1. Introduction
Ambrosia artemisiifolia L. is a globally invasive weed that is native to North America. Owing to its extremely high allergenicity and competitive power, A. artemisiifolia pollen has caused serious damage to human health and agricultural ecosystems and is listed as a quarantined agricultural weed in China [1,2]. Ophraella communa Lesage originated in North America and is an oligophagous phytophagous insect and a specific enemy of A. artemisiifolia. Their entire life cycle is accomplished on A. artemisiifolia by feeding on the leaves and meristems of A. artemisiifolia as both adults and larvae. In recent years, great success has been achieved in the biological control of A. artemisiifolia using leaf beetles in southern China [3]. The oligophagous characteristics of O. communa make it a perfect model for studying insect–plant communication.
Insects are the most numerous animal group on Earth, 40–50% of which are phytophagous insects. In interspecific communication between herbivorous insects and plants, the sensitive olfactory system plays a crucial role in locating host plants. The olfactory sensation of insects depends on the olfactory sense organ, which is distributed on the antennae and whiskers. The recognition of external odorant molecules requires olfactory proteins, such as odorant-binding proteins (OBPs), chemosensory proteins (CSPs), odorant receptors (ORs), ionotropic receptors (IRs), sensory neuron membrane proteins (SNMPs), and odorant-degrading enzymes (ODEs), for odorant molecule transduction [4,5,6]. During olfactory perception, OBPs first interact with external volatile compounds and transport them to olfactory neurons to activate ORs distributed on the surface of dendritic membranes, which is essential for the normal operation of the insect olfactory system [7].
Insect OBPs are small soluble proteins abundant in the tactile receptors of insects [8,9]. The protein sequences of insect OBPs include highly conserved cysteines with a specific number of amino acid residues between them. For example, classical OBPs include six conserved cysteine residues, of which Coleoptera have two modes: C1-X23-44-C2-X3-C3-X36-43-C4-X8-12-C5-X8-C6 and C1-X21-68-C2-X3-C3-X21-46-C4-X8-28-C5-X8-9-C6. The three-dimensional structure of classical OBPs comprises six α-helical domains that form hydrophobic cavities [10,11]. In addition, six conserved cysteines form three interlocking disulfide bonds and fold to form a tight and stable hydrophobic binding cavity, which increases the structural stability of OBPs to a certain extent [12,13]. The stable sequence structure of OBPs plays an important role in maintaining their function.
Vogt and Riddiford (1981) first identified pheromone-binding proteins (PBPs) in the antennae of male Antheraea polyphemus [14]. OBPs have been discovered through transcriptome and genome analyses, and many functions of insect OBPs have been revealed through electrophysiology, insect behavior analysis, and in vitro binding experiments. The main function of OBPs is to recognize odor molecules and transport them to ORs [15]. OBPs can also increase the sensitivity of insect olfactory systems, regulate mating behavior, and participate in the tasting process [16,17,18,19,20]. For example, the RNAi-mediated downregulation of OBP56h expression alters the biosynthesis of epidermal pheromones, including the synthesis of 5-tricosene sex pheromones, resulting in delayed mating latency in Drosophila melanogaster [17]. Recently, RNAi technology has been widely used in integrated pest management research. The RNAi technology is a highly conserved in vivo mechanism for inhibiting gene expression. Studies on silencing target genes have promoted the exploration of insect gene functions [21].
The OBP function of O. communna has not been reported, and the role of OcomOBPs in recognition of A. artemisiifolia volatiles by O. communa is still unclear. In this study, the full-length sequence of OcomOBP7 was cloned, and its sequence characteristics and expression profiles were analyzed. After the prokaryotic expression and purification of the OcomOBP7 protein, fluorescence competitive binding analysis, RNAi, and electroantennography (EAG) experiments were performed to clarify the olfactory recognition mechanism and function of OcomOBP7. This study provides a theoretical basis for explaining the molecular mechanism of host recognition by O. communa and lays a foundation for the better biological control of A. artemisiifolia by O. communa in the future.
2. Materials and Methods
2.1. Insect Source
The test insects were collected from the Langfang Experimental Station of the Chinese Academy of Agricultural Sciences, Hebei Province, China. All leaf beetles were raised on fresh A. artemisiifolia plants. The feeding environment was T = 26 ± 1 °C, RH = 70 ± 10%, and L:D = 14:10 h.
2.2. Gene Cloning and Sequence Analysis
Total RNA was isolated from male and female antennae of 2–3-day-old O. communa using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from 1 μg of total RNA using reverse transcriptase (TransGen Biotech, Beijing, China). Based on a previous antennal transcriptome of O. communa [22], specific primers were designed using Primer 5.0 software (PREMIER Biosoft International) to amplify the open reading frame of the OcomOBP7 gene; the primer sequences are shown in Table 1.
The PCR product was purified and ligated into the pEASY-T3 vector (TransGen Biotech, Beijing, China). The ligation products were then transformed into Trans-T1 chemosensory cells (TransGen Biotech, Beijing, China) and coated on an AMP-resistant plate to screen for positive colonies.
