1. Introduction
The global spread of carbapenem-resistant Enterobacteriaceae (CRE) has been a pressing threat to public health [1], and such pathogens have been disseminated widely in clinical settings in many counties, including China [2]. New Delhi metallo-β-lactamase (NDM) has been the main type of carbapenemases conferring resistance to almost all β-lactams, and CRE is the most common NDM carriers [3]. NDM-producing CRE isolates have been frequently found in humans [4], hospital wastewater [5] and animals [3] around the world. With the rapid increase in CRE, colistin has been re-used as the “last line of defense” for the treatment of CRE [6]. However, several mcr variants have been identified in various Enterobacteriaceae species [7], challenging the efficacy of colistin. The concurrence of colistin resistance in CRE isolates has been a great clinical concern, challenging the clinical usefulness of both colistin and carbapenems. In recent years, mcr has emerged in CRE isolates from humans [8], animals [9] and retail meats [10] in many countries.
Fresh vegetables have been associated with foodborne diseases [11], and the bacteria contaminated in fresh vegetables often serve as a reservoir of antimicrobial resistance genes [12,13]. The consumption of fresh vegetables eaten raw may result in transmitting antimicrobial resistant bacteria to humans [14], posing a threat to the health of consumers. The mcr-positive isolates among fresh vegetables have been reported in a few countries, including Portugal [15], Switzerland [16], South Korea [17] and China [18], and the prevalence of such bacteria in vegetables remains very low. Worryingly, CRE has also been found in vegetables in limited reports with a very low prevalence [14,19,20]. All these findings suggest that carbapenem resistance and colistin resistance have emerged in fresh vegetables, and one of the major concerns is the concurrence of carbapenemase genes and mcr in the same isolate from fresh vegetables eaten raw. To date, two E. coli isolates carrying both mcr-1 and blaNDM in fresh vegetables have been only reported in our previous study [12]. Sustained surveillance of CRE carrying mcr among fresh vegetables is needed to ensure food consumers’ health.
Proteus mirabilis is intrinsically resistant to polymyxins and tigecycline and is a zoonotic opportunistic pathogen that belongs to Enterobacteriaceae. P. mirabilis is notorious for its ability to actively disseminate antimicrobial resistance genes through horizontal gene transfer, and multidrug-resistant (MDR) P. mirabilis isolates, including some carrying blaNDM, have triggered nosocomial infections in many counties [21]. Furthermore, P. mirabilis is generally associated with food spoilage and can also cause foodborne illness when consumed in contaminated food, especially meat and vegetables [22,23]. P. mirabilis from vegetables has been linked with foodborne illness [24]. However, there has been no report about blaNDM-positive P. mirabilis isolates from fresh vegetables, especially in China, in which CRE isolates from vegetables have occurred. To gain insight into the characteristics and potential role of foodborne CRE isolates in disseminating MDR to humans, the present study was carried out to identify carbapenem-resistant P. mirabilis and mcr-1-positive E. coli possessing blaNDM in fresh vegetables. The molecular and sequence characteristics of these foodborne CRE isolates were further scrutinized by using bioinformatic analysis.
2. Materials and Methods
2.1. Identification of P. mirabilis and E. coli Harboring Carbapenemases Genes
A total of 720 fresh vegetable samples were included in this study, including 712 samples in our previous report [12] and eight fresh vegetable samples (one green pepper, three cucumber, two lettuce and two tomato samples) collected in one farmer’s market and one supermarket in Hangzhou of Zhejiang Province, China, in June 2019. These samples were processed with MH broth (Hope Bio-Technology Co., Qingdao, China) containing meropenem (1 µg/mL) and vancomycin (30 µg/mL) using the same protocol as previously described [20]. Carbapenem-resistant P. mirabilis isolates were isolated by streaking onto Salmonella Shigella (SS) agar plates (Hope, Qingdao, China) containing 30 µg/mL of vancomycin and 1 µg/mL of meropenem and incubated at 37 °C for 16–20 h. The representative clones were isolated, purified and confirmed to be P. mirabilis by using 16 S rDNA sequencing [25]. The samples containing carbapenem-resistant P. mirabilis were subsequently used to isolate E. coli using MacConkey Agar (Hope, Qingdao, China) supplemented with meropenem (1 µg/mL), as we previously reported [12]. The obtained meropenem-resistant P. mirabilis and E. coli isolates were detected for the carbapenemase genes (blaNDM, blaKPC, blaIMP, blaOXA-48, blaVIM, blaGIM, blaSPM, blaDIM, blaAIM, blaBIC and blaSIM) using the previously described method [26]. The mcr (mcr-1~mcr-10) genes were also detected among the E. coli isolates [7,27].
2.2. Detection of Virulence Genes for P. mirabilis and Diarrheagenic E. coli
Diarrheagenic E. coli pathotypes, including enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), shiga toxin-producing E. coli (STEC), enteroinvasive E. coli (EIEC) and enteroaggregative E. coli (EAEC) were identified using the previously described PCR method [28]. The criteria used for determining pathotypes were as follows: isolates carrying eaeA and escV and possible additional genes ent and bfpB were EPEC; isolates carrying elt and/or estla or estlb were ETEC; isolates carrying stx1 and/or stx2 and possible additional eaeA were STEC; isolates carrying invE and ipaH were EIEC; isolates carrying pic and/or aggR were EAEC. Diffusely adherent E. coli (DAEC) was identified by specific PCR for afa/dr as previously reported [29]. For P. mirabilis, the detection of eight virulence genes (ptA, zapA, ucaA, ireA, hpmA, mrpA, pmfA and atfA) that are often found in isolates from urinary tract infection was performed by using PCR, as previously described [30].
2.3. Antimicrobial Susceptibilities
Antimicrobial susceptibilities to 13 antimicrobials were determined for the obtained meropenem-resistant E. coli isolates using the broth microdilution method [31]. The 13 antimicrobial agents included cefotaxime, ceftazidime, ampicillin, meropenem, ciprofloxacin, levofloxacin, nalidixic acid, kanamycin, amikacin, streptomycin, tigecycline, tetracycline and colistin. Except for tigecycline and colistin, the susceptibilities to the remaining 11 antimicrobials were also measured for P. mirabilis isolates using the broth microdilution method. The resistant criteria recommended by the 2019 EUCAST were used for tigecycline and colistin [32], and the results for the remaining 11 drugs were interpreted according to the CLSI breakpoints [31].
2.4. Multilocus Sequence Typing of E. coli
Multilocus sequence typing (MLST) of E. coli carrying carbapenemases genes was performed [33]. Sequence types of E. coli were identified according to the databases (
2.5. Plasmid Conjugation and Replicon Typing
To investigate the transferability of blaNDM and mcr-1, conjugation experiment was carried out using P. mirabilis isolates harboring carbapenemase genes and mcr-positive E. coli carrying carbapenemase genes as the donors. E. coli C600 resistant to streptomycin was used as a recipient, and the broth mating method was performed as previously reported [34]. Eosin methylene blue (EMB) agar containing both colistin (2.5 µg/mL) and streptomycin (2000 µg/mL) was used to screen mcr-positive transconjugants, while MacConkey agar plates containing both meropenem (1 µg/mL) and streptomycin (2000 µg/mL) were used to isolate transconjugants harboring carbapenemase genes. Transconjugants were confirmed using the PCRs mentioned above, and antimicrobial susceptibilities for transconjugants were also determined. Plasmid replicon types within transconjugants were detected using a PCR method [35], and the IncI2 and IncX3 replicons were also screened [36,37].
2.6. Whole Genome Sequencing and Phylogenetic Analysis
To investigate the genetic properties of isolates and plasmids carrying mcr/blaNDM, whole genome sequencing (WGS) was carried out for the meropenem-resistant P. mirabilis (n = 2), E. coli (n = 3) and the transconjugants (n = 3) from P. mirabilis. Briefly, the total DNA of these isolates was extracted, respectively, and then was subjected to 250 bp paired-end WGS using the Illumina Hiseq 2500 platform (Illumina, Santiago, CA, USA). SPAdes v3.8.2 was used to assemble the Illumina sequence reads. Oxford Nanopore MinION sequencer was used to further sequence the E. coli isolate M15061H and P. mirabilis M15061B from the same lettuce sample. Unicycler v0.4.7 was used to assemble the MinION reads, and high-quality Illumina reads. MLSTs of E. coli isolates were confirmed by submitting genome sequences to MLST 2.0 (
To analyze the phylogenetic relationships of the mcr-1-positive E. coli isolates carrying blaNDM in this study and those reported from humans and animals, we used our 3 E. coli genomes from fresh vegetables and 57 assembled genomes carrying mcr-1 or blaNDM from different countries and sources in the pathogen database of NCBI (
2.7. Characterization of Plasmids Carrying blaNDM or mcr
For the nanopore-sequenced E. coli M15061H and P. mirabilis M15061B, the complete plasmid sequences carrying blaNDM were obtained, while the plasmid SPAdes tool (
2.8. Data Availability
The two mcr-1-bearing E. coli isolates carrying blaNDM (M15071H, M15081H) and blaNDM-bearing E. coli M15061H have been deposited in BioProject PRJNA869497, which also contains the three blaNDM-positive transconjugants from P. mirabilis. The sequences of blaNDM-positive P. mirabilis M15061B and M15101B have been submitted to NCBI under the BioProject PRJNA869497.
