L.). Field Crops Res.; 1997; 53, pp. 131-146. [DOI: https://dx.doi.org/10.1016/S0378-4290(97)00112-3]
2. Karavidas, I.; Ntatsi, G.; Vougeleka, V.; Karkanis, A.; Ntanasi, T.; Saitanis, C.; Agathokleous, E.; Ropokis, A.; Sabatino, L.; Tran, F. Agronomic Practices to Increase the Yield and Quality of Common Bean (Phaseolus vulgaris L.): A Systematic Review. Agronomy; 2022; 12, 271. [DOI: https://dx.doi.org/10.3390/agronomy12020271]
3. Singh, S.P. Broadening the genetic base of common bean cultivars: A review. Crop Sci.; 2001; 41, pp. 1659-1675. [DOI: https://dx.doi.org/10.2135/cropsci2001.1659]
4. Drijfhout, E.; Morales, F. Bean common mosaic. Compendium of Bean Diseases; 2nd ed. Schwartz, H.F.; Steadman, J.R.; Hall, R.; Forster, R.L. American Phytopathological Society: Saint Paul, MN, USA, 2005; pp. 60-62.
5. Arli-Sokmen, M.; Deligoz, I.; Kutluk-Yilmaz, N.D. Characterization of Bean common mosaic virus and Bean common mosaic necrosis virus isolates in common bean growing areas in Turkey. Eur. J. Plant Pathol.; 2016; 146, pp. 1-16. [DOI: https://dx.doi.org/10.1007/s10658-016-0886-x]
6. Chiquito-Almanza, E.; Acosta-Gallegos, J.A.; Garcia-Alvarez, N.C.; Garrido-Ramirez, E.R.; Montero-Tavera, V.; Guevara-Olvera, L.; Anaya-Lopez, J.L. Simultaneous Detection of Both RNA and DNA Viruses Infecting Dry Bean and Occurrence of Mixed Infections by BGYMV, BCMV and BCMNV in the Central-West Region of Mexico. Viruses; 2017; 9, 63. [DOI: https://dx.doi.org/10.3390/v9040063]
7. Mwaipopo, B.; Nchimbi-Msolla, S.; Njau, P.J.R.; Mark, D.; Mbanzibwa, D.R. Comprehensive Surveys of Bean common mosaic virus and Bean common mosaic necrosis virus and Molecular Evidence for Occurrence of Other Phaseolus vulgaris Viruses in Tanzania. Plant Dis.; 2018; 102, pp. 2361-2370. [DOI: https://dx.doi.org/10.1094/PDIS-01-18-0198-RE]
8. Ac, U.; Nayaka, S.C.; Niranjana, S.R.; Prkash, H.S.; Mortensen, C.N. Bean Common Mosaic of French Bean; Danish Seed Health Centre for Developing Countries: Copenhagen, Denmark, 2020.
9. Han, T.; Yang, C.X.; Jing-Jing, F.U.; Liao, Y.M.; Shuang-Yu, L.; Jia, R.; Shi, C.Y. Identification and Sequence Analysis of Bean common mosaic virus in Liaoning. Acta Agric. Univ. Jiangxiensis; 2018; 40, pp. 378-382.
10. Worrall, E.A.; Wamonje, F.O.; Mukeshimana, G.; Harvey, J.J.; Carr, J.P.; Mitter, N. Bean common mosaic virus and Bean common mosaic necrosis virus: Relationships, biology, and prospects for control. Adv. Virus Res.; 2015; 93, pp. 1-46.
11. Kabeja, A. Gene Ecology of the Climbing Common Bean (Phaseolus vulgaris)-Bean Common Mosaic Virus/Bean Common Mosaic Necrosis Virus (BCMV/BCMNV) Relationship in Rwanda: A Key for the Development of Virus-Resistant Beans. Ph.D. Thesis; University of California: Davis, CA, USA, 2020.
12. Valli, A.; García, J.A.; López-Moya, J.J. Potyviridae. eLS; John Wiley & Sons: Chichester, UK, 2015; pp. 1-10. [DOI: https://dx.doi.org/10.1002/9780470015902.a0000755.pub3]
13. Shukla, D.D.; Ward, C.W.; Brunt, A.A. The Potyviridae; CAB International: Wallingford, UK, 1994.
14. Naderpour, M.; Johansen, I.E. Visualization of resistance responses in Phaseolus vulgaris using reporter tagged clones of Bean common mosaic virus. Virus Res.; 2011; 159, pp. 1-8. [DOI: https://dx.doi.org/10.1016/j.virusres.2011.04.004]
15. Bello, M.H.; Moghaddam, S.M.; Massoudi, M.; Mcclean, P.E.; Cregan, P.B.; Miklas, P.N. Application of in silico bulked segregant analysis for rapid development of markers linked to Bean common mosaic virus resistance in common bean. BMC Genom.; 2014; 15, 903. [DOI: https://dx.doi.org/10.1186/1471-2164-15-903]
16. Meziadi, C.; Richard, M.M.S.; Derquennes, A.; Thareau, V.; Blanchet, S.; Gratias, A.; Pflieger, S.; Geffroy, V. Development of molecular markers linked to disease resistance genes in common bean based on whole genome sequence. Plant Sci.; 2016; 242, pp. 351-357. [DOI: https://dx.doi.org/10.1016/j.plantsci.2015.09.006]
17. Schmutz, J.; McClean, P.E.; Mamidi, S.; Wu, G.A.; Cannon, S.B.; Grimwood, J.; Jenkins, J.; Shu, S.; Song, Q.; Chavarro, C. A reference genome for common bean and genome-wide analysis of dual domestications. Nat. Genet.; 2014; 46, pp. 707-713. [DOI: https://dx.doi.org/10.1038/ng.3008]
18. Soler-Garzon, A.; McClean, P.E.; Miklas, P.N. Coding Mutations in Vacuolar Protein-Sorting 4 AAA+ ATPase Endosomal Sorting Complexes Required for Transport Protein Homologs Underlie bc-2 and New bc-4 Gene Conferring Resistance to Bean Common Mosaic Virus in Common Bean. Front. Plant Sci.; 2021; 12, 769247. [DOI: https://dx.doi.org/10.3389/fpls.2021.769247]
19. Soler-Garzon, A.; McClean, P.E.; Miklas, P.N. Genome-Wide Association Mapping of bc-1 and bc-u Reveals Candidate Genes and New Adjustments to the Host-Pathogen Interaction for Resistance to Bean Common Mosaic Necrosis Virus in Common Bean. Front. Plant Sci.; 2021; 12, 699569. [DOI: https://dx.doi.org/10.3389/fpls.2021.699569]
20. Strausbaugh, C.; Myers, J.; Forster, R.; McClean, P. bc-1 and bc-u—Two loci controlling bean common mosaic virus resistance in common bean are linked. J. Am. Soc. Hortic. Sci.; 1999; 124, pp. 644-648. [DOI: https://dx.doi.org/10.21273/JASHS.124.6.644]
21. Vallejos, C.E.; Astua-Monge, G.; Jones, V.; Plyler, T.R.; Sakiyama, N.S.; Mackenzie, S.A. Genetic and molecular characterization of the I locus of Phaseolus vulgaris. Genetics; 2006; 172, pp. 1229-1242. [DOI: https://dx.doi.org/10.1534/genetics.105.050815]
22. Larsen, R.C.; Miklas, P.N.; Druffel, K.L.; Wyatt, S.D. NL-3 K Strain Is a Stable and Naturally Occurring Interspecific Recombinant Derived from Bean common mosaic necrosis virus and Bean common mosaic virus. Phytopathology; 2005; 95, pp. 1037-1042. [DOI: https://dx.doi.org/10.1094/PHYTO-95-1037]
23. Naderpour, M.; Lund, O.; Johansen, I. Sequence analysis of expressed cDNA of Bean common mosaic virus RU1 isolate. Iran. J. Virol.; 2009; 3, pp. 39-41. [DOI: https://dx.doi.org/10.21859/isv.3.3.39]
24. Feng, X.; Poplawsky, A.R.; Karasev, A.V. A Recombinant of Bean common mosaic virus Induces Temperature-Insensitive Necrosis in an I Gene-Bearing Line of Common Bean. Phytopathology; 2014; 104, pp. 1251-1257. [DOI: https://dx.doi.org/10.1094/PHYTO-02-14-0048-R]
25. Ivanov, K.I.; Eskelin, K.; Lohmus, A.; Makinen, K. Molecular and cellular mechanisms underlying potyvirus infection. J. Gen. Virol.; 2014; 95, pp. 1415-1429. [DOI: https://dx.doi.org/10.1099/vir.0.064220-0]