SignalP 5.0 (
2.3. Quantitative Real-Time PCR Analysis
Total RNA was isolated from different tissues (male antennae, female antennae, heads, thoraxes, wings, legs, testes, and ovaries) of 2–3-day-old O. communa using TRIzol reagent (Invitrogen, Waltham, MA, USA). First-strand cDNA was synthesized from 1 μg of total RNA using reverse transcriptase (TransGen Biotech, Beijing, China). The expression of OcomOBP7 in different tissues was investigated using real-time quantitative PCR (RT-qPCR). RT-qPCR was conducted on an ABI 7500 Fast Detection System (Thermo Scientific, Waltham, MA, USA) using Hieff qPCR SYBR Green Master Mix (TransGen Biotech, Beijing, China). The RT-qPCR amplification reaction conditions were as follows: denaturation at 95 °C for 5 min and 40 cycles at 95 °C for 10 s and 60 °C for 30 s, followed by melting curve analysis with instrument default settings.
2.4. Heterologous Expression and Purification of OcomOBP7
Based on the full-length gene sequence of OcomOBP7, the signal peptide was removed, and primers with restriction sites were designed to amplify the target fragment. The target fragment and pET28a vector were double-digested with restriction enzymes BamHI and HindIII (Yeasen Biotech, Shanghai, China), and the target fragment was ligated into the expression vector. The recombinant plasmid was transformed into TOP10-competent cells, and the correctly sequenced recombinant plasmid was transformed into BL21(DE3)-competent cells (Yeasen Biotech, Shanghai, China). When the culture OD600 reached 0.6, the expression of the OcomOBP7 protein was induced using isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 1 mM at 37 °C for 10 h. The culture was centrifuged at 8000 rpm for 30 min, and the pellet was suspended in 1 × PBS, sonicated 200 times, and centrifuged. Inclusion bodies were denatured using 6 M guanidine hydrochloride and renatured using the redox method. Proteins were purified by HisTrap HP Ni ion affinity chromatography using the Rapid Protein Purification System KTA™ Avant 25 (General Electric, Boston, MA, USA). SDS-PAGE was used to monitor protein expression and purification. Protein concentration was determined using the Solarbio BCA Protein Concentration Assay Kit (Solarbio Science&Technology, Beijing, China).
After SDS-PAGE of the purified OcomOBP7 protein, the target gel was cut off and sent to the Beijing Protein Innovation Company for liquid chromatography–mass spectrometry (LC-MS/MS).
2.5. Fluorescence Binding Assay
Based on previous research on the volatiles of A. artemisiifolia [23], 26 standard chemical odors were selected to verify the binding characteristics of OcomOBP7 using a fluorescence binding assay (Table 2).
Fluorescence competition binding experiments were performed using an F-380 fluorescence spectrophotometer (Gangdong Technology, Tianjin, China), and the quartz cuvette was 1 cm wide. The excitation and emission slits were 10 nm, the sensitivity was 2 s, the emission wavelength range was 360–500 nm, the excitation wavelength was 337 nm, and the scanning speed was 1200 nm/min. The fluorescent probe, 1-NPN, was dissolved in a chromatographic methanol solution at a concentration of 1 mM. The target protein was diluted to 2 μM with 50 mM Tris-HCl (pH 7.4), and 1 mL of protein diluent was added to the cuvette. The 1-NPN fluorescent probe was added to the protein diluent to obtain a final concentration of 2–20 μM and was allowed to stand for 30 s after mixing. The maximum fluorescence value for each addition of 1-NPN was recorded, and three replicates were used. The 1-NPN fluorescent probe was added to the protein diluent at a final concentration of 2 μM, mixed well, and allowed to stand for 30 s. The maximum fluorescence intensity of 1-NPN was recorded. The odorant ligand was then added at a final concentration of 2–20 μM, and the maximum fluorescence value produced by the mixed solution was determined.
The dissociation constants Ki of OcomOBP7 and the fluorescent ligand compounds were calculated using the Scatchard equation. The formula is as follows: Ki = [IC50]/(1 + [1-NPN]/K1-NPN), where [1-NPN] represents the concentration of unbound 1-NPN, and K1-NPN is the binding constant of the OcomOBP7/1-NPN complex.
2.6. RNAi-Mediated Gene Silencing
dsRNA templates were synthesized by PCR using primers containing the T7 promoter sequence as templates. dsRNA was synthesized in vitro using a T7 RNAi Transcription Kit (Ambion Inc., Waltham, MA, USA) according to the manufacturer’s instructions. dsRNA was dissolved in DEPC water and its concentration determined using a Nanophotometer P330 (Implen, Germany). The quality of RNA was determined using 1% gel electrophoresis. Female and male adults with an initial emergence of <12 h were injected. A Nanoliter 2000 microinjector (WPI, Sarasota, FL, USA) was used to inject 1 ng of dsRNA into the pronotum of beetles. dsEGFP was used as a control. After injection, the beetles were kept in Petri dishes and fed fresh A. artemisiifolia leaves daily.
2.7. Electrophysiological Recordings
Based on the fluorescence binding experimental results, α-pinene, ocimene, and myrcene were used for the electrophysiological experiments. The universal hydrophobic solvent n-hexane was tested for use in EAG experiments [24,25]; the antennae of O. communa did not have an EAG response to it. Therefore, the odorants in this experiment were dissolved in n-hexane at a final concentration of 10 μg/μL, with n-hexane alone serving as a blank control. Filter paper strips with 10 μL of odorant were placed in a Pasteur Pipette for EAG experiments. The head and end of one antenna of the O. communa adult were cut off with a blade 48 h after the injection of dsRNA. A glass electrode filled with KCl conductivity liquid was inserted into the incision of the head of the O. communa and then connected to the electroantennogram system. The antenna incision was connected to a glass electrode at the other end using a micromanipulator. Each odorant was stimulated for 0.2 s with an interval of more than 30 s. Each treatment consisted of more than 20 biological replicates. Finally, the response curve was recorded using the EAG2000 software.