3. Results
3.1. Virulence Genes and Concurrence of blaNDM-Positive P. mirabilis and E. coli from the Same Fresh Vegetables
In this study, carbapenem-resistant P. mirabilis isolates were found in five of the eight vegetable samples from one farmer’s market and one supermarket in Zhejiang Province. The five P. mirabilis isolates were from one tomato, two lettuce and two cucumber samples (Table 1). Notably, five carbapenem-resistant E. coli isolates were also isolated from the five fresh vegetables, respectively. All P. mirabilis isolates carried blaNDM, and blaNDM-1 was the most prevalent type (n = 4), while blaNDM-5 was found in all E. coli isolates (Table 1). Worryingly, except M15061H, the remaining four E. coli isolates co-harbored mcr-1 and blaNDM-5. Notably, four vegetable samples carried both blaNDM-1 and blaNDM-5. All 15 virulence genes used for identifying diarrheagenic E. coli pathotypes were not found in our E. coli isolates, indicating that they were generic E. coli. Of the eight virulence genes detected, seven, including hpmA, mrpA, ptA, ireA, zapA, pmfA and atfA, were found in all the five blaNDM-positive P. mirabilis (Table 1).
3.2. Antimicrobial Resistance Patterns of blaNDM-Positive P. mirabilis and generic E. coli Isolates
The five blaNDM-positive E. coli isolates showed multidrug resistances, including resistance to β-lactams, aminoglycosides, tetracyclines and fluoroquinolones. Notably, the four E. coli isolates carrying both mcr-1 and blaNDM were also resistant to colistin (≥4 g/L) (Table 2). In the blaNDM-positive P. mirabilis isolates, M15061B was susceptible to fluoroquinolones, while the remaining isolates showed resistance to fluoroquinolones. All P. mirabilis isolates were also multidrug-resistant, including resistances to all β-lactams tested. In this study, only the P. mirabilis strain M15092B was resistant to amikacin. Luckily, all five blaNDM-positive E. coli strains remained susceptible to both amikacin and tigecycline.
3.3. MLST Typing and Transfer of blaNDM or mcr-1
MLST analysis showed that all four E. coli isolates harboring both mcr-1 and blaNDM-5 from three types of vegetables in two markets belonged to the ST6050 type, while isolate M15061H harboring only blaNDM-5 was the ST533 type (Table 1). Transconjugants containing blaNDM were obtained in all 10 isolates in this study, and the carriage of blaNDM resulted in all transconjugants being resistant to ampicillin, cefotaxime, meropenem and ceftazidime (Table 2). Only IncX3 replicon was found in the five blaNDM-positive transconjugants from E. coli, while the replicons in three P. mirabilis-derived transconjugants were untypable (Table 2). Notably, two plasmid replicons were found in transconjugants M15092BT. The mcr-1 in the four ST6050 E. coli isolates could not be transferred into the recipient E. coli C600, although the conjugation experiment was performed three times.
3.4. Genomic Characteristics and Phylogenetic Analysis
WGS analysis showed that nanopore-sequenced E. coli M15061H possessed 16 types of resistance genes, including resistance to aminoglycosides (aph(3′)-Ia, aph(6)-Id, aph(3″)-Ib and aadA5), tetracyclines (tet(A)), sulfonamides (sul2 and sul1), trimethoprim (dfrA17), peroxide (sitABCD), macrolides (mph(A)), β-lactams (blaNDM-5, blaCTX-M-14 and blaTEM-1B), fluoroquinolones (gyrA: (S83L, D87N), parC: S80I) and bleomycin (bleMBL) (Table 3). Both Illumina-sequenced E. coli isolates (M15071H and M15081H) from different types of vegetables had identical resistance genotypes, and both carried 21 resistance genes, including aminoglycosides (aph(3′)-Ia, aph(6)-Id, aac(3)-IV, aph(3″)-Ib, aph(4)-Ia and aadA2), tetracyclines (tet(M) and tet(A)), trimethoprim (dfrA12), fosfomycin (fosA3), amphenicol (catB3), rifamycin (arr-3), macrolides (mph(A)), fluoroquinolones (gyrA: (S83L, D87N), parC: S80I, and aac(6′)-Ib-cr), β-lactams (blaCTX-M-3, blaNDM-5 and blaOXA-1), bleomycin (bleMBL) and colistin (mcr-1) resistance genes (Table 3). The three sequenced E. coli isolates carried 14–21 virulence genes (Table 3).
The two sequenced P. mirabilis isolates M15061B and M15101B shared the same resistance genotypes, including aminoglycosides (aph(4)-Ia, aac(3)-IV and aadA2), tetracyclines (tet(J)), sulfonamides (sul2 and sul1), amphenicol (cat and floR), rifamycin (arr-3), β-lactams (blaNDM-1), bleomycin (bleMBL) and lincosamide (lnu(F)) (Table 3). The three sequenced blaNDM-positive transconjugants derived from P. mirabilis shared some resistance genes, including sulfonamides (sul2 and sul1), β-lactams (blaNDM) and bleomycin (bleMBL). All three transconjugants also harbored 3–7 diverse aminoglycosides resistance genes.
Based on the phylogenetic results of WGS, a total of 41,286 SNPs was obtained from these 60 mcr-1 and/or blaNDM-positive E. coli isolates from different origins and counties. These 60 E. coli isolates were clustered into 5 clades (Figure 1A). The two mcr-1-positive NDM-producing ST6050 isolates M15071H and M15081H in this study belonged to clade I and had a limited number of variations (7 SNPs), although they were from different types of vegetables in the same market. The blaNDM-5-positive M15061H belonged to clade II and had a large number of variations from M15071H and M15081H (19,597 to 19,604 SNPs). Notably, both the E. coli isolates in our study, M15071H and M15081H, were closely clustered together with previously reported blaNDM/mcr-1-positive isolates (e.g., isolates A20, L935) from humans in different countries, especially China. The blaNDM/mcr-1-positive E. coli isolates from animals (isolates 50080, 1003p and 51008369SK1) and environments (isolates HD6415, ICBEC3AM and ME2L-20-113) from different countries, including China, were also clustered together with our two foodborne E. coli isolates (M15071H and M15081H) (Figure 1A). M15061H, carrying blaNDM-5 in this study, was also clustered together with previously reported blaNDM/mcr-1-bearing isolates from animals, humans and environments in different countries, including China.
A total of four phylogenetic clades were observed among the 17 NDM-producing P. mirabilis isolates, and 20,792 SNPs were obtained. Two blaNDM-positive P. mirabilis isolates (M15061B and M15101B) from different vegetable samples and different markets in this study were clustered together and had no SNP variation (0 SNPs) (Figure 1B). It is worth noting that the two vegetable-sourced blaNDM-positive P. mirabilis isolates in this study were clustered together with animal-sourced isolates from China, which were mainly located in clade II. All NDM-producing P. mirabilis isolates from humans were located in clades I and III, including clinical isolates from humans in China (Figure 1B).
3.5. Sequences of Plasmids Harboring mcr-1
The two Illumina-sequenced E. coli isolates carrying both mcr-1 and blaNDM (M15071H and M15081H) harbored IncHI2 plasmids with mcr-1. Both mcr-1-harboring IncHI2 plasmids pmcr_M15071H and pmcr_M15081H were about 177 kb in size and carried 13 types of resistance genes, which included colistin (mcr-1), β-lactams (blaOXA-1), trimethoprim (dfrA12), fluoroquinolones (two copies of aac(6′)-Ib-cr), aminoglycosides (aph(4)-Ia, aph(3″)-Ib, aac(3)-IV, aph(6)-Id and aadA2), tetracyclines (tet(A)), rifamycin (arr-3) and amphenicol (catB3) (Table 4). In both IncHI2 plasmids, except mcr-1, the remaining resistance genes were located in the MDR region, which contained multiple insertion sequences. One copy of ISApl1 was adjacent to mcr-1 in the two mcr-1-harboring plasmids in the current study and a tellurium resistance region, including terYXWZABCDEF, was also detected in both plasmids (Figure 2A). Besides the MDR region, the two IncHI2 plasmids also possessed other backbone structures of the typical IncHI2-type plasmid pHNSHP45-2 (accession no. KU341381), including maintenance systems (parA and parB), plasmid replication (repHI2 and repHIA) and transfer-associated regions (trh and tra series genes) (Figure 2A). The two mcr-1-positive plasmids of ~177 kb in our study were highly similar (≥98%) to mcr-1-positive plasmids pHNSHP45-2 (accession no. KU341381, 251 kb) and pSH16G1394 (accession no. NZ_MK477614, 252 kb) from pig-sourced E. coli and clinical Salmonella in China, respectively (Figure 2A). However, the plasmids pmcr_M15071H and pmcr_M15081H had only 70% of the sequences of typical mcr-1-harboring IncHI2 plasmids. When compared to pSH16G1394 and pHNSHP45-2, both plasmids (pmcr_M15071H and pmcr_M15081H) in our study lacked seven resistance genes, including fosA3, blaCTX-M-14, floR, cmlA, sul3, oqxA and oqxB. Notably, both the typical mcr-1-bearing IncHI2 plasmids (pSH16G1394 and pHNSHP45-2) contained transfer regions 1 (traJ~trhG genes) and transfer region 2 (trhI~trhL genes). However, transfer region 1 was not found in our mcr-1-bearing IncHI2 plasmids from vegetables (Figure 2A), which led to the failure of conjugation for our two plasmids. Both pmcr_M15071H and pmcr_M15081H were highly similar to pE-T84-1-mcr-1 (CP090269, 185 kb) (99.96% identity and 91% coverage) from clinical E. coli and plas4.1.1 (NZ_CP047116, 190 kb) (99.98% identity and 98% coverage) from chicken-sourced Salmonella in China (Figure 2A).