26. Hull, R. Plant Virology; Academic Press: Cambridge, MA, USA, 2013.
27. Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Ozaki, K.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus in Arabidopsis thaliana by Trichoderma asperellum SKT-1. Plant Pathol. J.; 2013; 29, 193. [DOI: https://dx.doi.org/10.5423/PPJ.SI.07.2012.0117] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25288946]
28. Wylie, S.J.; Adams, M.; Chalam, C.; Kreuze, J.; Lopez-Moya, J.J.; Ohshima, K.; Praveen, S.; Rabenstein, F.; Stenger, D.; Wang, A. et al. ICTV Virus Taxonomy Profile: Potyviridae. J. Gen. Virol.; 2017; 98, pp. 352-354. [DOI: https://dx.doi.org/10.1099/jgv.0.000740] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28366187]
29. Revers, F.; Garcia, J.A. Molecular biology of potyviruses. Adv. Virus Res.; 2015; 92, pp. 101-199. [DOI: https://dx.doi.org/10.1016/bs.aivir.2014.11.006]
30. Urcuqui-Inchima, S.; Haenni, A.L.; Bernardi, F. Potyvirus proteins: A wealth of functions. Virus Res.; 2001; 74, pp. 157-175. [DOI: https://dx.doi.org/10.1016/S0168-1702(01)00220-9] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11226583]
31. Chung, Y.W.; Miller, W.A.; Atkins, J.F.; Firth, A.E. An overlapping essential gene in the Potyviridae. Proc. Natl. Acad. Sci. USA; 2008; 105, pp. 5897-5902. [DOI: https://dx.doi.org/10.1073/pnas.0800468105] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18408156]
32. Olspert, A.; Chung, Y.W.; Atkins, J.F.; Carr, J.P.; Firth, A.E. Transcriptional slippage in the positive-sense RNA virus family Potyviridae. EMBO Rep.; 2015; 16, pp. 995-1004. [DOI: https://dx.doi.org/10.15252/embr.201540509]
33. Rodamilans, B.; Valli, A.; Mingot, A.; San Leon, D.; Baulcombe, D.; Lopez-Moya, J.J.; Garcia, J.A. RNA polymerase slippage as a mechanism for the production of frameshift gene products in plant viruses of the potyviridae family. J. Virol.; 2015; 89, pp. 6965-6967. [DOI: https://dx.doi.org/10.1128/JVI.00337-15]
34. Chai, M.; Wu, X.; Liu, J.; Fang, Y.; Luan, Y.; Cui, X.; Zhou, X.; Wang, A.; Cheng, X. P3N-PIPO Interacts with P3 via the Shared N-Terminal Domain to Recruit Viral Replication Vesicles for Cell-to-Cell Movement. J. Virol.; 2020; 94, e01898-19. [DOI: https://dx.doi.org/10.1128/JVI.01898-19]
35. Revers, F.; García, J.A. Molecular biology of potyviruses. Advances in Virus Research; Karl, M.; Thomas, C.M.; Murphy, F.A. Academic Press: Waltham, MA, USA, 2015; Volume 92, pp. 101-199.
36. Mäkinen, K.; Paulin, L.; Saarma, M. The nucleotide sequence of potato virus A genomic RNA and its sequence similarities with other potyviruses. J. Gen. Virol.; 1994; 75, pp. 457-461.
37. Kekarainen, T.; Merits, A.; Oruetxebarria, I.; Rajamäki, M.-L.; Valkonen, J. Comparison of the complete sequences of five different isolates of Potato virus A (PVA), genus Potyvirus. Arch. Virol.; 1999; 144, pp. 2355-2366. [DOI: https://dx.doi.org/10.1007/s007050050649]
38. Shi, Y.; Chen, J.; Hong, X.; Chen, J.; Adams, M.J. A potyvirus P1 protein interacts with the Rieske Fe/S protein of its host. Mol. Plant Pathol.; 2007; 8, pp. 785-790. [DOI: https://dx.doi.org/10.1111/j.1364-3703.2007.00426.x]
39. Li, M.-J.; Kim, J.-K.; Seo, E.-Y.; Hong, S.M.; Hwang, E.-I.; Moon, J.-K.; Domier, L.L.; Hammond, J.; Youn, Y.-N.; Lim, H.-S. Sequence variability in the HC-Pro coding regions of Korean soybean mosaic virus isolates is associated with differences in RNA silencing suppression. Arch. Virol.; 2014; 159, pp. 1373-1383. [DOI: https://dx.doi.org/10.1007/s00705-013-1964-4]
40. Lim, H.-S.; Ko, T.-S.; Lambert, K.N.; Kim, H.-G.; Korban, S.S.; Hartman, G.L.; Domier, L.L. Soybean mosaic virus helper component-protease enhances somatic embryo production and stabilizes transgene expression in soybean. Plant Physiol. Biochem.; 2005; 43, pp. 1014-1021. [DOI: https://dx.doi.org/10.1016/j.plaphy.2005.08.012]
41. Lim, H.-S.; Jang, C.-Y.; Bae, H.-H.; Kim, J.-K.; Lee, C.-H.; Hong, J.-S.; Ju, H.-J.; Kim, H.-G.; Domier, L.L. Soybean mosaic virus infection and helper component-protease enhance accumulation of bean pod mottle virus-specific siRNAs. Plant Pathol. J.; 2011; 27, pp. 315-323. [DOI: https://dx.doi.org/10.5423/PPJ.2011.27.4.315]
42. Jossey, S.; Hobbs, H.A.; Domier, L.L. Role of Soybean mosaic virus–encoded proteins in seed and aphid transmission in soybean. Phytopathology; 2013; 103, pp. 941-948. [DOI: https://dx.doi.org/10.1094/PHYTO-09-12-0248-R]
43. Senda, M.; Masuta, C.; Ohnishi, S.; Goto, K.; Kasai, A.; Sano, T.; Hong, J.-S.; MacFarlane, S. Patterning of virus-infected Glycine max seed coat is associated with suppression of endogenous silencing of chalcone synthase genes. Plant Cell; 2004; 16, pp. 807-818. [DOI: https://dx.doi.org/10.1105/tpc.019885]
44. Lu, L.; Wu, G.; Xu, X.; Luan, H.; Zhi, H.; Cui, J.; Cui, X.; Chen, X. Soybean actin-depolymerizing factor 2 interacts with Soybean mosaic virus-encoded P3 protein. Virus Genes; 2015; 50, pp. 333-339. [DOI: https://dx.doi.org/10.1007/s11262-014-1150-0]
45. Ahangaran, A.; Habibi, M.K.; Mohammadi, G.-H.M.; Winter, S.; García-Arenal, F. Analysis of Soybean mosaic virus genetic diversity in Iran allows the characterization of a new mutation resulting in overcoming Rsv4-resistance. J. Gen. Virol.; 2013; 94, pp. 2557-2568. [DOI: https://dx.doi.org/10.1099/vir.0.055434-0]
46. Chowda-Reddy, R.; Sun, H.; Chen, H.; Poysa, V.; Ling, H.; Gijzen, M.; Wang, A. Mutations in the P3 protein of Soybean mosaic virus G2 isolates determine virulence on Rsv4-genotype soybean. Mol. Plant Microbe Interact.; 2011; 24, pp. 37-43. [DOI: https://dx.doi.org/10.1094/MPMI-07-10-0158]
47. Eggenberger, A.; Hajimorad, M.; Hill, J. Gain of virulence on Rsv1-genotype soybean by an avirulent Soybean mosaic virus requires concurrent mutations in both P3 and HC-Pro. Mol. Plant Microbe Interact.; 2008; 21, pp. 931-936. [DOI: https://dx.doi.org/10.1094/MPMI-21-7-0931]
