1. Introduction
Cyanobacteria, also known as Cyanoprokaryota, are diverse and among the most important phyla of photosynthetic prokaryotes, the characterization and identification of which originally relied on traditional morphology [1,2,3]. However, many genera in this group are phenotypically plastic, with small or almost no differences in morphological characteristics. Under these circumstances, identification of cyanobacteria (at both the species and generic levels) by morphology alone is difficult and problematic. The use of modern tools based on molecular data has clarified the taxonomy of cyanobacteria, particularly those lacking clear morphological distinctness [4,5,6]. Sequences of the 16S rRNA gene have become the gold standard and greatly improved the classification and systematics of cyanobacteria [7,8]. Additionally, modern polyphasic tools that combine morphology, ecophysiology, biochemistry, and genetics have led to the establishment of several new orders and families and a relatively large number of new genera and species of cyanobacteria [1,9,10,11,12,13].
In the comprehensive review of Komárek et al. [9], 8 orders, 46 families, and 202 genera of cyanobacterial were described based on phylogenomic analyses. While many taxa have undergone taxonomic revision, several genera have remained unrevised and polyphyletic—particularly those in the Synechococcales [9]. In 2018, Mai et al. [11] made a considerable taxonomic revision of the Synechococcales, with recognition of four families, including two new ones: Oculatellaceae and Trichocoleaceae. Despite the revision, a number of polyphyletic genera still exist in this group, suggesting that further revision is needed. Strunecký et al. [14] extensively evaluated the classification of cyanobacteria at the order and family levels on the basis of phylogenomic and polyphasic analyses, resolving the taxonomy of many families. They [14] also separated several new orders—including Nodosilineales, Oculatellales, and Leptolyngbyales—from the polyphyletic Synechococcales. Leptolyngbyales contains three families—Leptolyngbyaceae (with 21 genera), Trichocoleaceae (with 5 genera), and Neosynechococcaceae (with only 1 genus)—as a product of extensive analysis by polyphasic criteria [14]. Leptolyngbya, belonging to Leptolyngbyaceae, is the largest and most species-rich, but with many taxa that are polyphyletic in origin [9,11,15,16,17]. Using a polyphasic approach, studies have separated and/or split out several strains with Leptolyngbya-like morphotypes as new genera, including Nodosilinea [18], Haloleptolyngbya [19], Pantanalinema, Alkalinema [20], Kovacikia, Oculatella, Stenomitos [21], Chamaethrix [22], Chroakolemma [23], Albertania [24], Euryhalinema, and Leptoelongatus [25]. Some genera were assigned to different families. For instance, Prochlorothrix, Trichocoleus, Halomicronema, Haloleptolyngbya, Oculatella, Nodosilinea, Thermoleptolyngbya, Pinocchia, Elainella, Euryhalinema, Leptoelongatus, and Timaviella—previously assigned to Leptolyngbyaceae [11,25,26]—were treated at the family level [14]. Therefore, for the Leptolyngbyaceae sensu stricto, the 21 monophyletic genera are Alkalinema, Arthronema, Chamaethrix, Chroakolemma, Heteroleibleinia, Jaaginema, Kovacikia, Leptodesmis, Leptolyngbya, Limnolyngbya, Myxacorys, Onodrimia, Pantanalinema, Phormidesmis, Planktolyngbya, Plectolyngbya, Pseudophormidium, Scytolyngbya, Sokolovia, Stenomitos, and Tapinothrix [14]. To achieve better resolution of cyanobacterial taxonomy, new cyanobacteria should be analyzed using modern polyphasic approaches and should be clearly unique phylogenetically, distinct morphologically, and related biochemically and ecologically.
Cyanobacteria/Cyanoprokaryota are ecologically diverse and are distributed over a wide range of habitats, including extreme environments. In China, a number of new genera and species from both coccoid and filamentous groups—including Scytolyngbya [27], Neochroococcus [28], Microcoleusiopsis [29], and Microseira minor [30]—have been reported. The Tibet Autonomous Region (TAR)—a province in southwesternmost China—has a unique topography and geography of varying elevations in which biological diversity—particularly of cyanobacteria—is expected but understudied. One paper reported novel picocyanobacteria from the lakes in eastern Tibet [31]. A new genus in the Nostocalean group that forms distinct purple or black colonies was isolated from wet soil samples in Tibet and named Purpureonostoc [32,33].
Here, for the first time, we describe another free-living cyanobacterial strain isolated from a freshwater wetland meadow at 4922 m above sea level in the Tibet Autonomous Region. Our isolate showed clear morphology that placed it in the Leptolyngbyaceae. Based on evidence from morphology, ecology, and a phylogenetic analysis of the 16S rRNA gene, as well as from other informative molecular markers such as the rbcL gene and the 16S–23S ITS region, we propose it as a novel species.
2. Materials and Methods
2.1. Sampling Site
Samples were collected in August 2020 in Shiqi Village, Maidika Township, Jiali County, Nagqu Prefecture, Tibet Autonomous Region, 31°05′32.69 N, 93°02′48.41 E, 4922 m above sea level. The samples were taken from a meadow that is covered with fresh water in the summer but completely dry or covered by snow in the winter (Figure 1). Samples with a small amount of water were collected and put in clean Ziploc plastic bags, placed in an ice chest, and transported to the laboratory for isolation.