In order to investigate whether the backbone structures of mcr-1-bearing IncHI2 plasmids in unsequenced E. coli isolates (M15092H and M15101H) were similar to pmcr_M15071H, seven pairs of primers were designed. The seven pairs of primers were designed according to transfer region 2 (trhE-trhK, trhV-trhC and traU-traN), domain protein (DUF and VWA), heavy metal resistance (terZ-terD), tetracycline resistance (tetR(A)-tet(A)) and partial transfer region 1 (traI-traG) of pHNSHP45-2(KU341381) (Table 5 and Figure 2A). Except for transfer region 1 (traI-traG), the remaining six regions detected were all found in M15092H and M15101H, confirming that the backbone structure of the mcr-1-bearing plasmids in the two unsequenced E. coli as highly similar to pmcr_M15071H. Thus, all four IncHI2 plasmids carrying mcr-1 in the current study were pmcr_M15071H-like plasmids and lacked transfer region 1.
3.6. Sequence Analysis of Plasmids Harboring blaNDM
The blaNDM-5-positive plasmid pNDM5_M15061H (CP102807, 46,161 bp) was IncX3 type. In addition to pNDM5_M15061H, isolate M15061H also carried seven additional plasmids, including one IncFII resistance plasmid (~152 kb) with 11 resistance genes (aph(3′)-Ia, aph(3″)-Ib, aph(6)-Id, aadA5, blaTEM-1B, tet(A), dfrA17, sul1, sul2, mph(A) and sitABCD), and one IncY resistance plasmid (~152 kb) with blaCTX-M-14 (Table 4). In the four sequenced isolates or transconjugants with IncX3 replicon, blaNDM-carrying IncX3 plasmids were found in three E. coli isolates (pNDM5_M15061H, pNDM5_M15071H and pNDM5_M15081H) and one P. mirabilis (pNDM5_M15092B), and all these IncX3 plasmids were about 46 kb in size (Figure 2B and Table 4). All blaNDM-5-bearing IncX3 plasmids in this study carried two resistance genes (bleomycin resistance gene bleMBL and blaNDM-5) (Table 4). Besides resistance genes, the four IncX3 plasmids also contained transfer-related region (pilx series of genes), maintenance system (parB and parA) and plasmid replication gene (repB) (Figure 2B). Notably, all four IncX3 plasmids in this study were similar (99.99% identity and 100% coverage) to the blaNDM-bearing IncX3 plasmids pKW53T (KX214669, 46,161 bp) from the urinary tract infection patient in Kuwait, pCREC-591_4 (CP024825, 46,161 bp) from patient ascites in Korea, pNDM-SCCRK18-72 (MN565271, 46,161 bp) from swine in China and our previously reported pVH1 (CP028705, 46,161 bp) from vegetables in China (Figure 2B).
In the nanopore-sequenced P. mirabilis isolate M15061B from lettuce, only one untypeable blaNDM-1-bearing plasmid pNDM1_M15061B (CP102813, 186,140 bp) was found. The pNDM1_M15061B carried ten types of resistance genes, including genes resistant to β-lactams (blaNDM-1), bleomycin (bleMBL), sulfonamides (sul2 and sul1), aminoglycosides (aadA2, aac(3)-IV and aph(4)-Ia), rifamycin (arr-3), amphenicol (floR) and lincosamide (lnu(F)) (Table 4 and Figure 3A). The ten types of resistance genes were all located in the MDR region of ~61 kb on plasmid pNDM1_M15061B (Figure 3A and Figure 4). Resistance genes bleMBL, blaNDM-1, arr-3 and sul1 were embedded in an ISCR1 complex class 1 integron, and the structure of this class 1 integron (sul1-△qacE-arr-3-blaNDM-1-bleMBL-ISCR1) was about 6 kb in size (Figure 3A and Figure 4). Notably, there were five copies of this ISCR1 complex class 1 integron on the plasmid pNDM1_M15061B in this study.
The plasmid contigs of the three untypable blaNDM-bearing plasmids pNDM_M15071B, pNDM_M15081B and pNDM_M15101B in P. mirabilis were also identified, and the sizes of the total plasmid contigs were about 158–163 kb. The two plasmids pNDM1_M15081B and pNDM1_M15101B also carried the same ten types of resistance genes as pNDM1_M15061B, while pNDM1_M15071B lacked sul1 but had additional macrolides resistance gene mph(A) (Table 4). Notably, like pNDM1_M15061B, ISCR1 complex class 1 integron (sul1-△qacE-arr-3-blaNDM-1-bleMBL-ISCR1) was also found on the three plasmids (pNDM_M15071B, pNDM_M15081B and pNDM_M15101B) (Figure 3B and Figure 4). All four untypable blaNDM-bearing plasmids from P. mirabilis isolates contained multiple transposases. Some resistance genes were flanked by two homologous IS sequences to form composite transposons, such as ISVsa3-floR-ISVsa3 (~5 kb) and IS26-aph(4)-Ia-acc(3)-IVa-IS26 (~4 kb) on these plasmids in this study, leading to the integration of resistance genes into chromosomes or plasmids (Figure 4). These four untypable blaNDM-bearing plasmids also carried a mercury resistance region containing merRTPCADE, transfer-related region (tra series genes) and maintenance systems such as parB (Figure 3A,B). All four untypable plasmids in P. mirabilis from fresh vegetables in the current study were highly similar (100% identity, >98% coverage) to plasmid pSNYG35 (CP047590, 165,923 bp) from P. mirabilis of chicken in China and pDY.F1.2 (CP046050, 165,918 bp) from P. mirabilis of swine in China. However, pNDM1_M15061B had four additional copies of ISCR1 complex class 1 integron (sul1-qacE-arr-3-blaNDM-1-bleMBL-ISCR1, ~6 kb) compared with untypable blaNDM-bearing pSNYG35 (Figure 3 and Figure 4).
4. Discussion
It is well known that the mcr-carrying isolates or CRE pose a great threat to public health. To date, more than 40 subtypes of NDM have been reported in more than 60 species of bacteria from humans, animals and environments, with a high prevalence of NDM-producing Enterobacteriaceae, especially E. coli [3,41]. P. mirabilis, a member of Enterobacteriaceae, is an opportunistic pathogen for humans and animals. P. mirabilis is also a foodborne pathogen, and P. mirabilis from vegetables has been linked with foodborne illness [24]. However, there has been no report about blaNDM-positive P. mirabilis isolates from fresh vegetables, especially in China. Currently, studies about vegetable-sourced E. coli isolates co-carrying mcr and carbapenemases are still lacking. Here, we identified, for the first time, five blaNDM-positive P. mirabilis and five blaNDM-bearing E. coli concurrently from the same five fresh vegetables in China, and four of the five E. coli also carried mcr-1, confirming that fresh vegetables have been an important reservoir for blaNDM-positive Enterobacteriaceae, including P. mirabilis.
In this study, five fresh vegetable samples co-harbored blaNDM-positive P. mirabilis and E. coli carrying blaNDM, including two lettuces, two cucumbers and one tomato. The two cucumber samples from one market and one supermarket, respectively, harbored P. mirabilis with different subtypes of NDM. The two lettuces of different sampling origins also carried different ST types of blaNDM-positive E. coli. These results indicate that these five samples may be from different vegetable farms. In this study, ST6050 was the prevalent type of E. coli harboring both mcr-1 and blaNDM from fresh vegetables, different from that in our previous report [12], in which the two E. coli carrying both mcr-1 and blaNDM belonged to ST2847 and ST156, respectively. To our knowledge, this is the first report of ST6050 type of E. coli co-carrying mcr-1 and blaNDM, especially in food. Carbapenemase-producing ST533 E. coli has appeared in patients [42]. Therefore, the ST533 E. coli carrying blaNDM-5 in lettuce will be a threat to human health. Luckily, all blaNDM-positive E. coli isolates in this study were not diarrheagenic E. coli. However, the blaNDM and mcr-1 within the generic E. coli isolate from vegetables eaten raw in the current study may be transferred to other foodborne pathogens or clinical pathogens.
Carbapenemases can confer high-level resistance to β-lactams, including carbapenems. For example, all 10 blaNDM-positive E. coli and P. mirabilis isolates in our study showed high-level resistance to meropenem (≥128 µg/mL). All five blaNDM-positive E. coli isolates from fresh vegetables in this study showed multidrug resistance. Luckily, all these five vegetable-sourced blaNDM-positive E. coli isolates were susceptible to tigecycline and amikacin, similar to our previously reported two E. coli isolates carrying both blaNDM and mcr-1 from vegetables [12]. These results suggest that amikacin and tigecycline may be good options for treating human infection caused by such bacteria. All P. mirabilis isolates in this study also showed multidrug resistances, but four isolates were susceptible to amikacin, suggesting that amikacin might be a good option for human infection caused by blaNDM-positive P. mirabilis. This finding was similar to that for clinical P. mirabilis carrying blaNDM-1 in China [21]. Clinical NDM-producing P. mirabilis has been reported in China [21], Tunisia [43], Portugal [44] and Austria [45]. The treatment of infections caused by P. mirabilis represents a particular challenge because of its intrinsic resistance to colistin and tetracyclines, including tigecycline. P. mirabilis is generally associated with food spoilage and can also cause foodborne illness [22,23]. In China, vegetables contaminated with P. mirabilis have been linked with foodborne illness [24]. All five blaNDM-positive P. mirabilis from fresh vegetables in this study possessed seven of the eight virulence genes, which were all often found in clinical P. mirabilis linked with urinary tract infection [30], indicating a potential threat to humans. Furthermore, P. mirabilis is notorious for its ability to actively disseminate antimicrobial resistance genes, including blaNDM [21]. Thus, the concurrence of blaNDM-positive MDR P. mirabilis and mcr-1-positive E. coli producing NDM in fresh vegetables that are often eaten raw, poses a threat to human health.