48. Hajimorad, M.; Eggenberger, A.; Hill, J. Evolution of Soybean mosaic virus-G7 molecularly cloned genome in Rsv1-genotype soybean results in emergence of a mutant capable of evading Rsv1-mediated recognition. Virology; 2003; 314, pp. 497-509. [DOI: https://dx.doi.org/10.1016/S0042-6822(03)00456-2] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14554079]
49. Hajimorad, M.; Eggenberger, A.; Hill, J. Loss and gain of elicitor function of Soybean mosaic virus G7 provoking Rsv1-mediated lethal systemic hypersensitive response maps to P3. J. Virol.; 2005; 79, pp. 1215-1222. [DOI: https://dx.doi.org/10.1128/JVI.79.2.1215-1222.2005] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15613348]
50. Hajimorad, M.; Eggenberger, A.; Hill, J. Strain-specific P3 of Soybean mosaic virus elicits Rsv1-mediated extreme resistance, but absence of P3 elicitor function alone is insufficient for virulence on Rsv1-genotype soybean. Virology; 2006; 345, pp. 156-166. [DOI: https://dx.doi.org/10.1016/j.virol.2005.09.055] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16263149]
51. Hajimorad, M.; Eggenberger, A.; Hill, J. Adaptation of Soybean mosaic virus avirulent chimeras containing P3 sequences from virulent strains to Rsv1-genotype soybeans is mediated by mutations in HC-Pro. Mol. Plant Microbe Interact.; 2008; 21, pp. 937-946. [DOI: https://dx.doi.org/10.1094/MPMI-21-7-0937] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18533834]
52. Hajimorad, M.; Wen, R.-H.; Eggenberger, A.; Hill, J.; Maroof, M.S. Experimental adaptation of an RNA virus mimics natural evolution. J. Virol.; 2011; 85, pp. 2557-2564. [DOI: https://dx.doi.org/10.1128/JVI.01935-10]
53. Khatabi, B.; Fajolu, O.; Wen, R.H.; Hajimorad, M. Evaluation of North American isolates of Soybean mosaic virus for gain of virulence on Rsv-genotype soybeans with special emphasis on resistance-breaking determinants on Rsv4. Mol. Plant Pathol.; 2012; 13, pp. 1077-1088. [DOI: https://dx.doi.org/10.1111/j.1364-3703.2012.00817.x]
54. Khatabi, B.; Wen, R.H.; Hajimorad, M. Fitness penalty in susceptible host is associated with virulence of Soybean mosaic virus on R sv1-genotype soybean: A consequence of perturbation of HC-P ro and not P 3. Mol. Plant Pathol.; 2013; 14, pp. 885-897. [DOI: https://dx.doi.org/10.1111/mpp.12054]
55. Lim, H.S.; Ko, T.S.; Hobbs, H.A.; Lambert, K.N.; Yu, J.M.; McCoppin, N.K.; Korban, S.S.; Hartman, G.L.; Domier, L.L. Soybean mosaic virus helper component-protease alters leaf morphology and reduces seed production in transgenic soybean plants. Phytopathology; 2007; 97, pp. 366-372. [DOI: https://dx.doi.org/10.1094/PHYTO-97-3-0366]
56. Seo, J.-K.; Sohn, S.-H.; Kim, K.-H. A single amino acid change in HC-Pro of soybean mosaic virus alters symptom expression in a soybean cultivar carrying Rsv1 and Rsv3. Arch. Virol.; 2011; 156, pp. 135-141. [DOI: https://dx.doi.org/10.1007/s00705-010-0829-3]
57. Wang, Y.; Hajimorad, M. Gain of virulence by Soybean mosaic virus on Rsv4-genotype soybeans is associated with a relative fitness loss in a susceptible host. Mol. Plant Pathol.; 2016; 17, pp. 1154-1159. [DOI: https://dx.doi.org/10.1111/mpp.12354]
58. Wang, Y.; Khatabi, B.; Hajimorad, M. Amino acid substitution in P 3 of Soybean mosaic virus to convert avirulence to virulence on R sv4-genotype soybean is influenced by the genetic composition of P 3. Mol. Plant Pathol.; 2015; 16, pp. 301-307. [DOI: https://dx.doi.org/10.1111/mpp.12175]
59. Wen, R.-H.; Khatabi, B.; Ashfield, T.; Maroof, M.S.; Hajimorad, M. The HC-Pro and P3 cistrons of an avirulent Soybean mosaic virus are recognized by different resistance genes at the complex Rsv1 locus. Mol. Plant Microbe Interact.; 2013; 26, pp. 203-215. [DOI: https://dx.doi.org/10.1094/MPMI-06-12-0156-R]
60. Hong, X.-Y.; Chen, J.; Shi, Y.-H.; Chen, J.-P. The ‘6K1′protein of a strain of Soybean mosaic virus localizes to the cell periphery. Arch. Virol.; 2007; 152, pp. 1547-1551. [DOI: https://dx.doi.org/10.1007/s00705-007-0972-7]
61. Moreno, M.; Bernal, J.J.; Jiménez, I.; Rodrńuez-Cerezo, I. Resistance in plants transformed with the P1 or P3 gene of tobacco vein mottling potyvirus. J. Gen. Virol.; 1998; 79, pp. 2819-2827. [DOI: https://dx.doi.org/10.1099/0022-1317-79-11-2819]
62. Verchot, J.; Carrington, J.C. Debilitation of plant potyvirus infectivity by P1 proteinase-inactivating mutations and restoration by second-site modifications. J. Virol.; 1995; 69, pp. 1582-1590. [DOI: https://dx.doi.org/10.1128/jvi.69.3.1582-1590.1995]
63. Blanc, S.; López-Moya, J.-J.; Wang, R.; García-Lampasona, S.; Thornbury, D.W.; Pirone, T.P. A specific interaction between coat protein and helper component correlates with aphid transmission of a potyvirus. Virology; 1997; 231, pp. 141-147. [DOI: https://dx.doi.org/10.1006/viro.1997.8521]
64. Rojas, M.R.; Zerbini, F.M.; Allison, R.F.; Gilbertson, R.L.; Lucas, W.J. Capsid protein and helper component-proteinase function as potyvirus cell-to-cell movement proteins. Virology; 1997; 237, pp. 283-295. [DOI: https://dx.doi.org/10.1006/viro.1997.8777]
65. Jenner, C.E.; Tomimura, K.; Ohshima, K.; Hughes, S.L.; Walsh, J.A. Mutations in Turnip mosaic virus P3 and cylindrical inclusion proteins are separately required to overcome two Brassica napus resistance genes. Virology; 2002; 300, pp. 50-59. [DOI: https://dx.doi.org/10.1006/viro.2002.1519] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12202205]
66. Rodriguez-Cerezo, E.; Ammar, E.; Pirone, T.; Shaw, J. Association of the non-structural P3 viral protein with cylindrical inclusions in potyvirus-infected cells. J. Gen. Virol.; 1993; 74, pp. 1945-1949. [DOI: https://dx.doi.org/10.1099/0022-1317-74-9-1945]
67. Merits, A.; Guo, D.; Järvekülg, L.; Saarma, M. Biochemical and genetic evidence for interactions between potato A potyvirus-encoded proteins P1 and P3 and proteins of the putative replication complex. Virology; 1999; 263, pp. 15-22. [DOI: https://dx.doi.org/10.1006/viro.1999.9926]