2.8. Statistical Analysis
All statistical tests were conducted using IBM SPSS Statistics for Windows version 25.0 (IBM). Different tissue expression levels of OcomOBP7 were calculated using the comparative 2−∆∆Ct method. Multiple groups of data were compared using one-way ANOVA. The EAG data were analyzed using two independent samples for nonparametric test analysis. Differences were considered statistically significant at p < 0.05. Images were obtained using OriginPro 9.1 software and GraphPad Prism (version 8.0).
3. Results
3.1. Clone and Sequence Analysis of OcomOBP7
Based on the antennal transcriptome data of O. communa, the OcomOBP7 gene was cloned; the complete ORF was 420 bp, encoding 139 amino acids (Figure S1).
The deduced OcomOBP7 protein contained a signal peptide of 19 amino acids. The predicted molecular weight of the mature protein was 16.5 kDa, and the theoretical PI was 8.74. According to multiple sequence alignment results, the protein sequence similarity between OcomOBP7 and other Coleoptera insects was 44–54%. The deduced amino acid sequence had six conserved cysteines and belonged to the classical OBP family. The cysteine mode of OcomOBP7 was C1-X23-44-C2-X3-C3-X36-43-C4-X8-12-C5-X8-C6 (Figure 1a).
We constructed a phylogenetic tree of the OcomOBP7 protein and homologous sequences of other related species of Coleoptera. According to the phylogenetic tree, CforOBP6 and HaxyOBP7 were clustered together, and other OBP proteins were clustered. the OcomOBP7 and CbowOBP1 of Colaphellus bowringi clustered on the same branch, with a similarity of up to 54% (Figure 1b).
3.2. Expression Profiles of OcomOBP7
The expression patterns of OcomOBP7 were analyzed via RT-qPCR using RNA extracted from female and male antennae, heads, thoraxes, wings, legs, testes, and ovaries. The results showed that OcomOBP7 expression was higher in antennae than in other tissues (Figure 2). There was no significant difference in expression between male and female antennae, indicating that OcomOBP7 may be involved in chemical communication.
3.3. Expression and Purification of OcomOBP7
At 37 °C, the recombinant protein pET28/OcomOBP7 was successfully expressed in E. coli after 10 h of induction with 1 mM IPTG. SDS-PAGE showed that the recombinant protein pET28/OcomOBP7 was expressed in the inclusion bodies. After denaturation and renaturation, the OcomOBP7 fusion protein was purified using nickel affinity chromatography. The band size in the SDS-PAGE was approximately 17 kDa, which was close to the expected molecular weight of 16.5 kDa (Figure S2).
The concentration of purified protein was 1.92 mg/mL. Since the 6 × His tag of pET28a is very small and has little effect on the function of the protein, the purified protein was directly used for fluorescence competitive binding experiments.
The LC-MS/MS identification results for OcomOBP7 were retrieved by database construction. The results showed that the purified protein sample was OBP7 from O. communa (Figure S3).
3.4. Ligand-Binding Characteristic of OcomOBP7
To study the binding ability of OcomOBP7 to A. artemisiifolia volatiles, we first determined the binding constant (Kd) of the protein and probe 1-NPN. The binding curve and Scatchard equation showed that OcomOBP7 had strong binding ability with 1-NPN, and Kd was 1.47 ± 0.20 μM (Figure 3a).
The binding ability of OcomOBP7 to 26 A. artemisiifolia volatiles was determined using a fluorescence competitive binding assay. The IC50 and dissociation constant (Ki) values are listed in Table 2. The smaller the Ki value, the stronger the binding ability was. Among the 26 tested volatiles, 14 A. artemisiifolia volatiles bound to OcomOBP7, including 12 alkenes, 1 alkane, and 1 ester. The binding curves of these 14 volatiles with OcomOBP7 are shown in Figure 3. OcomOBP7 bound most alkenes and had the strongest binding affinity to trans-β-farnesene, with a Ki value of 0.48 ± 0.04 μM. OcomOBP7 showed high binding capacity with ocimene (1.23 ± 0.11 μM), (R)-(+)-dipentene (2.22 ± 0.11 μM), (S)-(-)-limonene (2.55 ± 0.40 μM), DL-limonene (2.84 ± 0.20 μM), α-phellandrene (2.91 ± 0.42 μM), myrcene (3.97 ± 0.85 μM), Y-terpinene (4.70 ± 0.32 μM), sabinene (4.75 ± 0.14 μM), and α-pinene (6.55 ± 0.05 μM). OcomOBP7 also strongly bound to n-octane (0.67 ± 0.12 μM). Moderate binding ability was observed with camphene (9.85 ± 0.66 μM) and β-pinene (10.88 ± 0.59 μM). Borneol acetate showed a weak binding ability to OcomOBP7 (20.37 ± 0.07μM) (Figure 3b,c).