IncX4 and IncI2 are the two major types of mcr-1-positive plasmids in E. coli from animals [46] and humans [47]. IncHI2 plasmids often carry multiple resistance genes [12], and IncHI2 plasmids possessing mcr-1 have also been found in E. coli from cooked retail meat in China in recent years [48]. In our previous study, which only investigated E. coli carrying mcr-1 among vegetables, IncX4 and IncI2 plasmids carrying mcr-1 were also the two major plasmid types [49]. However, mcr-1 was located on IncHI2 plasmids in all four vegetable-source blaNDM-positive E. coli isolates in this study. These data suggest that IncHI2-type plasmids play an important role in spreading mcr-1 among vegetables in China, indicating further surveillance of IncHI2 plasmids carrying mcr-1 is needed. Most previously reported mcr-1-harboring IncHI2 plasmids range from 210 to 260 kb in size and contain two transfer regions, as shown in [12], resulting in the transferability of these IncHI2 plasmids. However, the four mcr-1-positive IncHI2 plasmids in the current study were about 177 kb in size and did not harbor transfer region 1 (traJ~trhG genes), which might lead to the failure of conjugation for these plasmids. mcr-1 has often been linked with one or two copies of ISApl1, which plays an important role in spreading mcr-1 [50]. One copy of ISApl1 was linked to mcr-1 on the IncHI2 plasmids in our study, and Tn6330, an ISApl1-flanked composite transposon was not found. Besides mcr-1, IncHI2 plasmids in the current study also carried additional twelve types of resistance genes, including β-lactams (blaOXA-1), trimethoprim (dfrA12), fluoroquinolones (aac(6′)-Ib-cr), aminoglycosides (aph(4)-Ia, aph(3″)-Ib, aac(3)-IV, aph(6)-Id and aadA2), tetracyclines (tet(A)), rifamycin (arr-3) and amphenicol (catB3). Most antimicrobials mentioned above are used for both humans and animals. Thus the adverse effects of these drugs on the spread of mcr-1 should be paid more attention to.
IncX3 plasmids have been the main vector for the spread of blaNDM among Enterobacteriaceae [51]. Notably, almost all IncX3 plasmids carrying blaNDM carried the blaNDM-5 gene, while the E. coli isolates carrying other subtypes of blaNDM from animals harbored other replicon types rather than IncX3 in a previous study [3], consistent with the findings in our study that all IncX3 plasmids in the six isolates (E. coli and P. mirabilis) from fresh vegetables carried blaNDM-5 and P. mirabilis isolates with blaNDM-1 harbored no IncX3 replicon. The environment surrounding blaNDM-5 contained the mobile element IS5, suggesting that blaNDM-5 was recombined into IncX3 plasmids by insertion or transposition. A retrospective analysis of IncX3 plasmids in China showed that the backbone of IncX3 plasmids has been highly conserved [52]. The blaNDM-5-positive IncX3 plasmids in this study were transferable and also had a highly similar backbone structure, although these plasmids were from bacteria of different genera, different ST types or different types of vegetables. These results suggest that the horizontal transfer of similar IncX3 plasmids might be responsible for the spread of blaNDM-5 among vegetables in China. All IncX3 plasmids from fresh vegetables in our study were similar to the blaNDM-positive IncX3 plasmids pKW53T (KX214669, 46,161 bp) from the urinary tract infection patient in Kuwait, pCREC-591_4 (CP024825, 46,161 bp) from patient ascites in Korea and pNDM-SCCRK18-72 (MN565271, 46,161 bp) from swine in China. These results suggest that the transferable blaNDM-bearing IncX3 plasmids in fresh vegetables might be derived from animals and then transmitted to humans through the food chain.
Unlike E. coli and Klebsiella pneumoniae, in which IncX3 and IncFII plasmids were the two main vectors for spreading blaNDM, the blaNDM-1-bearing plasmids in P. mirabilis isolates were often assigned to an unknown incompatibility group [53]. In China, blaNDM-1 was also located on plasmids with unknown replicon type in P. mirabilis isolates from chicken [54]. Similarly, we obtained four untypable plasmids carrying blaNDM-1 from P. mirabilis isolates in vegetables, further confirming the association of untypable plasmids and blaNDM-1 in P. mirabilis isolates. The four untypable blaNDM-1-bearing plasmids in P. mirabilis isolates from different types of vegetables or markets in our study were highly similar to untypable blaNDM-1-positive pSNYG35 from cloacal swabs of broilers in China, further confirming the previous finding that the family of blaNDM-1-carrying untypable plasmids in P. mirabilis shares high homologous backbones [53]. This result indicates that blaNDM-1-positive plasmids in P. mirabilis from vegetables may come from isolates from animals. Insertion sequence common region (ISCR) is an IS91-like element that could mobilize adjacent sequences through the mechanism “rolling-circle replication” [55], and ISCR1 is a well-established gene capture system. blaNDM−1 could be disseminated by a circular ISCR1-blaNDM−1 element [56], and in this study, the untypable plasmids in P. mirabilis contained ISCR1 complex class 1 integron (sul1-△qacE-arr-3-blaNDM-1-bleMBL-ISCR1). The ISCR1 complex class 1 integron containing sul1-△qacE-arr-3-blaNDM-1-bleMBL-ISCR1/IS91 was also found on plasmid pSNYG35 in P. mirabilis isolated from cloacal swabs of broilers in China [53]. These results deepen our conjecture that the plasmids or blaNDM-1 in P. mirabilis from vegetables may have come from animals via plasmid transfer or gene capture. Notably, the nanopore-sequenced data confirmed that plasmid pNDM1_M15061B in P. mirabilis contained five copies of the ISCR1 complex class 1 integron (sul1-△qacE-arr-3-blaNDM-1-bleMBL-ISCR1) in this study. We speculate that the ISCR1 element captures multiple antimicrobial resistance genes, including sul1-△qacE-arr-3-blaNDM-1-bleMBL, by several steps, resulting in the formation of pNDM1_M15061B. The meropenem MICs of previously reported blaNDM-1-positive P. mirabilis from animals ranged from 32 to 64 µg/mL [54], and those from humans were from 2 to 64 µg/mL [21]. P. mirabilis (64 µg/mL) from humans was confirmed to possess two copies of blaNDM-1. The meropenem MICs of M15061 and its transconjugant M15061BT in this study were ≥128 µg/mL, which might be attributed to the fact that both M15061 and its transconjugant M15061BT carried five copies of ISCR1 complex class 1 integron-containing blaNDM-1. The meropenem MICs of the remaining four P. mirabilis and their transconjugants in our study were also ≥128 µg/mL, indicating that the remaining four P. mirabilis may also harbor at least one copy of ISCR1 complex class 1 integron-containing blaNDM-1, although the structure of multiple copies of ISCR1 complex class 1 integron in these isolates were not obtained only from Illumina-sequenced data.
The sequenced mcr-1-positive NDM-producing ST6050 isolates (M15071H and M15081H) in this study were highly similar (7 SNPs), although they were isolated from different types of vegetables in the same market, indicating a very close genetic relationship between these two isolates. Notably, the NDM-producing E. coli isolates from fresh vegetables were clustered together with previously reported blaNDM/mcr-1-positive isolates from animals, humans and environments in different countries, including China. These results suggest that the NDM-producing E. coli isolates with mcr-1 from fresh vegetables in our study may be derived from animals through fecal fertilization and transferred to humans. The blaNDM-positive P. mirabilis isolates obtained from vegetables in this study had no SNP variation and were also clustered with animal-sourced isolates from China. These results suggest that blaNDM-positive P. mirabilis isolates in vegetables may be derived from animals because a relatively high prevalence of P. mirabilis isolates carrying blaNDM-1 has already been found in chickens from China [54].
5. Conclusions
In conclusion, we reported, for the first time, five blaNDM-positive P. mirabilis and five blaNDM-bearing generic E. coli concurrently from the same five fresh vegetables in China, and four of the five E. coli also carried mcr-1. blaNDM-5 in all E. coli isolates, and P. mirabilis carrying blaNDM-5 from fresh vegetables was located on similar IncX3 transferable plasmids, while similarly untypable transferable plasmids were the carriers of blaNDM-1 in P. mirabilis isolates from different types of vegetables or markets. mcr-1 in all blaNDM-5-positive E. coli was located on similarly non-conjugative IncHI2 MDR plasmids lacking a transfer region. Notably, ISCR1 complex class 1 integron capable of capturing blaNDM-1 was found on transferable untypable plasmids from P. mirabilis in this study, and five copies of ISCR1 complex class 1 integron were even found in one P. mirabilis. Plasmid comparison and phylogenetic analysis revealed that the blaNDM-positive P. mirabilis and blaNDM-positive E. coli in fresh vegetables might be derived from animals by fecal fertilization and could be transmitted to humans through the food chain. Fresh retail vegetables might have been underestimated vehicles of E. coli and P. mirabilis in spreading resistance genes, including both blaNDM and mcr-1. The concurrence of blaNDM-positive P. mirabilis and E. coli possessing both mcr-1 and blaNDM in different types of fresh vegetables eaten raw is alarming and threatens food safety. Sustained surveillance of resistance in foodborne pathogens in the food chain, especially fresh vegetables, is urgent for preventing the transmission of MCR-producing and/or NDM-producing Enterobacteriaceae to ensure the health of food consumers.
Conceptualization, B.-T.L. and F.-J.S.; methodology, C.-A.L., C.-H.G. and T.-Y.Y.; software, F.-Y.L.; validation, T.-Y.Y. and F.-Y.L.; formal analysis, F.-Y.L.; investigation, T.-Y.Y.; resources, F.-J.S.; data curation, B.-T.L.; writing—original draft preparation, C.-A.L. and C.-H.G.; writing—review and editing, B.-T.L. and F.-J.S.; visualization, C.-A.L. and C.-H.G.; supervision, B.-T.L. and F.-J.S.; project administration, B.-T.L. and F.-J.S.; funding acquisition, B.-T.L. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
Data are contained within the article or
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Phylogenetic tree of E. coli harboring mcr-1 and/or blaNDM (A) and blaNDM-positive P. mirabilis (B) by core genome sequences visualized using iTOL v6. (A) Phylogenetic tree of E. coli possessing mcr-1 and/or blaNDM from different origins and countries, including 57 genome sequences from NCBI and 3 isolates in this study. Strain M15061H in this study was used as a reference. A–O represent different countries, namely A: China, B: United States, C: Brazil, D: Lebanon, E: Denmark, F: Colombia, G: Switzerland, H: Italy, I: Germany, J: India, K: Ecuador, L: Thailand, M: Netherlands, N: United Kingdom and O: Bolivia. (B) Phylogenetic tree of blaNDM-positive P. mirabilis isolates from different origins and countries, including 15 genomes from NCBI and 2 isolates in this study. Strain M15061B in this study was used as a reference. Different clades were marked with different colored sectors. The genomes labeled with “*” were collected from vegetables in this study.