68. Wei, T.; Wang, A. Biogenesis of cytoplasmic membranous vesicles for plant potyvirus replication occurs at endoplasmic reticulum exit sites in a COPI-and COPII-dependent manner. J. Virol.; 2008; 82, pp. 12252-12264. [DOI: https://dx.doi.org/10.1128/JVI.01329-08] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18842721]
69. Wei, T.; Huang, T.-S.; McNeil, J.; Laliberté, J.-F.; Hong, J.; Nelson, R.S.; Wang, A. Sequential recruitment of the endoplasmic reticulum and chloroplasts for plant potyvirus replication. J. Virol.; 2010; 84, pp. 799-809. [DOI: https://dx.doi.org/10.1128/JVI.01824-09] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19906931]
70. Lellis, A.D.; Kasschau, K.D.; Whitham, S.A.; Carrington, J.C. Loss-of-susceptibility mutants of Arabidopsis thaliana reveal an essential role for eIF (iso) 4E during potyvirus infection. Curr. Biol.; 2002; 12, pp. 1046-1051. [DOI: https://dx.doi.org/10.1016/S0960-9822(02)00898-9]
71. El-Sawy, M.A.; Mohamed, H.A.E.; Elsharkawy, M.M. Serological and molecular characterisations of the Egyptian isolate of Bean common mosaic virus. Arch. Phytopathol. Plant Prot.; 2014; 47, pp. 1431-1443. [DOI: https://dx.doi.org/10.1080/03235408.2013.845470]
72. Pasev, G.; Kostova, D.; Sofkova, S. Identification of Genes for Resistance to Bean Common Mosaic Virus and Bean Common Mosaic Necrosis Virus in Snap Bean (Phaseolus vulgaris L.) Breeding Lines Using Conventional and Molecular Methods. J. Phytopathol.; 2013; 162, pp. 19-25. [DOI: https://dx.doi.org/10.1111/jph.12149]
73. Aishwarya, P.; Rangaswamy, K.T.; Basavaraju, S.; Achari, R.; Prameela, H.A. Evaluation of the Seed-borne Nature of Bean Common Mosaic Virus (BCMV) in Cowpea. Int. J. Curr. Microbiol. Appl. Sci.; 2020; 9, pp. 239-245. [DOI: https://dx.doi.org/10.20546/ijcmas.2020.911.028]
74. Aishwarya, P. Identification of Genotypes and Tagging of Available SSR Markers Linked to BCMV (Bean Common Mosaic Virus) Resistance in Early Segregating Generation of Cowpea [Vigna unguiculata (L.) Walp.] and Evaluation of Nature of Seed Transmission. Ph. D. Thesis; University of Agricultural Sciences: Bangalore, India, 2017.
75. Su, W. Molecular Identification and Analysis of the Complete Genome Sequences of Bean Common Mosaic Virus from Three Legumes. Master’s Thesis; Shandong Agricultural University: Taian, China, 2013.
76. Edwardson, J.; Christie, R.; Ko, N. Potyvirus cylindrical inclusions—Subdivision-IV. Phytopathology; 1984; 74, pp. 1111-1114. [DOI: https://dx.doi.org/10.1094/Phyto-74-1111]
77. Klein, R.; Wyatt, S.; Kaiser, W. Incidence of bean common mosaic virus in USDA Phaseolus germ plasm collection. Plant Dis.; 1988; 72, pp. 301-302. [DOI: https://dx.doi.org/10.1094/PD-72-0301]
78. Kuhn, C.; Nutter, F., Jr.; Padgett, G. Multiple levels of resistance to tobacco etch virus in pepper. Phytopathology; 1989; 79, pp. 814-818. [DOI: https://dx.doi.org/10.1094/Phyto-79-814]
79. Kachroo, A.; Wang, X.W.; Valdes-Lopez, O.; Carr, J.P.; Gilligan, C.A. Three Aphid-Transmitted Viruses Encourage Vector Migration from Infected Common Bean (Phaseolus vulgaris) Plants Through a Combination of Volatile and Surface Cues. Front. Plant Sci.; 2020; 11, 613772.
80. Mhlanga, N.M. Effects of Plant Viral Pathogens on Plant-Pollinator Relationships. Ph.D. Thesis; University of Cambridge: Cambridge, UK, 2020.
81. Westwood, J.H.; Lewsey, M.G.; Murphy, A.M.; Tungadi, T.; Bates, A.; Gilligan, C.A.; Carr, J.P. Interference with jasmonic acid-regulated gene expression is a general property of viral suppressors of RNA silencing but only partly explains virus-induced changes in plant–aphid interactions. J. Gen. Virol.; 2014; 95, 733. [DOI: https://dx.doi.org/10.1099/vir.0.060624-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24362960]
82. Sade, D.; Shriki, O.; Cuadros-Inostroza, A.; Tohge, T.; Semel, Y.; Haviv, Y.; Willmitzer, L.; Fernie, A.R.; Czosnek, H.; Brotman, Y. Comparative metabolomics and transcriptomics of plant response to Tomato yellow leaf curl virus infection in resistant and susceptible tomato cultivars. Metabolomics; 2015; 11, pp. 81-97. [DOI: https://dx.doi.org/10.1007/s11306-014-0670-x]
83. Moreno-Delafuente, A.; Garzo, E.; Moreno, A.; Fereres, A. A plant virus manipulates the behavior of its whitefly vector to enhance its transmission efficiency and spread. PLoS ONE; 2013; 8, e61543. [DOI: https://dx.doi.org/10.1371/journal.pone.0061543]
84. Li, Y.; Cui, H.; Cui, X.; Wang, A. The altered photosynthetic machinery during compatible virus infection. Curr. Opin. Virol.; 2016; 17, pp. 19-24. [DOI: https://dx.doi.org/10.1016/j.coviro.2015.11.002]
85. Hodge, S.; Powell, G. Do plant viruses facilitate their aphid vectors by inducing symptoms that alter behavior and performance?. Environ. Entomol.; 2008; 37, pp. 1573-1581. [DOI: https://dx.doi.org/10.1603/0046-225X-37.6.1573]
86. Isaacs, R.; Willis, M.A.; Byrne, D.N. Modulation of whitefly take-off and flight orientation by wind speed and visual cues. Physiol. Entomol.; 1999; 24, pp. 311-318. [DOI: https://dx.doi.org/10.1046/j.1365-3032.1999.00144.x]
87. Hajimorad, M.R.; Domier, L.L.; Tolin, S.A.; Whitham, S.A.; Saghai Maroof, M.A. Soybean mosaic virus: A successful potyvirus with a wide distribution but restricted natural host range. Mol. Plant Pathol.; 2018; 19, pp. 1563-1579. [DOI: https://dx.doi.org/10.1111/mpp.12644]
88. Yan, L.; Xu, Z.; Liao, B. Molecular identification of peanut stripe virus isolated from Sesame (Sesamun indicium L.). Chin. J. Oil Crop Sci.; 2009; 31, 4.
89. Yadav, D.L.; Jaisani, P.; Pandey, R.N.; Chalam, V.C. Detection and molecular characterization of Bean Common mosaic virus in mungbean. Int. J. Chem. Stud.; 2021; 9, pp. 2996-3001. [DOI: https://dx.doi.org/10.22271/chemi.2021.v9.i1ap.11684]
90. Smith, M.R.; Rao, I.M. Chapter 12—Common bean. Crop Physiology Case Histories for Major Crops; Sadras, V.O.; Calderini, D.F. Academic Press: Waltham, MA, USA, 2021; pp. 384-406.