3.5. RNAi and EAG Analysis
To further verify the biological function of OcomOBP7, EAG experiments were performed after the RNAi treatment. The product size of the dsRNA synthesized in this study was 420 bp, which was consistent with the target gene and could be used for subsequent microinjection. dsRNA was injected, and the interference efficiency was detected via RT-qPCR after 48 h. Compared with the injection of dsEGFP, the expression of OcomOBP7 decreased significantly in the antennae of leaf beetles injected with dsOBP7 (F = 38,362.45, p < 0.0001), and the interference efficiency reached 98.4% (Figure 4a).
According to the fluorescence competitive binding experiment results, we selected the A. artemisiifolia volatiles with strong binding ability to OcomOBP7 for electroantennogram experiments to verify the antennal response of O. communa to volatiles after 48 h of RNAi. Because not all A. artemisiifolia volatiles could activate antennal responses to O. communa, we selected three volatiles for RNAi verification. The average EAG responses of O. communa antennae to α-pinene, ocimene, and myrcene in the dsEGFP control group were 0.36 ± 0.03, 0.19 ± 0.01, and 0.10 ± 0.01, respectively (Figure 4b). After the injection of dsRNA, the EAG response of O. communa antennae significantly decreased to 0.28 ± 0.02 and 0.14 ± 0.01 for α-pinene (p = 0.010) and ocimene (p = 0.016), respectively. The EAG response of myrcene slightly decreased to 0.09 ± 0.01; however, it was not significantly different to the dsEGFP control group (p = 0.217).
4. Discussion
Antennae are the main organs of insects that receive external information and harbor various olfactory genes and proteins. OBPs are essential for insects to recognize external odors; they play important roles in regulating insect behavior and the chemical communication mechanisms of insects [26,27]. Based on previous studies, 25 putative odorant-binding proteins were identified in the antennal transcriptome of O. communa [22]. In the present study, we cloned the full-length OBP7 gene of O. communa and analyzed its sequence characteristics, expression profiles, and binding affinities. The amino acid sequence of OcomOBP7 contains six conserved cysteine sequences and a classical structure that belongs to the classical OBP family [28,29,30].
Studies have shown that the expression of OBPs in different tissues may be related to different physiological functions [31]. For example, the expression levels of CsupPBP1 and CsupPBP2 in the male antennae of Chilo suppressalis were significantly higher than those in females, and the two PBPs are involved in recognizing pheromones by male insects [16]. The expression levels of AlinOBP11 in the adult legs of Adelphocoris lineolatus were significantly higher than those in other tissues, indicating that AlinOBP11 has important gustatory functions in A. lineolatus [32]. The expression level of OcomOBP7 in the antennae was significantly higher than in other tissues, indicating that it plays an important role in olfaction. In addition, its expression level was not significantly different between the male and female antennae, suggesting OcomOBP7 is involved in olfactory behavior, such as host location, in both sexes.
The structural characteristics of OBP determine its ability to bind odorous molecules [33,34]. Fluorescence competitive binding experiments are now considered a popular method for screening OBP ligands [35]. The results of the fluorescence binding experiments in this study showed that OcomOBP7 had a broad ligand-binding affinity; it could bind 14 of the 26 candidate A. artemisiifolia volatiles, including 12 alkenes, n-octane, and bornyl acetate. Previous studies have shown that the main volatiles of A. artemisiifolia include (E)-β-farnesene, ocimene, limonene, α-pinene, and myrcene [23]. OcomOBP7 showed strong binding with (E)-β-farnesene, ocimene, α-pinene, and myrcene, indicating that these compounds may play an important role in host plant localization. Among these, (E)-β-farnesene had the strongest binding with OcomOBP7. (E)-β-Farnesene is a sesquiterpene compound with a strong aroma and biological activity [36], which may be one of the reasons for its strong binding with OcomOBP7. We also detected OcomOBP7 binding to three isomers of limonene ((+)-dipentene, (S)-(−)-limonene, and DL-limonene). The results showed that the binding abilities of the three isomers were almost the same, indicating that the binding capacities of OBP to the isomers were similar. However, the binding ability of CpunOBP8 to the two isomers of hexyl acetate and ethyl caprylate was significantly different in Conogethes punctiferalis. Of the eight compounds with the same molecular formula, C10H16, CpunOBP9 and CpunABP bound strongly to only two. These results indicate that OBPs have strict requirements for the molecular configuration of odorant ligands [30].
RNAi and EAG experiments were performed to confirm the biological functions of OcomOBP7 in O. communa. According to previous experiment results (unpublished data), α-pinene, ocimene, and mycere could significantly attract the beetles. Thus, to elucidate the olfactory communication mechanism between A. artemisiifolia and O. communa, although OcomOBP7 was a broad-spectrum OBP gene, we focused on the OcomOBP7-binding ability of α-pinene, ocimene, and mycere. In addition, a previous experiment showed that limonene isomers and trans-β-farnesene cannot activate the antennal response via the EAG method. So, we put our focus on α-pinene, ocimene, and mycere. This is similar to s study on Asian honeybees; three odors with high binding affinity to AcerOBP6 did not cause a strong reaction to the antennae, and there was no significant change in the EAG assay [37]. The RT-qPCR results showed that compared with dsEGFP-injected beetles, the expression level of OcomOBP7 in beetles injected with dsOBP7 significantly reduced, and the interference efficiency reached 98.4%. In addition, compared to dsEGFP-injected beetles, the antennal response of dsOBP7-injected O. communa to α-pinene and ocimene decreased significantly. These experimental results indicated that α-pinene and ocimene are odorant ligands that correspond to OcomOBP7. From the perspective of pest control, modulating the OBP gene using RNAi and compromising the olfactory system could represent a novel method for controlling insect pests in future research [38].