Enlarge this image.Figure 2. Circular alignment of IncHI2 mcr-1-bearing (A) or IncX3 blaNDM-5-bearing (B) plasmids by BRIG. (A) The plasmid pNSHNP45-2 (KU341381) (pink ring) from E. coli in pigs from China was set as a reference. The light blue, blue purple and orange rings represent pH16G1394 (NZ_MK477614) from clinical Salmonella, PE-T81-1-mcr-1 (CP090269) from human E. coli and plas4.1.1 (NZ_CP047116) from Salmonella of chicken, respectively, in China. The yellow and green rings represent pmcr_M15071H and pmcr_M1508H in this study. (B) The plasmid pW53T-NDM (KX214669) (purple ring), from a urinary tract infection patient in Kuwait was set as a reference. The light blue, blue and orange rings represent pCREC-591_4 (CP024825) from ascites in a Korean patient, pNDM-SCCRK18-72 (MN565271) in E. coli in swine from China and pVH1 (CP028705) in vegetable-sourced E. coli from China, respectively. The yellow, green, red and dark green rings represent pNDM5_M15061H, pNDM5_M15071H, pNDM5_M15081H and pNDM5_M15092B in this study. The outer circle with black arrows represents annotation of the reference plasmids; among them, the red, blue and orange represent resistance genes, transfer-related genes and transposase genes, respectively.
Enlarge this image.Figure 3. Circular sequence alignment of blaNDM-bearing untypable plasmids by BRIG. (A) The plasmid pNDM1_M15061B in this study (purple ring) was used as a reference. The light red and green rings represent pSNYG35 (CP047590) from P. mirabilis of chicken in China and pDY.F1.2 (CP046050) from P. mirabilis from swine in China. (B) The plasmid pSNYG35 (CP047590) (light blue ring) from P. mirabilis of chicken in China was used as a reference. The blue ring represents pDY.F1.2 (CP046050) from P. mirabilis from swine in China. The pink, orange and green rings represent pNDM1_M15071B, pNDM1_M15081B and pNDM1_M15101B in the current study, respectively. The black arrows in the outer circle represent annotation of the reference plasmid; among them, the red and blue represent resistance genes and transfer-related genes, respectively.
Enlarge this image.Figure 4. Linear alignment of blaNDM-1-bearing untypable plasmids from P. mirabilis isolates by Easyfig. Arrows indicate the directions of gene transcription. Regions with 100% nucleotide sequence homology are shown in grey.
Origins, resistance genes and virulence genes of five P. mirabilis carrying blaNDM and five blaNDM-positive E. coli from the same five fresh vegetables.
| Sources | Samples | E. coli | P. mirabilis | |||||
|---|---|---|---|---|---|---|---|---|
| Strains | Resistance Genes | STs | Diarrheagenic Virulence Genes | Strains | Resistance Genes | Virulence Genes | ||
| Market | lettuce | M15061H | bla NDM-5 | ST553 | Not found | M15061B | bla NDM-1 | hpmA, mrpA, ptA, ireA, zapA, pmfA, atfA |
| tomato | M15071H | mcr-1, bla NDM-5 | ST6050 | Not found | M15071B | bla NDM-1 | hpmA, mrpA, ptA, ireA, zapA, pmfA, atfA | |
| cucumber | M15081H | mcr-1, bla NDM-5 | ST6050 | Not found | M15081B | bla NDM-1 | hpmA, mrpA, ptA, ireA, zapA, pmfA, atfA | |
| Supermarket | cucumber 1 | M15092H | mcr-1, bla NDM-5 | ST6050 | Not found | M15092B | bla NDM-5 | hpmA, mrpA, ptA, ireA, zapA, pmfA, atfA |
| lettuce | M15101H | mcr-1, bla NDM-5 | ST6050 | Not found | M15101B | bla NDM-1 | hpmA, mrpA, ptA, ireA, zapA, pmfA, atfA | |
| green pepper | - | - | ||||||
| cucumber 2 | - | - | ||||||
| tomato | - | - | ||||||
Resistance characteristics of the 10 blaNDM-positive isolates and their transconjugants harboring blaNDM in this study.
| Strains | Replicons in Transconjugants | Resistance Genes | MICs (μg/mL) | Other Resistance Profiles | |||||
|---|---|---|---|---|---|---|---|---|---|
| COL | TIG | MEM | CTX | CAZ | AMP | ||||
| M15061H | - | bla NDM-5 | 0.5 | 0.25 | >128 | >256 | >256 | >256 | STR, KAN, TET, NAL, CIP |
| M15071H | - | mcr-1, bla NDM-5 | 4 | 0.25 | >128 | >256 | >256 | >256 | STR, KAN, TET, LEV, NAL, CIP |
| M15081H | - | mcr-1, bla NDM-5 | 4 | 0.5 | >128 | >256 | >256 | >256 | STR, KAN, TET, LEV, NAL, CIP |
| M15092H | - | mcr-1, bla NDM-5 | 4 | 0.125 | >128 | >256 | >256 | >256 | STR, KAN, TET, LEV, NAL, CIP |
| M15101H | - | mcr-1, bla NDM-5 | 4 | 0.25 | >128 | >256 | >256 | >256 | STR, KAN, TET, LEV, NAL, CIP |
| M15061B | - | bla NDM-1 | NA | NA | >128 | 128 | >256 | >256 | STR, KAN, TET |
| M15071B | - | bla NDM-1 | NA | NA | >128 | >256 | >256 | >256 | STR, KAN, TET, NAL, CIP |
| M15081B | - | bla NDM-1 | NA | NA | >128 | >256 | >256 | >256 | STR, KAN, TET, LEV, NAL, CIP |
| M15092B | - | bla NDM-5 | NA | NA | >128 | >256 | >256 | >256 | STR, KAN, AMK, TET, NAL, CIP |
| M15101B | - | bla NDM-1 | NA | NA | >128 | 256 | >256 | >256 | STR, KAN, TET, NAL, CIP |
| M15061HT | X3 | bla NDM-5 | <0.125 | 0.125 | >128 | 128 | 256 | >256 | STR |
| M15071HT | X3 | bla NDM-5 | <0.125 | 0.25 | >128 | 256 | 128 | >256 | STR |
| M15081HT | X3 | bla NDM-5 | <0.125 | 0.125 | >128 | 256 | 256 | >256 | STR |
| M15092HT | X3 | bla NDM-5 | <0.125 | 0.125 | >128 | 256 | 256 | >256 | STR |
| M15101HT | X3 | bla NDM-5 | <0.125 | 0.25 | >128 | 256 | 256 | >256 | STR |
| M15061BT | UT | bla NDM-1 | <0.125 | 0.125 | 128 | 64 | 256 | >256 | STR |
| M15071BT | F24:A-:B6 | bla NDM-1 | <0.125 | 0.125 | 128 | 64 | 256 | >256 | STR |
| M15081BT | UT | bla NDM-1 | <0.125 | 0.25 | 128 | 128 | 256 | >256 | STR |
| M15092BT | X3, F24:A-:B6 | bla NDM-5 | <0.125 | 0.5 | >128 | 128 | 256 | >256 | STR, TET |
| M15101BT | UT | bla NDM-1 | <0.125 | 0.125 | >128 | 256 | 256 | >256 | STR |
| C600 | - | - | <0.125 | 0.125 | 0.125 | 0.031 | 0.062 | 4 | STR |
COL, colistin; TIG, tigecycline; AMP, ampicillin; MEM, meropenem; CTX, cefotaxime; CAZ, ceftazidime; NAL, nalidixic acid; CIP, ciprofloxacin; STR, streptomycin; KAN, kanamycin; AMK, amikacin; LEV, levofloxacin; TET, tetracycline; UT, untypable; NA, not applicable because of intrinsic resistance.