91. Cadle-Davidson, M.M.; Jahn, M.M. Resistance conferred against bean common mosaic virus by the incompletely dominant I locus of Phaseolus vulgaris is active at the single cell level. Arch. Virol.; 2005; 150, pp. 2601-2608. [DOI: https://dx.doi.org/10.1007/s00705-005-0592-z]
92. Drijfhout, E. Genetic interaction between Phaseolus vulgaris and bean common mosaic virus with implications for strain identification and breeding for resistance. Verslagen Van Landbouwkundige Onderzoekingen; Centre for Agricultural Publishing and Documentation: Wageningen, The Netherlands, 1978.
93. Hart, J.P.; Griffiths, P.D. A series of eIF4E alleles at the Bc-3 locus are associated with recessive resistance to Clover yellow vein virus in common bean. Theor. Appl. Genet.; 2013; 126, pp. 2849-2863. [DOI: https://dx.doi.org/10.1007/s00122-013-2176-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23933781]
94. Kelly, J.D.; Afanador, L.; Haley, S.D. Pyramiding genes for resistance to bean common mosaic virus. Euphytica; 1995; 82, pp. 207-212. [DOI: https://dx.doi.org/10.1007/BF00029562]
95. Naderpour, M.; Lund, O.S.; Larsen, R.; Johansen, E. Potyviral resistance derived from cultivars of Phaseolus vulgaris carrying bc-3 is associated with the homozygotic presence of a mutated eIF4E allele. Mol. Plant. Pathol.; 2010; 11, pp. 255-263. [DOI: https://dx.doi.org/10.1111/j.1364-3703.2009.00602.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20447274]
96. Collmer, C.W.; Marston, M.F.; Taylor, J.C.; Jahn, M. The I gene of bean: A dosage-dependent allele conferring extreme resistance, hypersensitive resistance, or spreading vascular necrosis in response to the potyvirus Bean common mosaic virus. Mol. Plant Microbe Interact.; 2000; 13, 1266. [DOI: https://dx.doi.org/10.1094/MPMI.2000.13.11.1266] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11059494]
97. Adams, M.J.; Zerbini, F.M.; French, R.; Rabenstein, F.; Valkonen, J. Family Potyviridae. Virus Taxonomy: 9th Report of the International Committee on Taxonomy of Viruses; Elsevier: Amsterdam, The Netherlands, 2012.
98. Singh, S.P.; Schwartz, H.F. Breeding common bean for resistance to diseases: A review. Crop Science; 2010; 50, pp. 2199-2223. [DOI: https://dx.doi.org/10.2135/cropsci2009.03.0163]
99. Mangeni, B.C.; Were, H.K.; Ndong’a, M.; Mukoye, B. Incidence and severity of bean common mosaic disease and resistance of popular bean cultivars to the disease in western Kenya. J. Phytopathol.; 2020; 168, pp. 501-515. [DOI: https://dx.doi.org/10.1111/jph.12928]
100. Pardina, P.R. Viral diseases in common bean crops in Argentina. Curr. Top. Virol.; 2021; 17, pp. 95-110.
101. Morales, F. Common beans. Natural Resistance Mechanisms of Plants to Viruses; Loebenstein, G.; Carr, J.P. Springer: Dordrecht, The Netherlands, 2006.
102. Feng, X.; Myers, J.R.; Karasev, A.V. Bean common mosaic virus isolate exhibits a novel pathogenicity profile in common bean, overcoming the bc-3 resistance allele coding for the mutated eIF4E translation initiation factor. Phytopathology; 2015; 105, pp. 1487-1495. [DOI: https://dx.doi.org/10.1094/PHYTO-04-15-0108-R]
103. Feng, X.; Orellana, G.E.; Myers, J.R.; Karasev, A.V. Recessive Resistance to Bean common mosaic virus Conferred by the bc-1 and bc-2 Genes in Common Bean (Phaseolus vulgaris) Affects Long-Distance Movement of the Virus. Phytopathology; 2018; 108, pp. 1011-1018. [DOI: https://dx.doi.org/10.1094/PHYTO-01-18-0021-R]
104. Feng, X.; Orellana, G.E.; Green, J.C.; Melzer, M.J.; Hu, J.S.; Karasev, A.V. A New Strain of Bean Common Mosaic Virus from Lima Bean (Phaseolus lunatus): Biological and Molecular Characterization. Plant Dis.; 2019; 103, pp. 1220-1227. [DOI: https://dx.doi.org/10.1094/PDIS-08-18-1307-RE]
105. Feng, X.; Guzmán, P.; Myers, J.R.; Karasev, A.V. Resistance to Bean common mosaic necrosis virus Conferred by the bc-1 Gene Affects Systemic Spread of the Virus in Common Bean. Phytopathology; 2017; 107, pp. 893-900. [DOI: https://dx.doi.org/10.1094/PHYTO-01-17-0013-R]
106. McKern, N.; Shukla, D.; Barnett, O.; Vetten, H.; Dijkstra, J.; Whittaker, L.; Ward, C. Coat protein properties suggest that azuki bean mosaic virus, blackeye cowpea mosaic virus, peanut stripe virus, and three isolates from soybean are all strains of the same potyvirus. Intervirology; 1992; 33, pp. 121-134. [DOI: https://dx.doi.org/10.1159/000150241]
107. Berger, P.; Wyatt, S.; Shiel, P.; Silbernagel, M.; Druffel, K.; Mink, G. Phylogenetic analysis of the Potyviridae with emphasis on legume-infecting potyviruses. Arch. Virol.; 1997; 142, pp. 1979-1999. [DOI: https://dx.doi.org/10.1007/s007050050216]
108. Sáiz, M.; Dopazo, J.; Castro, S.; Romero, J. Evolutionary relationships among bean common mosaic virus strains and closely related potyviruses. Virus Res.; 1994; 31, pp. 39-48. [DOI: https://dx.doi.org/10.1016/0168-1702(94)90069-8]
109. Gibbs, A.; Ohshima, K. Potyviruses and the digital revolution. Annu. Rev. Phytopathol.; 2010; 48, pp. 205-223. [DOI: https://dx.doi.org/10.1146/annurev-phyto-073009-114404]
110. Gibbs, A.J.; Trueman, J.; Gibbs, M.J. The bean common mosaic virus lineage of potyviruses: Where did it arise and when?. Arch. Virol.; 2008; 153, pp. 2177-2187. [DOI: https://dx.doi.org/10.1007/s00705-008-0256-x]
111. Gibbs, A.J.; Ohshima, K.; Phillips, M.J.; Gibbs, M.J. The prehistory of potyviruses: Their initial radiation was during the dawn of agriculture. PLoS ONE; 2008; 3, e2523. [DOI: https://dx.doi.org/10.1371/journal.pone.0002523]
112. Fang, G.W.; Allison, R.F.; Zambolim, E.M.; Maxwell, D.P.; Gilbertson, R.L. The complete nucleotide sequence and genome organization of bean common mosaic virus (NL3 strain). Virus Res.; 1995; 39, pp. 13-23. [DOI: https://dx.doi.org/10.1016/S0168-1702(95)00072-0]
113. Bousalem, M.; Douzery, E.J.; Fargette, D. High genetic diversity, distant phylogenetic relationships and intraspecies recombination events among natural populations of Yam mosaic virus: A contribution to understanding potyvirus evolution. J. Gen. Virol.; 2000; 81, 243. [DOI: https://dx.doi.org/10.1099/0022-1317-81-1-243]
114. Cuevas, J.M.; Delaunay, A.; Visser, J.C.; Bellstedt, D.U.; Jacquot, E.; Elena, S.F. Phylogeography and molecular evolution of potato virus Y. PLoS ONE; 2012; 7, e37853. [DOI: https://dx.doi.org/10.1371/journal.pone.0037853]
115. Moreno, I.M.; Malpica, J.M.; Díaz-Pendón, J.A.; Moriones, E.; Fraile, A.; GarcíA-Arenal, F. Variability and genetic structure of the population of watermelon mosaic virus infecting melon in Spain. Virology; 2004; 318, pp. 451-460. [DOI: https://dx.doi.org/10.1016/j.virol.2003.10.002] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14972570]