In this study, we cloned the OcomOBP7 gene and screened 26 A. artemisiifolia volatiles for binding ability using a fluorescence competitive binding assay to verify the ligands of OcomOBP7 in vitro. RNAi combined with EAG experiments demonstrated that OcomOBP7 was involved in recognizing α-pinene and ocimene. This study highlights the importance of the O. communa–A. artemisiifolia chemical communication mechanisms, which will lay a theoretical foundation for the development of beneficial insect attractants and help control ragweed through biological control.
5. Conclusions
We cloned the OcomOBP7 gene from O. communa and expressed and purified the resulting protein. This protein is a classical OBP that is specifically expressed in the antennae of O. communa. OcomOBP7 had an extensive ability to bind to alkenes. Among them, it had strong binding with limonene, α-pinene, and myrcene, the main volatile components of A. artemisiifolia. RNAi combined with EAG experiments further verified that α-pinene and ocimene are odor ligands of OcomOBP7, and OcomOBP7 participates in the recognition process. In conclusion, the binding of OcomOBP7 to A. artemisiifolia volatiles is broad-spectrum, indicating that it plays an important role in host plant localization.
Conceptualization, T.-H.L., Z.-S.Z. and C.M.; methodology, C.M. and Y.Y.; validation, C.M. and Y.Y.; analysis, C.M., Y.Z., and H.-S.C.; writing—original draft preparation, C.M.; writing—review and editing, J.-Y.G. and Z.-S.Z.; project administration, Z.-S.Z. and C.M.; funding acquisition, Z.-S.Z. and C.M. All authors have read and agreed to the published version of the manuscript.
Data are contained within the article or
We thank the Biological Invasion Laboratory of the Institute of Plant Protection, Chinese Academy of Agricultural Sciences, for their support in this experiment. We are also grateful to Ling Sun from the Langfang Experimental Station of the Chinese Academy of Agricultural Sciences for her support in insect breeding.
The authors declare no conflict of interest. The funders had no role in the study design, collection, analyses, or interpretation of data, writing of the manuscript, or decision to publish the results.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Sequence and phylogenetic analysis of OcomOBP7. (a) Amino acid sequence alignment of OcomOBP7 with other homologous proteins. Target genes are marked in blue, conserved residues are highlighted in white letters with a red background, alignment positions are framed in blue box if the corresponding residues are identical or similar, and Six conserved cysteine residues are labeled with red stars, the helix represents the secondary structure of OcomOBP7. (b) Phylogenetic analysis of OcomOBP7 and other homologous proteins. The target gene is marked with black dots.
Enlarge this image.Figure 2. Expression profiles of OcomOBP7. F-T: female antennae; M-T: male antennae; HE: head; TH: thorax; WI: wing; LE: leg; OV: ovary; TE: testis. All values are shown as the mean ± SD. Different letters indicate significant differences at p < 0.05 by LSD test.
Enlarge this image.Figure 3. Ligand-binding experiment of OcomOBP7. (a) The binding curve of OcomOBP7 and 1-NPN and Scathard equation. (b,c) The binding curve of OcomOBP7 and A. artemisiifolia volatiles.
Enlarge this image.Figure 4. RNA interference of OcomOBP7. (a) The relative expression level of OcomOBP7 after 48 h of RNAi. Different letters indicate significant differences at p < 0.05. (b) EAG response of O. communa to A. artemisiifolia volatiles 48 h after RNAi. The comparison between different treatment groups was analyzed using a nonparametric test. Different letters indicate significant differences at p < 0.05 using nonparametric test.
The primer sequence of OcomOBP7 for cloning, RT-qPCR, and dsRNA.
| Gene Name | Primer Name | Primer Sequence (5′-3′) |
|---|---|---|
| OcomOBP7 | OcomOBP7-F | ATGAAGTGGTTCCTGCTT |
| OcomOBP7-R | TTATGGAAGGAAATAATTTG | |
| OcomOBP7-F-q | GAAAAACAATTAAATGCGACCA | |
| OcomOBP7-R-q | ACCTTCCCAATCAAACGACC | |
| OcomOBP7-eF | GGATCCGCAGTTACAGAAAAACAAT | |
| OcomOBP7-eR | AAGCTTTTATGGAAGGAAATAATTTG | |
| dsOcomOBP7 | dsOcomOBP7-F | TAATACGACTCACTATAGGGATGGAAGATGTATGGTGTG |
| dsOcomOBP7-R | TAATACGACTCACTATAGGGAAGGAAATAATTTGGAGG | |
| dsEGFP | dsEGFP-F | TAATACGACTCACTATAGGGTGAGCAAGGGCGAGGAG |
| dsEGFP-R | TAATACGACTCACTATAGGGCGGCGGTCACGAACTCCAG | |
| RL19 | RL19-F-q | AAGGAAGGCATTGTGGAT |
| RL19-R-q | GACGCAAATCTCGCATAC |
Standard chemical odors used in this study.