Antimicrobial resistance genes of obtained isolates from WGS sequencing.
| Strains | Origins | Strategies of Sequencing | Resistance Genes | Virulence Genes |
|---|---|---|---|---|
| E. coli | ||||
| M15061H | lettuce | MinION + HiSeq | aph(3′)-Ia, aph(6)-Id, aph(3″)-Ib, aadA5, tet(A), sul2, sul1, dfrA17, sitABCD, mph(A), blaNDM-5, blaCTX-M-14, blaTEM-1B, bleMBL, gyrA: (S83L,D87N), parC: S80I | cma, csgA, cvaC, fdeC, fimH, gad, hlyE, hlyF, iroN, iss, lpfA, nlpI, ompT, sitA, terC, traJ, traT, yehA, yehB, yehC, yehD |
| M15071H | tomato | HiSeq | aph(3′)-Ia, aph(6)-Id, aac(3)-IV, aph(3″)-Ib, aph(4)-Ia, aac(6′)-Ib-cr, aadA2, tet(M), tet(A), dfrA12, fosA3, catB3, arr-3, mph(A), blaNDM-5, blaCTX-M-3, blaOXA-1, bleMBL, mcr-1, gyrA: (S83L,D87N), parC: S80I | astA, csgA, fimH, gad, hlyE, nlpI, ompT, terC, traJ, traT, yehA, yehB, yehC, yehD |
| M15081H | cucumber | HiSeq | aph(3′)-Ia, aph(6)-Id, aac(3)-IV, aph(3″)-Ib, aph(4)-Ia, aac(6′)-Ib-cr, aadA2, tet(M), tet(A), dfrA12, fosA3, catB3, arr-3, mph(A), blaNDM-5, blaCTX-M-3, blaOXA-1, bleMBL, mcr-1, gyrA: (S83L,D87N), parC: S80I | astA, csgA, fimH, gad, hlyE, nlpI, ompT, terC, traJ, traT, yehA, yehB, yehC, yehD |
| P. mirabilis | ||||
| M15061B | lettuce | MinION + HiSeq | aph(4)-Ia, aac(3)-IV, aadA2, tet(J), sul2, sul1, cat, floR, arr-3, blaNDM-1, bleMBL, lnu(F) | - |
| M15101B | lettuce | HiSeq | aph(4)-Ia, aac(3)-IV, aadA2, tet(J), sul2, sul1, cat, floR, arr-3, blaNDM-1, bleMBL, lnu(F) | - |
| transconjugants | ||||
| M15071BT | - | HiSeq | aph(6)-Id, aph(3′)-Ia, aph(3″)-Ib, aac(3)-IV, aph(4)-Ia, aadA2, aadA5, tet(A), sul2, sul1, dfrA17, sitABCD, floR, arr-3, mph(A), blaNDM-1, blaTEM-1B, bleMBL, lnu(F) | - |
| M15081BT | - | HiSeq | aac(3)-IV, aph(4)-Ia, aadA2, sul2, sul1, floR, arr-3, blaNDM-1, bleMBL, lnu(F) | - |
| M15092BT | - | HiSeq | aph(6)-Id, aph(3′)-Ia, aph(3″)-Ib, aadA5, tet(A), sul2, sul1, dfrA17, sitABCD, mph(A), blaNDM-5, blaTEM-1B, bleMBL | - |
Characteristics of plasmids harboring mcr-1 or blaNDM from fresh vegetables.
| Strains | Plasmids | Resistance Genes | Plasmids Carrying mcr-1 or blaNDM | |
|---|---|---|---|---|
| Replicon Type | Size (kb) | |||
| M15061H | pNDM5_M15061H | blaNDM-5, bleMBL | X3 | ~46 |
| pTEM-1B_M15061H | aph(3′)-Ia, aph(3″)-Ib, aph(6)-Id, aadA5, blaTEM-1B, tet(A), dfrA17, sul1, sul2, mph(A), sitABCD | FII | ~152 | |
| pCTX-M-14_M15061H | bla CTX-M-14 | Y | ~152 | |
| p1_M15061H | I1-I | ~90 | ||
| p2_M15061H | UT | ~5 | ||
| p3_M15061H | UT | ~3 | ||
| p4_M15061H | UT | ~3 | ||
| p5_M15061H | UT | ~2 | ||
| M15071H | pmcr_M15071H | mcr-1, blaOXA-1, dfrA12, aac(6′)-Ib-cr, aph(3′)-Ia, aph(4)-Ia, aac(3)-IV, aph(3″)-Ib, aph(6)-Id, aadA2, tet(A), arr-3, catB3 | HI2 | ~177 |
| pNDM5_M15071H | blaNDM-5, bleMBL | X3 | ~46 | |
| M15081H | pmcr_M15081H | mcr-1, blaOXA-1, dfrA12, aac(6′)-Ib-cr, aph(3′)-Ia, aph(4)-Ia, aac(3)-IV, aph(3″)-Ib, aph(6)-Id, aadA2, tet(A), arr-3, catB3 | HI2 | ~177 |
| pNDM5_M15081H | blaNDM-5, bleMBL | X3 | ~46 | |
| M15092H | pmcr_M15092H | mcr-1, blaOXA-1, dfrA12, aac(6′)-Ib-cr, aph(3′)-Ia, aph(4)-Ia, aac(3)-IV, aph(3″)-Ib, aph(6)-Id, aadA2, tet(A), arr-3, catB3 | HI2 | ~177 |
| pNDM5_M15092H | blaNDM-5, bleMBL | X3 | ~46 | |
| M15101H | pmcr_M15101H | mcr-1, blaOXA-1, dfrA12, aac(6′)-Ib-cr, aph(3′)-Ia, aph(4)-Ia, aac(3)-IV, aph(3″)-Ib, aph(6)-Id, aadA2, tet(A), arr-3, catB3 | HI2 | ~177 |
| pNDM5_M15101H | blaNDM-5, bleMBL | X3 | ~46 | |
| M15061B | pNDM1_M15061B | blaNDM-1, bleMBL, sul1, sul2, aadA2, aac(3)-IV, aph(4)-Ia, arr-3, folR, lnu(F) | UT | ~186 |
| M15071B | pNDM1_M15071B | blaNDM-1, bleMBL, sul2, aadA2, aac(3)-IV, aph(4)-Ia, mph(A), arr-3, floR, lnu(F) | UT | ~163 |
| M15081B | pNDM1_M15081B | blaNDM-1, bleMBL, sul1, sul2, aadA2, aac(3)-IV, aph(4)-Ia, arr-3, folR, lnu(F) | UT | ~160 |
| M15092B | pNDM5_M15092B | blaNDM-5, bleMBL | X3 | ~46 |
| M15101B | pNDM1_M15101B | blaNDM-1, bleMBL, sul1, sul2, aadA2, aac(3)-IV, aph(4)-Ia, arr-3, folR, lnu(F) | UT | ~158 |
Primer sequences used for the detection of pmcr_M15071H-like plasmids.
| Primers | DNA Sequence (5′→3′) | Target Genes | Products Size (bp) |
|---|---|---|---|
| trhE-trhK-F | AACGGTGATCTTGAACAGTC | trhE and trhK | 1000 |
| trhE-trhK-R | ACGGTAGGGAGATCAGTTG | ||
| trhV-trhC-F | CAACAGGGGAAAGTAATGAG | trhV and trhC | 999 |
| trhV-trhC-R | GTTTGAAGTAACGATGCTCAG | ||
| traU-traN-F | CAACACTAATCAGCCAATGAC | traU and traN | 992 |
| traU-traN-R | GATTAAGATTAGCGGATTCGG | ||
| DUF-VWA-F | GATTGAACGAGAGTTTCAGG | DUF and VWA | 980 |
| DUF-VWA-R | ACAGGATCAAAATACGGTCC | ||
| terZ-terD-F | GAGTTAACCAGTCGACGC | terZ and terD | 997 |
| terZ-terD-R | TAAACGCCAGGTATTCAACG | ||
| tetR(A)-tet(A)-F | TTCTATCTGCGATTGGACCC | tetR(A) and tet(A) | 872 |
| tetR(A)-tet(A)-R | CTAGTATGACGTCTGTCGC | ||
| traG-traI-F | AAGCTTATCGACCTCTTTCG | traG and traI | 993 |
| traG-traI-R | AATGCAAAGCATACAGCATC |
Supplementary Materials
The following supporting information can be downloaded at:
References
1. van Duin, D.; Doi, Y. The global epidemiology of carbapenemase-producing Enterobacteriaceae. Virulence; 2017; 8, pp. 460-469. [DOI: https://dx.doi.org/10.1080/21505594.2016.1222343] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27593176]
2. Zhang, R.; Liu, L.; Zhou, H.; Chan, E.W.; Li, J.; Fang, Y.; Li, Y.; Liao, K.; Chen, S. Nationwide Surveillance of Clinical Carbapenem-resistant Enterobacteriaceae (CRE) Strains in China. EBioMedicine; 2017; 19, pp. 98-106. [DOI: https://dx.doi.org/10.1016/j.ebiom.2017.04.032] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28479289]
3. Zhai, R.; Fu, B.; Shi, X.; Sun, C.; Liu, Z.; Wang, S.; Shen, Z.; Walsh, T.R.; Cai, C.; Wang, Y. et al. Contaminated in-house environment contributes to the persistence and transmission of NDM-producing bacteria in a Chinese poultry farm. Environ. Int.; 2020; 139, 105715. [DOI: https://dx.doi.org/10.1016/j.envint.2020.105715] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32315891]
4. CDC. Antibiotic Resistance Threats in the United States, 2019; Department of Health and Human Services, CDC: Atlanta, GA, USA, 2019.