116. Ohshima, K.; Tomitaka, Y.; Wood, J.T.; Minematsu, Y.; Kajiyama, H.; Tomimura, K.; Gibbs, A.J. Patterns of recombination in turnip mosaic virus genomic sequences indicate hotspots of recombination. J. Gen. Virol.; 2007; 88, pp. 298-315. [DOI: https://dx.doi.org/10.1099/vir.0.82335-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17170463]
117. Seo, J.K.; Lee, S.H.; Kim, K.H. Strain-specific cylindrical inclusion protein of soybean mosaic virus elicits extreme resistance and a lethal systemic hypersensitive response in two resistant soybean cultivars. Mol. Plant Microbe Interact.; 2009; 22, 1151. [DOI: https://dx.doi.org/10.1094/MPMI-22-9-1151] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19656049]
118. Abadkhah, M.; Hajizadeh, M.; Koolivand, D. Global population genetic structure of Bean common mosaic virus. Arch. Phytopathol. Plant Prot.; 2020; 53, pp. 266-281. [DOI: https://dx.doi.org/10.1080/03235408.2020.1743525]
119. Karasev, A.V.; Gray, S.M. Continuous and emerging challenges of Potato virus Y in potato. Annu. Rev. Phytopathol.; 2013; 51, pp. 571-586. [DOI: https://dx.doi.org/10.1146/annurev-phyto-082712-102332]
120. Karasev, A.V.; Gray, S.M. Genetic diversity of Potato virus Y complex. Am. J. Potato Res.; 2013; 90, pp. 7-13. [DOI: https://dx.doi.org/10.1007/s12230-012-9287-7]
121. Silbernagel, M.J.; Mink, G.I.; Zhao, R.L.; Zheng, G.Y. Phenotypic recombination between bean common mosaic and bean common mosaic necrosis potyviruses in vivo. Arch. Virol.; 2001; 146, pp. 1007-1020. [DOI: https://dx.doi.org/10.1007/s007050170132]
122. Cordero, T.; Mohamed, M.A.; Lopez-Moya, J.-J.; Daròs, J.-A. A recombinant potato virus y infectious clone tagged with the rosea1 visual marker (pvy-ros1) facilitates the analysis of viral infectivity and allows the production of large amounts of anthocyanins in plants. Front. Microbiol.; 2017; 8, 611. [DOI: https://dx.doi.org/10.3389/fmicb.2017.00611]
123. Simon-Loriere, E.; Holmes, E.C. Why do RNA viruses recombine?. Nat. Rev. Microbiol.; 2011; 9, pp. 617-626. [DOI: https://dx.doi.org/10.1038/nrmicro2614]
124. Feng, X.; Poplawsky, A.R.; Nikolaeva, O.V.; Myers, J.R.; Karasev, A.V. Recombinants of bean common mosaic virus (BCMV) and genetic determinants of BCMV involved in overcoming resistance in common bean. Phytopathology; 2014; 104, pp. 786-793. [DOI: https://dx.doi.org/10.1094/PHYTO-08-13-0243-R]
125. Salvador, B.; Saenz, P.; Yanguez, E.; Quiot, J.B.; Quiot, L.; Delgadillo, M.O.; Garcia, J.A.; Simon-Mateo, C. Host-specific effect of P1 exchange between two potyviruses. Mol. Plant Pathol.; 2008; 9, pp. 147-155. [DOI: https://dx.doi.org/10.1111/j.1364-3703.2007.00450.x]
126. Mao, C.; Shan, S.; Huang, Y.; Jiang, C.; Zhang, H.; Li, Y.; Chen, J.; Wei, Z.; Sun, Z. The hypervariable N-terminal of soybean mosaic virus P1 protein influences its pathogenicity and host defense responses. Phytopathol. Res.; 2022; 4, 10. [DOI: https://dx.doi.org/10.1186/s42483-022-00115-3]
127. Jiang, H.; Li, K.; Dou, D.; Gai, J. Characterization of a soybean mosaic virus variant causing different diseases in Glycine max and Nicotiana benthamiana. Arch. Virol.; 2017; 162, pp. 549-553. [DOI: https://dx.doi.org/10.1007/s00705-016-3123-1]
128. Ali, M.A. Genetics of resistance to the common bean mosaic virus (bean virus 1) in the bean (Phaseolus vulgaris L.). Phytopathology; 1950; 40, pp. 69-79.
129. Hart, J.P.; Griffiths, P.D. Genotyping-by-Sequencing Enabled Mapping and Marker Development for the By-2 Potyvirus Resistance Allele in Common Bean. Plant Genome; 2015; 8, plantgenome2014.09.0058. [DOI: https://dx.doi.org/10.3835/plantgenome2014.09.0058]
130. Wu, M.; Wu, W.P.; Liu, C.C.; Liu, Y.N.; Wu, X.Y.; Ma, F.F.; Zhu, A.Q.; Yang, J.Y.; Wang, B.; Chen, J.Q. A bean common mosaic virus (BCMV)-resistance gene is fine-mapped to the same region as Rsv1-h in the soybean cultivar Suweon 97. TAG. Theoretical and applied genetics. Theor. Angew. Genet.; 2018; 131, pp. 1851-1860. [DOI: https://dx.doi.org/10.1007/s00122-018-3117-3]
131. Wu, M.; Liu, Y.N.; Zhang, C.; Liu, X.T.; Liu, C.C.; Guo, R.; Niu, K.X.; Zhu, A.Q.; Yang, J.Y.; Chen, J.Q. et al. Molecular mapping of the gene(s) conferring resistance to Soybean mosaic virus and Bean common mosaic virus in the soybean cultivar Raiden. TAG. Theoretical and applied genetics. Theor. Angew. Genet.; 2019; 132, pp. 3101-3114. [DOI: https://dx.doi.org/10.1007/s00122-019-03409-x]
132. Liu, X.-T.; Wu, X.-Y.; Wu, W.-P.; Wu, M.; Chen, J.-Q.; Wang, B. A bean common mosaic virus-resistance gene in the soybean variant V94-5152 was mapped to the Rsv4 locus conferring resistance to soybean mosaic virus. Theor. Appl. Genet.; 2021; 134, pp. 2367-2377. [DOI: https://dx.doi.org/10.1007/s00122-021-03829-8]
133. Ishibashi, K.; Saruta, M.; Shimizu, T.; Shu, M.; Anai, T.; Komatsu, K.; Yamada, N.; Katayose, Y.; Ishikawa, M.; Ishimoto, M. et al. Soybean antiviral immunity conferred by dsRNase targets the viral replication complex. Nat. Commun.; 2019; 10, 4033. [DOI: https://dx.doi.org/10.1038/s41467-019-12052-5]
134. Miklas, P.N.; Larsen, R.C.; Riley, R.; Kelly, J.D. Potential marker-assisted selection for bc-12 resistance to bean common mosaic potyvirus in common bean. Euphytica; 2000; 116, pp. 211-219. [DOI: https://dx.doi.org/10.1023/A:1004006514814]
135. Obita, T.; Saksena, S.; Ghazi-Tabatabai, S.; Gill, D.J.; Perisic, O.; Emr, S.D.; Williams, R.L. Structural basis for selective recognition of ESCRT-III by the AAA ATPase Vps4. Nature; 2007; 449, pp. 735-739. [DOI: https://dx.doi.org/10.1038/nature06171] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17928861]
136. Amano, M.; Mochizuki, A.; Kawagoe, Y.; Iwahori, K.; Niwa, K.; Svoboda, J.; Maeda, T.; Imura, Y. High-resolution mapping of zym, a recessive gene for Zucchini yellow mosaic virus resistance in cucumber. Theor. Appl. Genet.; 2013; 126, pp. 2983-2993. [DOI: https://dx.doi.org/10.1007/s00122-013-2187-5] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24026172]
137. Barajas, D.; Martín, I.F.d.C.; Pogany, J.; Risco, C.; Nagy, P.D. Noncanonical role for the host Vps4 AAA+ ATPase ESCRT protein in the formation of Tomato bushy stunt virus replicase. PLoS Pathog.; 2014; 10, e1004087. [DOI: https://dx.doi.org/10.1371/journal.ppat.1004087] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24763736]
138. Carberry, S.E.; Goss, D.J.; Darzynkiewicz, E. A comparison of the binding of methylated cap analogs to wheat germ protein synthesis initiation factors 4F and (iso) 4F. Biochemistry; 1991; 30, pp. 1624-1627. [DOI: https://dx.doi.org/10.1021/bi00220a026] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/1993179]