| CAS Number | Name of Compound | IC50 (μM) | Ki (μM) | |
|---|---|---|---|---|
| Alkenes | 18794-84-8 | (E)-β-farnesene | 0.76 | 0.48 ± 0.04 |
| 13877-91-3 | Ocimene | 1.94 | 1.23 ± 0.11 | |
| 5989-54-8 | (S)-(-)-Limonene | 4.02 | 2.55 ± 0.40 | |
| 99-85-4 | Y-Terpinene | 7.42 | 4.70 ± 0.32 | |
| 3387-41-5 | Sabinene | 7.49 | 4.75 ± 0.14 | |
| 80-56-8 | α-Pinene | 10.34 | 6.55 ± 0.05 | |
| 2437-95-8 | β-Pinene | 17.18 | 10.88 ± 0.59 | |
| 87-44-5 | β-Caryophyllene | - | - | |
| 6753-98-6 | α-Humulene | - | - | |
| 565-00-4 | Camphene | 15.54 | 9.85 ± 0.66 | |
| 123-35-3 | Myrcene | 6.26 | 3.97 ± 0.85 | |
| 99-83-2 | α-phellandrene | 4.59 | 2.91 ± 0.42 | |
| 5989-27-5 | (R)-(+)-Dipentene | 3.50 | 2.22 ± 0.11 | |
| 124-76-5 | Isoborneol | - | - | |
| 464-49-3 | Camphor | - | - | |
| 138-86-3 | DL-Limonene | 4.48 | 2.84 ± 0.20 | |
| Alkanes | 112-40-3 | n-Dodecane | - | - |
| 629-50-5 | n-Tridecane | - | - | |
| 111-65-9 | n-Octane | 1.05 | 0.67 ± 0.12 | |
| Esters | 3681-71-8 | cis-3-Hexenyl Acetate | - | - |
| 125-12-2 | Isobornyl acetate | - | - | |
| 76-49-3 | Bornyl acetate | 32.16 | 20.37 ± 0.07 | |
| Aldehydes | 124-13-0 | Octanal | - | - |
| 124-19-6 | 1-Nonanal | - | - | |
| Alcohols | 78-70-6 | Linalool | - | - |
| 18479-58-8 | Dihydromyrcenol | - | - |
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Smith, M.; Cecchi, L.; Skjøth, C.A.; Karrer, G.; Šikoparija, B. Common ragweed: A threat to environmental health in Europe. Environ. Int.; 2013; 61, pp. 115-126. [DOI: https://dx.doi.org/10.1016/j.envint.2013.08.005]
2. Han, C.; Shao, H.; Zhou, S.; Mei, Y.; Cheng, Z.; Huang, L.; Lv, G. Chemical composition and phytotoxicity of essential oil from invasive plant, Ambrosia artemisiifolia L. Ecotoxicol. Environ. Saf.; 2021; 211, 111879. [DOI: https://dx.doi.org/10.1016/j.ecoenv.2020.111879] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33465625]
3. Zhou, Z.S.; Chen, H.S.; Zheng, X.W.; Guo, J.Y.; Guo, W.; Li, M.; Luo, M.; Wan, F.H. Control of the invasive weed Ambrosia artemisiifolia with Ophraella communa and Epiblema strenuana. Biocontrol Sci. Tech.; 2014; 24, pp. 950-964. [DOI: https://dx.doi.org/10.1080/09583157.2014.897305]
4. He, P.; Durand, N.; Dong, S.L. Editorial: Insect olfactory proteins (from gene identification to functional characterization). Front. Physiol.; 2019; 10, 1313. [DOI: https://dx.doi.org/10.3389/fphys.2019.01313] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31681019]
5. Pelosi, P.; Iovinella, I.; Zhu, J.; Wang, G.; Dani, F.R. Beyond chemoreception: Diverse tasks of soluble olfactory proteins in insects. Biol. Rev. Camb. Philos. Soc.; 2018; 93, pp. 184-200. [DOI: https://dx.doi.org/10.1111/brv.12339]
6. Leal, W.S. Odorant reception in insects: Roles of receptors, binding proteins, and degrading enzymes. Annu. Rev. Entomol.; 2013; 58, pp. 373-391. [DOI: https://dx.doi.org/10.1146/annurev-ento-120811-153635] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23020622]
7. Fleischer, J.; Pregitzer, P.; Breer, H.; Krieger, J. Access to the odor world: Olfactory receptors and their role for signal transduction in insects. Cell Mol. Life Sci.; 2018; 75, pp. 485-508. [DOI: https://dx.doi.org/10.1007/s00018-017-2627-5]
8. Ahmed, T.; Zhang, T.; Wang, Z.; He, K.; Bai, S. Molecular cloning, expression profile, odorant affinity, and stability of two odorant-binding proteins in Macrocentrus cingulum Brischke (Hymenoptera: Braconidae). Arch. Insect Biochem. Physiol.; 2017; 94, 10. [DOI: https://dx.doi.org/10.1002/arch.21374]
9. Vieira, F.G.; Rozas, J. Comparative genomics of the odorant-binding and chemosensory protein gene families across the Arthropoda: Origin and evolutionary history of the chemosensory system. Genome Biol. Evol.; 2011; 3, pp. 476-490. [DOI: https://dx.doi.org/10.1093/gbe/evr033]
10. Wang, J.; Gao, P.; Luo, Y.; Tao, J. Characterization and expression profiling of odorant-binding proteins in Anoplophora glabripennis Motsch. Gene; 2019; 693, pp. 25-36. [DOI: https://dx.doi.org/10.1016/j.gene.2018.12.075]
11. Pelosi, P.; Zhou, J.J.; Ban, L.P.; Calvello, M. Soluble proteins in insect chemical communication. Cell Mol. Life Sci.; 2006; 63, pp. 1658-1676. [DOI: https://dx.doi.org/10.1007/s00018-005-5607-0]