5. Delgado-Blas, J.F.; Agui, C.V.; Rodriguez, E.M.; Serna, C.; Montero, N.; Saba, C.K.S.; Gonzalez-Zorn, B. Dissemination Routes of Carbapenem and Pan-Aminoglycoside Resistance Mechanisms in Hospital and Urban Wastewater Canalizations of Ghana. mSystems; 2022; 7, e0101921. [DOI: https://dx.doi.org/10.1128/msystems.01019-21]
6. Li, F.; Cheng, P.; Li, X.; Liu, R.; Liu, H.; Zhang, X. Molecular Epidemiology and Colistin-Resistant Mechanism of mcr-Positive and mcr-Negative Escherichia coli Isolated From Animal in Sichuan Province, China. Front. Microbiol.; 2022; 13, 818548. [DOI: https://dx.doi.org/10.3389/fmicb.2022.818548]
7. Wang, C.; Feng, Y.; Liu, L.; Wei, L.; Kang, M.; Zong, Z. Identification of novel mobile colistin resistance gene mcr-10. Emerg. Microbes Infect.; 2020; 9, pp. 508-516. [DOI: https://dx.doi.org/10.1080/22221751.2020.1732231]
8. Xu, T.; Xue, C.X.; Chen, Y.; Huang, J.; Wu, W.; Lu, Y.; Huang, Q.; Chen, D.; Zhou, K. Frequent convergence of mcr-9 and carbapenemase genes in Enterobacter cloacae complex driven by epidemic plasmids and host incompatibility. Emerg. Microbes Infect.; 2022; 11, pp. 1959-1972. [DOI: https://dx.doi.org/10.1080/22221751.2022.2103456]
9. Aklilu, E.; Harun, A.; Singh, K.K.B. Molecular characterization of blaNDM, blaOXA-48, mcr-1 and blaTEM-52 positive and concurrently carbapenem and colistin resistant and extended spectrum beta-lactamase producing Escherichia coli in chicken in Malaysia. BMC Vet. Res.; 2022; 18, 190. [DOI: https://dx.doi.org/10.1186/s12917-022-03292-7]
10. Liu, X.; Li, R.; Dong, N.; Ye, L.; Chan, E.W.; Chen, S. Complete Genetic Analysis of Plasmids Carried by Two Nonclonal blaNDM-5- and mcr-1-Bearing Escherichia coli Strains: Insight into Plasmid Transmission among Foodborne Bacteria. Microbiol. Spectr.; 2021; 9, e0021721. [DOI: https://dx.doi.org/10.1128/Spectrum.00217-21]
11. Jung, Y.; Jang, H.; Matthews, K.R. Effect of the food production chain from farm practices to vegetable processing on outbreak incidence. Microb. Biotechnol.; 2014; 7, pp. 517-527. [DOI: https://dx.doi.org/10.1111/1751-7915.12178]
12. Liu, B.T.; Song, F.J. Emergence of two Escherichia coli strains co-harboring mcr-1 and blaNDM in fresh vegetables from China. Infect. Drug Resist.; 2019; 12, pp. 2627-2635. [DOI: https://dx.doi.org/10.2147/IDR.S211746]
13. van Hoek, A.H.; Veenman, C.; van Overbeek, W.M.; Lynch, G.; de Roda Husman, A.M.; Blaak, H. Prevalence and characterization of ESBL- and AmpC-producing Enterobacteriaceae on retail vegetables. Int. J. Food Microbiol.; 2015; 204, pp. 1-8. [DOI: https://dx.doi.org/10.1016/j.ijfoodmicro.2015.03.014] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25828704]
14. Chelaghma, W.; Loucif, L.; Bendjama, E.; Cherak, Z.; Bendahou, M.; Rolain, J.M. Occurrence of Extended Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram-Negative Bacteria in Fresh Vegetables, an Increasing Human Health Concern in Algeria. Antibiotics; 2022; 11, 988. [DOI: https://dx.doi.org/10.3390/antibiotics11080988] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35892378]
15. Jones-Dias, D.; Manageiro, V.; Ferreira, E.; Barreiro, P.; Vieira, L.; Moura, I.B.; Canica, M. Architecture of Class 1, 2, and 3 Integrons from Gram Negative Bacteria Recovered among Fruits and Vegetables. Front. Microbiol.; 2016; 7, 1400. [DOI: https://dx.doi.org/10.3389/fmicb.2016.01400] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27679611]
16. Zurfuh, K.; Poirel, L.; Nordmann, P.; Nuesch-Inderbinen, M.; Hachler, H.; Stephan, R. Occurrence of the plasmid-borne mcr-1 colistin resistance gene in ESBL-producing Enterobacteriacae in river water and imported vegetable samples in Switzerland. Antimicrob. Agents Chemother.; 2016; 60, pp. 2594-2595. [DOI: https://dx.doi.org/10.1128/AAC.00066-16]
17. Oh, S.S.; Song, J.; Kim, J.; Shin, J. Increasing prevalence of multidrug-resistant mcr-1-positive Escherichia coli isolates from fresh vegetables and healthy food animals in South Korea. Int. J. Infect. Dis.; 2020; 92, pp. 53-55. [DOI: https://dx.doi.org/10.1016/j.ijid.2019.12.025] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31877351]
18. Luo, J.; Yao, X.; Lv, L.; Doi, Y.; Huang, X.; Huang, S.; Liu, J.H. Emergence of mcr-1 in Raoultella ornithinolytica and Escherichia coli Isolates from Retail Vegetables in China. Antimicrob. Agents Chemother.; 2017; 61, e01139-17. [DOI: https://dx.doi.org/10.1128/AAC.01139-17]
19. Soliman, A.M.; Nariya, H.; Tanaka, D.; Yu, L.; Hisatsune, J.; Kayama, S.; Kondo, K.; Sugai, M.; Shimamoto, T.; Shimamoto, T. Vegetable-Derived Carbapenemase-Producing High-Risk Klebsiella pneumoniae ST15 and Acinetobacter baumannii ST2 Clones in Japan: Coexistence of blaNDM-1, blaOXA-66, blaOXA-72, and an AbaR4-Like Resistance Island in the Same Sample. Appl. Environ. Microbiol.; 2021; 87, e02166-20. [DOI: https://dx.doi.org/10.1128/AEM.02166-20]
20. Liu, B.T.; Zhang, X.Y.; Wan, S.W.; Hao, J.J.; Jiang, R.D.; Song, F.J. Characteristics of Carbapenem-Resistant Enterobacteriaceae in Ready-to-Eat Vegetables in China. Front. Microbiol.; 2018; 9, 1147. [DOI: https://dx.doi.org/10.3389/fmicb.2018.01147]
21. Yang, L.; He, H.; Chen, Q.; Wang, K.; Lin, Y.; Li, P.; Li, J.; Liu, X.; Jia, L.; Song, H. et al. Nosocomial Outbreak of Carbapenemase-Producing Proteus mirabilis With Two Novel Salmonella Genomic Island 1 Variants Carrying Different blaNDM-1 Gene Copies in China. Front. Microbiol.; 2022; 12, 800938. [DOI: https://dx.doi.org/10.3389/fmicb.2021.800938]
22. Keisam, S.; Tuikhar, N.; Ahmed, G.; Jeyaram, K. Toxigenic and pathogenic potential of enteric bacterial pathogens prevalent in the traditional fermented foods marketed in the Northeast region of India. Int. J. Food Microbiol.; 2019; 296, pp. 21-30. [DOI: https://dx.doi.org/10.1016/j.ijfoodmicro.2019.02.012] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30826539]
23. Nyenje, M.E.; Odjadjare, C.E.; Tanih, N.F.; Green, E.; Ndip, R.N. Foodborne pathogens recovered from ready-to-eat foods from roadside cafeterias and retail outlets in Alice, Eastern Cape Province, South Africa: Public health implications. Int. J. Environ. Res. Public Health; 2012; 9, pp. 2608-2619. [DOI: https://dx.doi.org/10.3390/ijerph9082608] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23066386]
24. Gong, Z.; Shi, X.; Bai, F.; He, X.; Zhang, H.; Li, Y.; Wan, Y.; Lin, Y.; Qiu, Y.; Chen, Q. et al. Characterization of a Novel Diarrheagenic Strain of Proteus mirabilis Associated With Food Poisoning in China. Front. Microbiol.; 2019; 10, 2810. [DOI: https://dx.doi.org/10.3389/fmicb.2019.02810] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31921012]
25. Mollet, C.; Drancourt, M.; Raoult, D. rpoB sequence analysis as a novel basis for bacterial identification. Mol. Microbiol.; 1997; 26, pp. 1005-1011. [DOI: https://dx.doi.org/10.1046/j.1365-2958.1997.6382009.x]
26. Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis.; 2011; 70, pp. 119-123. [DOI: https://dx.doi.org/10.1016/j.diagmicrobio.2010.12.002]
27. Borowiak, M.; Baumann, B.; Fischer, J.; Thomas, K.; Deneke, C.; Hammerl, J.A.; Szabo, I.; Malorny, B. Development of a Novel mcr-6 to mcr-9 Multiplex PCR and Assessment of mcr-1 to mcr-9 Occurrence in Colistin-Resistant Salmonella enterica Isolates From Environment, Feed, Animals and Food (2011–2018) in Germany. Front. Microbiol.; 2020; 11, 80. [DOI: https://dx.doi.org/10.3389/fmicb.2020.00080]
28. Antikainen, J.; Tarkka, E.; Haukka, K.; Siitonen, A.; Vaara, M.; Kirveskari, J. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. Eur. J. Clin. Microbiol. Infect. Dis.; 2009; 28, pp. 899-908. [DOI: https://dx.doi.org/10.1007/s10096-009-0720-x]
29. Meraz, I.M.; Jiang, Z.D.; Ericsson, C.D.; Bourgeois, A.L.; Steffen, R.; Taylor, D.N.; Hernandez, N.; DuPont, H.L. Enterotoxigenic Escherichia coli and diffusely adherent E. coli as likely causes of a proportion of pathogen-negative travelers’ diarrhea—A PCR-based study. J. Travel Med.; 2008; 15, pp. 412-418. [DOI: https://dx.doi.org/10.1111/j.1708-8305.2008.00249.x]
30. de Oliveira, W.D.; Barboza, M.G.L.; Faustino, G.; Inagaki, W.T.Y.; Sanches, M.S.; Kobayashi, R.K.T.; Vespero, E.C.; Rocha, S.P.D. Virulence, resistance and clonality of Proteus mirabilis isolated from patients with community-acquired urinary tract infection (CA-UTI) in Brazil. Microb. Pathog.; 2021; 152, 104642. [DOI: https://dx.doi.org/10.1016/j.micpath.2020.104642]
31.
32. EUCAST. Breakpoint Tables for Interpretation of MICs and Zone Diameters, Version 9.0; European Committee on Antimicrobial Susceptibility Testing: Växjö, Sweden, 2019; Available online: http://www.eucast.org/clinical_breakpoints (accessed on 1 May 2021).