139. Leonard, S.; Plante, D.; Wittmann, S.; Daigneault, N.; Fortin, M.G.; Laliberté, J.F. Complex formation between potyvirus VPg and translation eukaryotic initiation factor 4E correlates with virus infectivity. J. Virol.; 2000; 74, pp. 7730-7737. [DOI: https://dx.doi.org/10.1128/JVI.74.17.7730-7737.2000]
140. Beauchemin, C.; Boutet, N.; Laliberte, J.F. Visualization of the interaction between the precursors of VPg, the viral protein linked to the genome of turnip mosaic virus, and the translation eukaryotic initiation factor iso 4E in Planta. J. Virol.; 2007; 81, pp. 775-782. [DOI: https://dx.doi.org/10.1128/JVI.01277-06]
141. Leonard, S.; Viel, C.; Beauchemin, C.; Daigneault, N.; Fortin, M.G.; Laliberte, J.-F. Interaction of VPg-Pro of Turnip mosaic virus with the translation initiation factor 4E and the poly (A)-binding protein in planta. J. Gen. Virol.; 2004; 85, pp. 1055-1063. [DOI: https://dx.doi.org/10.1099/vir.0.19706-0]
142. Schaad, M.C.; Anderberg, R.J.; Carrington, J.C. Strain-specific interaction of the tobacco etch virus NIa protein with the translation initiation factor eIF4E in the yeast two-hybrid system. Virology; 2000; 273, pp. 300-306. [DOI: https://dx.doi.org/10.1006/viro.2000.0416]
143. Udvardi, M.K.; Kakar, K.; Wandrey, M.; Montanari, O.; Murray, J.; Andriankaja, A.; Zhang, J.Y.; Benedito, V.; Hofer, J.M.; Chueng, F. et al. Legume transcription factors: Global regulators of plant development and response to the environment. Plant Physiol.; 2007; 144, pp. 538-549. [DOI: https://dx.doi.org/10.1104/pp.107.098061]
144. Walter, J.; Barra, A.; Charon, J.; Tavert-Roudet, G.; Michon, T. Spectroscopic Investigation of the Kinetic Mechanism Involved in the Association of Potyviral VPg with the Host Plant Translation Initiation Factor eIF4E. Int. J. Mol. Sci.; 2020; 21, 5618. [DOI: https://dx.doi.org/10.3390/ijms21165618]
145. SahaMkinen. Insights into the Functions of eIF4E-Binding Motif of VPg in Potato Virus A Infection. Viruses; 2020; 12, 197. [DOI: https://dx.doi.org/10.3390/v12020197]
146. Wittmann, S.; Chatel, H.; Fortin, M.G.; Laliberté, J.-F. Interaction of the viral protein genome linked of turnip mosaic potyvirus with the translational eukaryotic initiation factor (iso) 4E of Arabidopsis thaliana Using the yeast two-hybrid system. Virology; 1997; 234, pp. 84-92. [DOI: https://dx.doi.org/10.1006/viro.1997.8634]
147. Ala-Poikela, M.; Rajamaki, M.L.; Valkonen, J.P.T. A Novel Interaction Network Used by Potyviruses in Virus-Host Interactions at the Protein Level. Viruses; 2019; 11, 1158. [DOI: https://dx.doi.org/10.3390/v11121158]
148. Bastet, A.; Robaglia, C.; Gallois, J.-L. eIF4E resistance: Natural variation should guide gene editing. Trends Plant Sci.; 2017; 22, pp. 411-419. [DOI: https://dx.doi.org/10.1016/j.tplants.2017.01.008]
149. Coutinho de Oliveira, L.; Volpon, L.; Rahardjo, A.K.; Osborne, M.J.; Culjkovic-Kraljacic, B.; Trahan, C.; Oeffinger, M.; Kwok, B.H.; Borden, K.L. Structural studies of the eIF4E–VPg complex reveal a direct competition for capped RNA: Implications for translation. Proc. Natl. Acad. Sci. USA; 2019; 116, pp. 24056-24065. [DOI: https://dx.doi.org/10.1073/pnas.1904752116]
150. Zafirov, D.; Giovinazzo, N.; Bastet, A.; Gallois, J. When a knockout is an Achilles’ heel: Resistance to one potyvirus species triggers hypersusceptibility to another one in Arabidopsis thaliana. Mol. Plant Pathol.; 2021; 22, pp. 334-347. [DOI: https://dx.doi.org/10.1111/mpp.13031]
151. Bruun-Rasmussen, M.; Moller, I.S.; Tulinius, G.; Hansen, J.; Johansen, I.E. The same allele of translation initiation factor 4E mediates resistance against two Potyvirus spp. in Pisum sativum. Mol. Plant Microbe Interact.; 2007; 20, 1075. [DOI: https://dx.doi.org/10.1094/MPMI-20-9-1075]
152. Singh, K.B.; Foley, R.C.; Oñate-Sánchez, L. Transcription factors in plant defense and stress responses. Curr. Opin. Plant Biol.; 2002; 5, pp. 430-436. [DOI: https://dx.doi.org/10.1016/S1369-5266(02)00289-3]
153. Cichy, K.A.; Porch, T.G.; Beaver, J.S.; Cregan, P.; Fourie, D.; Glahn, R.P.; Grusak, M.A.; Kamfwa, K.; Katuuramu, D.N.; McClean, P. A Phaseolus vulgaris diversity panel for Andean bean improvement. Crop Sci.; 2015; 55, pp. 2149-2160. [DOI: https://dx.doi.org/10.2135/cropsci2014.09.0653]
154. Kaminaka, H.; Näke, C.; Epple, P.; Dittgen, J.; Schütze, K.; Chaban, C.; Holt III, B.F.; Merkle, T.; Schäfer, E.; Harter, K. bZIP10-LSD1 antagonism modulates basal defense and cell death in Arabidopsis following infection. EMBO J.; 2006; 25, pp. 4400-4411. [DOI: https://dx.doi.org/10.1038/sj.emboj.7601312]
155. Liao, Y.; Zhang, J.S.; Chen, S.Y.; Zhang, W.K. Role of soybean GmbZIP132 under abscisic acid and salt stresses. J. Integr. Plant Biol.; 2008; 50, pp. 221-230. [DOI: https://dx.doi.org/10.1111/j.1744-7909.2007.00593.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18713445]
156. Alves, M.S.; Dadalto, S.P.; Gonçalves, A.B.; De Souza, G.B.; Barros, V.A.; Fietto, L.G. Plant bZIP transcription factors responsive to pathogens: A review. Int. J. Mol. Sci.; 2013; 14, pp. 7815-7828. [DOI: https://dx.doi.org/10.3390/ijms14047815] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23574941]
157. Gao, M.; Zhang, H.; Guo, C.; Cheng, C.; Guo, R.; Mao, L.; Fei, Z.; Wang, X. Evolutionary and expression analyses of basic zipper transcription factors in the highly homozygous model grape PN40024 (Vitis vinifera L.). Plant Mol. Biol. Report.; 2014; 32, pp. 1085-1102. [DOI: https://dx.doi.org/10.1007/s11105-014-0723-3]
158. Liu, Y.; Schiff, M.; Marathe, R.; Dinesh-Kumar, S. Tobacco Rar1, EDS1 and NPR1/NIM1 like genes are required for N-mediated resistance to tobacco mosaic virus. Plant J.; 2002; 30, pp. 415-429. [DOI: https://dx.doi.org/10.1046/j.1365-313X.2002.01297.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12028572]
159. Engalycheva, I.A. Development pecularities of bean common mosaic virus(Potyvirus, Potyviridae) in moscow region and initial material for resistance breeding. Sel’skokhozyaistvennaya Biol.; 2020; 55, pp. 901-919. [DOI: https://dx.doi.org/10.15389/agrobiology.2020.5.901eng]
160. Osorno, J.M.; Wal, A.; Posch, J.; Simons, K.; Grafton, K.F.; Pasche, J.S. ‘ND Whitetail’, a new white kidney bean with high seed yield and intermediate resistance to white mold and bacterial blights. J. Plant Regist.; 2020; 14, pp. 102-109. [DOI: https://dx.doi.org/10.1002/plr2.20012]
161. Parker, T. Development of Phenotyping Methods and Genetic Resources for Common Bean Improvement. Ph.D. Thesis; University of California: Davis, CA, USA, 2020.