12. Briand, L.; Nespoulous, C.; Huet, J.C.; Pernollet, J.C. Disulfide pairing and secondary structure of ASP1, an olfactory-binding protein from honeybee (Apis mellifera L.). J. Pept. Res.; 2001; 58, pp. 540-545. [DOI: https://dx.doi.org/10.1034/j.1399-3011.2001.00949.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12005423]
13. Pechlaner, M.; Oostenbrink, C. Multiple binding poses in the hydrophobic cavity of bee odorant binding protein AmelOBP14. J. Chem. Inf. Model.; 2015; 55, pp. 2633-2643. [DOI: https://dx.doi.org/10.1021/acs.jcim.5b00673]
14. Vogt, R.G.; Riddiford, L.M. Pheromone binding and inactivation by moth antennae. Nature; 1981; 293, pp. 161-163. [DOI: https://dx.doi.org/10.1038/293161a0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18074618]
15. Rihani, K.; Ferveur, J.F.; Briand, L. The 40-year mystery of insect odorant-binding proteins. Biomolecules; 2021; 11, 509. [DOI: https://dx.doi.org/10.3390/biom11040509]
16. Chang, H.; Liu, Y.; Yang, T.; Pelosi, P.; Dong, S.; Wang, G. Pheromone binding proteins enhance the sensitivity of olfactory receptors to sex pheromones in Chilo suppressalis. Sci. Rep.; 2015; 5, 13093. [DOI: https://dx.doi.org/10.1038/srep13093]
17. Swarup, S.; Williams, T.I.; Anholt, R.R. Functional dissection of odorant binding protein genes in Drosophila melanogaster. Genes Brain Behav.; 2011; 10, pp. 648-657. [DOI: https://dx.doi.org/10.1111/j.1601-183X.2011.00704.x]
18. Yasukawa, J.; Tomioka, S.; Aigaki, T.; Matsuo, T. Evolution of expression patterns of two odorant-binding protein genes, Obp57d and Obp57e, in Drosophila. Gene; 2010; 467, pp. 25-34. [DOI: https://dx.doi.org/10.1016/j.gene.2010.07.006]
19. Liu, H.; Wang, C.; Qiu, C.L.; Shi, J.H.; Sun, Z.; Hu, X.J.; Liu, L.; Wang, M.Q. A salivary odorant-binding protein mediates Nilaparvata lugens feeding and host plant phytohormone suppression. Int. J. Mol. Sci.; 2021; 22, 4988. [DOI: https://dx.doi.org/10.3390/ijms22094988] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34066665]
20. Jeong, Y.T.; Shim, J.; Oh, S.R.; Yoon, H.I.; Kim, C.H.; Moon, S.J.; Montell, C. An odorant-binding protein required for suppression of sweet taste by bitter chemicals. Neuron; 2013; 79, pp. 725-737. [DOI: https://dx.doi.org/10.1016/j.neuron.2013.06.025]
21. List, F.; Tarone, A.M.; Zhu-Salzman, K.; Vargo, E.L. RNA meets toxicology: Efficacy indicators from the experimental design of RNAi studies for insect pest management. Pest. Manag. Sci; 2022; 78, pp. 3215-3225. [DOI: https://dx.doi.org/10.1002/ps.6884] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35338587]
22. Ma, C.; Zhao, C.; Cui, S.; Zhang, Y.; Zhou, Z. Identification of candidate chemosensory genes of Ophraella communa lesage (coleoptera: Chrysomelidae) based on antennal transcriptome analysis. Sci. Rep.; 2019; 9, 15551. [DOI: https://dx.doi.org/10.1038/s41598-019-52149-x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31664149]
23. Chalchat, J.C.; Maksimović, Z.A.; Petrović, S.D.; Gorunović, M.S.; Dordević, S.; Mraović, M. Chemical composition and antimicrobial activity of Ambrosia artemisiifolia L. essential oil. J. Essent Oil Res.; 2004; 16, pp. 270-273. [DOI: https://dx.doi.org/10.1080/10412905.2004.9698718]
24. Ma, T.; Liu, Z.T.; Zhang, Y.Y.; Sun, Z.H.; Li, Y.Z.; Wen, X.J.; Chen, X.Y. Electrophysiological and behavioral responses of Diaphania glauculalis males to female sex pheromone. Environ. Sci. Pollut. Res. Int.; 2015; 22, pp. 15046-15054. [DOI: https://dx.doi.org/10.1007/s11356-015-4711-4] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26002369]
25. Zehraoui, A.; Hassan, A.A.; Sorial, G.A. Effect of methanol on the biofiltration of n-hexane. J. Hazard. Mater.; 2012; 219–220, pp. 176-182. [DOI: https://dx.doi.org/10.1016/j.jhazmat.2012.03.075]
26. Fan, J.; Francis, F.; Liu, Y.; Chen, J.L.; Cheng, D.F. An overview of odorant-binding protein functions in insect peripheral olfactory reception. Genet. Mol. Res.; 2011; 10, pp. 3056-3069. [DOI: https://dx.doi.org/10.4238/2011.December.8.2]