33. Wirth, T.; Falush, D.; Lan, R.; Colles, F.; Mensa, P.; Wieler, L.H.; Karch, H.; Reeves, P.R.; Maiden, M.C.; Ochman, H. et al. Sex and virulence in Escherichia coli: An evolutionary perspective. Mol. Microbiol.; 2006; 60, pp. 1136-1151. [DOI: https://dx.doi.org/10.1111/j.1365-2958.2006.05172.x]
34. Chen, L.; Chen, Z.L.; Liu, J.H.; Zeng, Z.L.; Ma, J.Y.; Jiang, H.X. Emergence of RmtB methylase-producing Escherichia coli and Enterobacter cloacae isolates from pigs in China. J. Antimicrob. Chemother.; 2007; 59, pp. 880-885. [DOI: https://dx.doi.org/10.1093/jac/dkm065] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17353219]
35. Carattoli, A.; Bertini, A.; Villa, L.; Falbo, V.; Hopkins, K.L.; Threlfall, E.J. Identification of plasmids by PCR-based replicon typing. J. Microbiol. Methods; 2005; 63, pp. 219-228. [DOI: https://dx.doi.org/10.1016/j.mimet.2005.03.018] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15935499]
36. Johnson, T.; Bielak, E.; Fortini, D.; Hansen, L.; Hasman, H.; Debroy, C.; Nolan, L.; Carattoli, A. Expansion of the IncX plasmid family for improved identification and typing of novel plasmids in drug-resistant Enterobacteriaceae. Plasmid; 2012; 68, pp. 43-50. [DOI: https://dx.doi.org/10.1016/j.plasmid.2012.03.001] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22470007]
37. Chen, L.; Chavda, K.D.; Al Laham, N.; Melano, R.G.; Jacobs, M.R.; Bonomo, R.A.; Kreiswirth, B.N. Complete nucleotide sequence of a blaKPC-harboring IncI2 plasmid and its dissemination in New Jersey and New York hospitals. Antimicrob. Agents Chemother.; 2013; 57, pp. 5019-5025. [DOI: https://dx.doi.org/10.1128/AAC.01397-13] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23896467]
38. Larsen, M.; Cosentino, S.; Rasmussen, S.; Friis, C.; Hasman, H.; Marvig, R.; Jelsbak, L.; Sicheritz-Pontén, T.; Ussery, D.; Aarestrup, F. et al. Multilocus sequence typing of total-genome-sequenced bacteria. J. Clin. Microbiol.; 2012; 50, pp. 1355-1361. [DOI: https://dx.doi.org/10.1128/JCM.06094-11]
39. Alikhan, N.; Petty, N.; Ben Zakour, N.; Beatson, S. BLAST Ring Image Generator (BRIG): Simple prokaryote genome comparisons. BMC Genom.; 2011; 12, 402. [DOI: https://dx.doi.org/10.1186/1471-2164-12-402]
40. Sullivan, M.; Petty, N.; Beatson, S. Easyfig: A genome comparison visualizer. Bioinformatics; 2011; 27, pp. 1009-1010. [DOI: https://dx.doi.org/10.1093/bioinformatics/btr039]
41. Cui, C.Y.; Chen, C.; Liu, B.T.; He, Q.; Wu, X.T.; Sun, R.Y.; Zhang, Y.; Cui, Z.H.; Guo, W.Y.; Jia, Q.L. et al. Co-occurrence of Plasmid-Mediated Tigecycline and Carbapenem Resistance in Acinetobacter spp. from Waterfowls and Their Neighboring Environment. Antimicrob. Agents Chemother.; 2020; 64, e02502-19. [DOI: https://dx.doi.org/10.1128/AAC.02502-19]
42. Bourafa, N.; Chaalal, W.; Bakour, S.; Lalaoui, R.; Boutefnouchet, N.; Diene, S.; Rolain, J. Molecular characterization of carbapenem-resistant Gram-negative bacilli clinical isolates in Algeria. Infect. Drug Resist.; 2018; 11, pp. 735-742. [DOI: https://dx.doi.org/10.2147/IDR.S150005]
43. Kanzari, L.; Ferjani, S.; Saidani, M.; Hamzaoui, Z.; Jendoubi, A.; Harbaoui, S.; Ferjani, A.; Rehaiem, A.; Boutiba Ben Boubaker, I.; Slim, A. First report of extensively-drug-resistant Proteus mirabilis isolate carrying plasmid-mediated blaNDM-1 in a Tunisian intensive care unit. Int. J. Antimicrob. Agents; 2018; 52, pp. 906-909. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2018.06.009]
44. Aires-de-Sousa, M.; de la Rosa, J.O.; Goncalves, M.; Costa, A.; Nordmann, P.; Poirel, L. Occurrence of NDM-1-producing Morganella morganii and Proteus mirabilis in a single patient in Portugal: Probable in vivo transfer by conjugation. J. Antimicrob. Chemother.; 2020; 75, pp. 903-906. [DOI: https://dx.doi.org/10.1093/jac/dkz542] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31971235]
45. Valentin, T.; Feierl, G.; Masoud-Landgraf, L.; Kohek, P.; Luxner, J.; Zarfel, G. Proteus mirabilis harboring carbapenemase NDM-5 and ESBL VEB-6 detected in Austria. Diagn. Microbiol. Infect. Dis.; 2018; 91, pp. 284-286. [DOI: https://dx.doi.org/10.1016/j.diagmicrobio.2018.02.009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29571841]
46. Barbieri, N.; Pimenta, R.; de Melo, D.; Nolan, L.; de Souza, M.; Logue, C. mcr-1 Identified in Fecal Escherichia coli and Avian Pathogenic E. coli (APEC) From Brazil. Front. Microbiol.; 2021; 12, 659613. [DOI: https://dx.doi.org/10.3389/fmicb.2021.659613] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33959114]
47. Lv, Z.; Shen, Y.; Liu, W.; Ye, H.; Liu, D.; Liu, J.; Fu, Y.; Peng, C.; Chen, K.; Deng, X. et al. Prevalence and risk factors of mcr-1-positive volunteers after colistin banning as animal growth promoter in China: A community-based case-control study. Clin. Microbiol. Infect.; 2022; 28, pp. 267-272. [DOI: https://dx.doi.org/10.1016/j.cmi.2021.06.033] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34197932]
48. Zhang, S.; Huang, Y.; Yang, G.; Lei, T.; Chen, M.; Ye, Q.; Wang, J.; Gu, Q.; Wei, X.; Zhang, J. et al. High prevalence of multidrug-resistant Escherichia coli and first detection of IncHI2/IncX4-plasmid carrying mcr-1 E. coli in retail ready-to-eat foods in China. Int. J. Food Microbiol.; 2021; 355, 109349. [DOI: https://dx.doi.org/10.1016/j.ijfoodmicro.2021.109349]
49. Liu, B.; Li, X.; Zhang, Q.; Shan, H.; Zou, M.; Song, F. Colistin-Resistant mcr-Positive Enterobacteriaceae in Fresh Vegetables, an Increasing Infectious Threat in China. Int. J. Antimicrob. Agents; 2019; 54, pp. 89-94. [DOI: https://dx.doi.org/10.1016/j.ijantimicag.2019.04.013]
50. Sun, J.; Zhang, H.; Liu, Y.H.; Feng, Y. Towards Understanding MCR-like Colistin Resistance. Trends Microbiol.; 2018; 26, pp. 794-808. [DOI: https://dx.doi.org/10.1016/j.tim.2018.02.006]
51. Kopotsa, K.; Sekyere, J.O.; Mbelle, N.M. Plasmid evolution in carbapenemase-producing Enterobacteriaceae: A review. Ann. N. Y. Acad. Sci.; 2019; 1457, pp. 61-91. [DOI: https://dx.doi.org/10.1111/nyas.14223]
52. Liu, B.; Guo, Y.; Liu, N.; Wang, J.; Li, F.; Yao, L.; Zhuo, C. In silico Evolution and Comparative Genomic Analysis of IncX3 Plasmids Isolated From China Over Ten Years. Front. Microbiol.; 2021; 12, 725391. [DOI: https://dx.doi.org/10.3389/fmicb.2021.725391]
53. Xie, X.; Zhang, J.; Wang, H.N.; Lei, C.W. Whole genome sequence of a New Delhi metallo-beta-lactamase 1-producing Proteus mirabilis isolate SNYG35 from broiler chicken in China. J. Glob. Antimicrob. Resist.; 2021; 24, pp. 266-269. [DOI: https://dx.doi.org/10.1016/j.jgar.2020.12.023]
54. Zhu, X.; Zhang, Y.; Shen, Z.; Xia, L.; Wang, J.; Zhao, L.; Wang, K.; Wang, W.; Hao, Z.; Liu, Z. Characterization of NDM-1-Producing Carbapenemase in Proteus mirabilis among Broilers in China. Microorganisms; 2021; 9, 2443. [DOI: https://dx.doi.org/10.3390/microorganisms9122443] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34946044]
55. Toleman, M.A.; Bennett, P.M.; Walsh, T.R. ISCR elements: Novel gene-capturing systems of the 21st century?. Microbiol. Mol. Biol. Rev.; 2006; 70, pp. 296-316. [DOI: https://dx.doi.org/10.1128/MMBR.00048-05] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16760305]
56. Li, J.; Lan, R.; Xiong, Y.; Ye, C.; Yuan, M.; Liu, X.; Chen, X.; Yu, D.; Liu, B.; Lin, W. et al. Sequential isolation in a patient of Raoultella planticola and Escherichia coli bearing a novel ISCR1 element carrying blaNDM-1. PLoS ONE; 2014; 9, e89893. [DOI: https://dx.doi.org/10.1371/journal.pone.0089893] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/24594606]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
1 College of Veterinary Medicine, Qingdao Agricultural University, Qingdao 266109, China
2 Institute of Plant Protection, Qingdao Academy of Agricultural Sciences, Qingdao 266100, China