162. Chiquito-Almanza, E.; Caballero-Pérez, J.; Acosta-Gallegos, J.A.; Montero-Tavera, V.; Mariscal-Amaro, L.A.; Anaya-López, J. Diversity and Distribution of Viruses Infecting Wild and Domesticated Phaseolus spp. in the Mesoamerican Center of Domestication. Viruses; 2021; 13, 1153. [DOI: https://dx.doi.org/10.3390/v13061153]
163. Amir, W.; Bhat, M.A.; Mir, A.; Dar, A.; Sofi, P.A. Screening of Genotypes for Identification of Resistant Genotypes for BCMV. Res. J. Agric. Sci.; 2017; 8, pp. 320-323.
164. Mukeshimana, G.; Pañeda, A.; Rodríguez-Suárez, C.; Ferreira, J.J.; Giraldez, R.; Kelly, J.D. Markers linked to the bc-3 gene conditioning resistance to bean common mosaic potyviruses in common bean. Euphytica; 2005; 144, pp. 291-299. [DOI: https://dx.doi.org/10.1007/s10681-005-7397-8]
165. Portilla, A.E.; Mayor-Duran, V.M.; Buendia, H.F.; Blair, M.W.; Cichy, K.; Raatz, B. Climbing bean breeding for disease resistance and grain quality traits. Legume Sci.; 2021; 4, e122. [DOI: https://dx.doi.org/10.1002/leg3.122]
166. Urrea, C.A.; Hurtado-Gonzales, O.P.; Pastor-Corrales, M.A.; Steadman, J.R. Registration of Great Northern Common Bean Cultivar ‘Panhandle Pride’ with Enhanced Disease Resistance to Bean Rust and Common Bacterial Blight. J. Plant Regist.; 2019; 13, pp. 311-315. [DOI: https://dx.doi.org/10.3198/jpr2019.02.0006crc]
167. Manjunatha, N.; Rangaswamy, K.; Sah, R.; Nagaraju, N.; Rudraswamy, P. Characterization and identification of SSR markers for screening of cowpea genotypes against Bean common mosaic virus (BCMV) disease resistance. Legume Res.; 2017; 40, pp. 878-883. [DOI: https://dx.doi.org/10.18805/LR-3673]
168. Bruckner, F.P.; Andrade, P.O.; de Souza Cascardo, R.; Laliberté, J.-F.; Alfenas-Zerbini, P. Translationally controlled tumour protein: A protein necessary for potyvirus intracellular multiplication that supports plant infection by unrelated viruses. Ann. Appl. Biol.; 2022; 180, pp. 90-98. [DOI: https://dx.doi.org/10.1111/aab.12708]
169. Bruckner, F.P.; da Silva Xavier, A.; de Souza Cascardo, R.; Otoni, W.C.; Zerbini, F.M.; Alfenas-Zerbini, P. Translationally controlled tumor protein (TCTP) from tomato and Nicotiana benthamiana is necessary for successful infection by A Potyvirus. Mol. Plant Pathol.; 2017; 18, pp. 672-683. [DOI: https://dx.doi.org/10.1111/mpp.12426]
170. Kyrychenko, A. Seed transmission of bean common mosaic virus in Phaseolus vulgaris cv Chervona Shapochka. Biol. Syst. Theory Innov.; 2020; 11, pp. 587-597. [DOI: https://dx.doi.org/10.31548/biologiya2020.01.069]
171. Worrall, E.A.; Bravo-Cazar, A.; Nilon, A.T.; Fletcher, S.J.; Robinson, K.E.; Carr, J.P.; Mitter, N. Exogenous application of RNAi-inducing double-stranded RNA inhibits aphid-mediated transmission of a plant virus. Front. Plant Sci.; 2019; 10, 265. [DOI: https://dx.doi.org/10.3389/fpls.2019.00265]
172. Megasari, D.; Damayanti, T.A.; Santoso, S. Pengendalian Aphis craccivora Koch. dengan kitosan dan pengaruhnya terhadap penularan Bean common mosaic virus strain Black eye cowpea (BCMV-BlC) pada kacang panjang. J. Entomol. Indones.; 2014; 11, pp. 72-80. [DOI: https://dx.doi.org/10.5994/jei.11.2.72]
173. Elsharkawy, M.M.; Shimizu, M.; Takahashi, H.; Hyakumachi, M. Induction of systemic resistance against Cucumber mosaic virus by Penicillium simplicissimum GP17-2 in Arabidopsis and tobacco. Plant Pathol.; 2012; 61, pp. 964-976. [DOI: https://dx.doi.org/10.1111/j.1365-3059.2011.02573.x]
174. Elsharkawy, M.M.; Shimizu, M.; Takahashi, H. The plant growth-promoting fungus Fusarium equiseti and the arbuscular mycorrhizal fungus Glomus mosseae induce systemic resistance against Cucumber mosaic virus in cucumber plants. Plant Soil; 2012; 361, pp. 397-409. [DOI: https://dx.doi.org/10.1007/s11104-012-1255-y]
175. Roossinck, M.J. Symbiosis versus competition in plant virus evolution. Nat. Rev. Microbiol.; 2005; 3, pp. 917-924. [DOI: https://dx.doi.org/10.1038/nrmicro1285]
176. Melotto, M.; Afanador, L.; Kelly, J. Development of a SCAR marker linked to the I gene in common bean. Genome; 1996; 39, pp. 1216-1219. [DOI: https://dx.doi.org/10.1139/g96-155] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/8983191]
177. Johnson, W.C.; Guzmán, P.; Mandala, D.; Mkandawire, A.B.; Temple, S.; Gilbertson, R.; Gepts, P. Molecular tagging of the bc-3 gene for introgression into Andean common bean. Crop Sci.; 1997; 37, pp. 248-254. [DOI: https://dx.doi.org/10.2135/cropsci1997.0011183X003700010044x]
178. Haley, S.D.; Afanador, L.; Kelly, J.D. Selection for monogenic pest resistance traits with coupling-and repulsion-phase RAPD markers. Crop Sci.; 1994; 34, pp. 1061-1066. [DOI: https://dx.doi.org/10.2135/cropsci1994.0011183X003400040041x]
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Xue, Feng