27. Sims, C.; Birkett, M.A.; Withall, D.M. Enantiomeric discrimination in insects: The role of OBPs and ORs. Insects; 2022; 13, 368. [DOI: https://dx.doi.org/10.3390/insects13040368] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35447810]
28. Pelletier, J.; Leal, W.S. Genome analysis and expression patterns of odorant-binding proteins from the Southern House mosquito Culex pipiens quinquefasciatus. PLoS ONE; 2009; 4, e6237. [DOI: https://dx.doi.org/10.1371/journal.pone.0006237]
29. Li, T.T.; Liu, W.C.; Zhu, J.; Yang, Y.H.; Ma, C.; Lu, C.; Zhang, K.X. Crystal structure and ligand identification of odorant binding protein 4 in the natural predator Chrysopa pallens. Int. J. Biol. Macromol.; 2019; 141, pp. 1004-1012. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2019.09.043]
30. Tian, L.; Guo, H.G.; Ren, Z.G.; Zhang, A.H.; Qin, X.C.; Zhang, M.Z.; Du, Y.L. Ligand-binding specificities of four odorant-binding proteins in Conogethes punctiferalis. Arch. Insect Biochem. Physiol.; 2022; 111, e21947. [DOI: https://dx.doi.org/10.1002/arch.21947]
31. He, P.; Zhang, J.; Liu, N.Y.; Zhang, Y.N.; Yang, K.; Dong, S.L. Distinct expression profiles and different functions of odorant binding proteins in Nilaparvata lugens Stål. PLoS ONE; 2011; 6, e28921. [DOI: https://dx.doi.org/10.1371/journal.pone.0028921]
32. Sun, L.; Wang, Q.; Wang, Q.; Dong, K.; Xiao, Y.; Zhang, Y.J. Identification and characterization of odorant binding proteins in the forelegs of Adelphocoris lineolatus (Goeze). Front. Physiol.; 2017; 8, 735. [DOI: https://dx.doi.org/10.3389/fphys.2017.00735] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29018358]
33. Zhu, J.; Zaremska, V.; D’Onofrio, C.; Knoll, W.; Pelosi, P. Site-directed mutagenesis of odorant-binding proteins. Method Enzymol.; 2020; 642, pp. 301-324.
34. Li, H.L.; Song, X.M.; Wu, F.; Qiu, Y.L.; Fu, X.B.; Zhang, L.Y.; Tan, J. Chemical structure of semiochemicals and key binding sites together determine the olfactory functional modes of odorant-binding protein 2 in Eastern honey bee, Apis cerana. Int. J. Biol. Macromol.; 2020; 145, pp. 876-884. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2019.11.189] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31765753]
35. D’Onofrio, C.; Zaremska, V.; Zhu, J.; Knoll, W.; Pelosi, P. Ligand-binding assays with OBPs and CSPs. Methods Enzymol.; 2020; 642, pp. 229-258. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32828255]
36. Fraga, B.M. Natural sesquiterpenoids. Nat. Prod. Rep.; 2012; 29, pp. 1334-1366. [DOI: https://dx.doi.org/10.1039/c2np20074k] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22918397]
37. Zhao, H.; Peng, Z.; Huang, L.; Zhao, S.; Liu, M. Expression profile and ligand screening of a putative odorant-binding protein, AcerOBP6, from the Asian honeybee. Insects; 2021; 12, 955. [DOI: https://dx.doi.org/10.3390/insects12110955]
38. Adeyinka, O.S.; Riaz, S.; Toufiq, N.; Yousaf, I.; Bhatti, M.U.; Batcho, A.; Olajide, A.A.; Nasir, I.A.; Tabassum, B. Advances in exogenous RNA delivery techniques for RNAi-mediated pest control. Mol. Biol. Rep.; 2020; 47, pp. 6309-6319. [DOI: https://dx.doi.org/10.1007/s11033-020-05666-2]
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Zhang, Yan 2 ; Hong-Song, Chen 3
; Jian-Ying, Guo 2 ; Ting-Hui, Liu 4 ; Zhong-Shi, Zhou 3 1 College of Plant Protection, Hebei Agricultural University, Baoding 071001, China; State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China; National Nanfan Research Institute, Chinese Academy of Agricultural Sciences, Sanya 572019, China
2 State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China; National Nanfan Research Institute, Chinese Academy of Agricultural Sciences, Sanya 572019, China
3 State Key Laboratory for Biology of Plant Diseases and Insect Pests, Institute of Plant Protection, Chinese Academy of Agricultural Sciences, Beijing 100193, China; National Nanfan Research Institute, Chinese Academy of Agricultural Sciences, Sanya 572019, China; Guangxi Key Laboratory for Biology of Crop Diseases and Insect Pests, Institute of Plant Protection, Guangxi Academy of Agricultural Sciences, Nanning 530007, China
4 College of Plant Protection, Hebei Agricultural University, Baoding 071001, China