2.2. Culturing and Morphological Description
The samples were first washed with sterile distilled water and cut into small pieces. Isolation was carried out by putting the samples in a nitrogen-reduced BG11 broth with the antifungal cycloheximide [34] to prevent fungal contamination, after which they were maintained in a growth chamber with a 14 h:10 h light/dark cycle. The chamber was equipped with white fluorescent lamps set to a photon flux density of 40 μmol m−2 s−1 and a temperature of 26 °C ± 2 °C. The living strains reported in this paper are currently maintained at the Cycad Symbiotic Microorganism Laboratory (CSML) in the research building of Fairy Lake Botanical Garden, Shenzhen, China. The cyanobacterial strain described herein is designated CSML-F035. The filaments of strain CSML-F035 were observed under a Nikon Eclipse light microscope (Nikon NI-SS 936076, Japan) at a magnification of 100–1000 times. All micrographs presented were taken using a camera (Nikon Y-TV55, Tokyo 108–6920, Japan) attached to the light microscope. The width and length from at least 50 vegetative cells in 25 trichomes were measured and recorded. The appearance of the sheaths, presence of necridia, and apical cell morphologies were also noted and provided in the description. The morphological data from strain CSML-F035 were compared to data available for Stenomitos species. A freeze-dried, metabolically inactive specimen prepared from this material was deposited in the herbarium of Shenzhen Fairy Lake Botanical Garden (SZG) under accession number FLBG-CSML035.
2.3. DNA Extraction, PCR Amplification, and Gene Sequencing
Genomic DNA from strain CSML-F035 was isolated using a sodium dodecyl sulfate (SDS) extraction buffer containing 100 mM Tris HCl (pH 8.0), 50 mM EDTA, and 3% SDS. The DNA was obtained from a culture in the log phase of growth (ca. 14 days) that was harvested from a solid BG11 culture plate. The cells were first rinsed with sterile deionized water three times and then centrifuged for 1 min at 3000 rpm to expel excess water. Lysing of the cells was carried out by a freeze–thawing method (using liquid nitrogen and a water bath at 60 °C) and shaking on a tissue homogenizer with 60 mg glass beads (Tissuelyser 24, Jingxin Technology, Shanghai, China) twice, for 30 s each time [34]. The DNA was stored at −20 °C. The DNA samples were processed for PCR amplification of several molecular markers. First, the 16S rRNA gene with the 16S–23S ITS region was amplified using the primers 8F (5’–AGTTGATCCTGGCTCAG–3′) and BS23SR (5′–CTTCGCCTCTGTGTGCCTAGG–3´). In addition, the 16S rRNA gene and 16S–23S ITS region were also amplified separately using the primers 27F (5′–AGAGTTTGATCCTGGCTCAG–3′) and 1492R (5′–TACGGYTACCTTGTTAYGACTT–3′), and the primers 322F (5´–TGTACACACCGCCCGTC–3´) and 340R (5′–CTCTGTGTGCCTAGGTATCC–3′), respectively. The rbcL gene was additionally amplified, using the primers rbcLf (5′–GACTTCACCAAAGAYGACGAAAACAT–3′) and rbcLr (5′–GAACTCGAACTTRATYTCTTTCCA–3′). These primer regions were adapted from [13,34,35,36,37]. The PCR conditions used for the amplification of the primers mentioned above are provided in Supplementary Table S1 [13,34,35,36,37]. All PCR reactions were performed in 25 µL volumes containing equal volumes of purified water and PCR FastTaq Premix (TOLO Biotech Co., Ltd., Shanghai, China), 1 µL of each primer (0.01 mM concentration), and 1.5 µL of template DNA (20 ng µL−1). PCR amplification was performed on a T100TM Thermal Cycler (BIO-RAD, Singapore). The quality of the PCR products was visualized by horizontal electrophoresis on 1% agarose gel in 1× TAE stained with gel red and sent to TSINGKE Biotechnology Co., Ltd. (Guangdong, China) for sequencing on a 3730XL DNA Analyzer (Applied Biosystems).
2.4. Phylogenetic Analyses
The 16S rRNA gene phylogeny was constructed based on 16S rRNA gene sequences of 107 cyanobacterial taxa retrieved from the NCBI GenBank database. Four copies of 16S rRNA gene sequences were generated from our CSML-F035 strain, but only two sequences (1344 bp, 1359 bp) with consensus files were included in the 16S rRNA gene phylogeny, resulting in a total of 109 cyanobacteria in the 16S rRNA gene phylogeny. Pairwise alignment of these cyanobacterial sequences was performed using the default settings of MAFFT v.450 [38] on Geneious Prime 2023.0.1 [39], edited and proofread manually. The final alignment was ~1370 bp long. The phylogenetic tree was constructed using maximum-likelihood (ML), Bayesian inference (BI), and neighbor-joining (NJ) methods. For the alignment datasets, the model of nucleotide substitution that most appropriately fit under the Bayesian information criterion (BIC) using IQ-TREE v6.10 [40] and jModelTest 2.1.1 [41] on XSEDE on the CIPRES Science Gateway [42] was the TIM3e + R evolutionary model. The maximum-likelihood (ML) phylogeny was built in IQ-TREE v6.10, generating 1000 samples for ultrafast bootstrap and 1000 bootstrap replications [40] following the selected best model. GTR + I + G could also be used as an appropriate alternative model for those alignment datasets, with the TIM3e model as the chosen best model. Therefore, the phylogenetic trees analyzed by the BI and NJ methods were generated in Mr. Bayes v3.2.6 [43], applying the model GTR + I + G and MEGA version X with the Kimura-2 parameter model [44], respectively. The BI execution was composed of two runs with four Markov chain Monte Carlo (MCMC) models running for 10 million generations, until the average standard deviation of split frequencies between runs reached <0.01. The phylogenetic tree consensus files were viewed using FigTree v1.4.4 and rooted with the outgroup Gloeobacter violaceus VP3-01. A maximum-likelihood phylogenetic tree was also constructed based on the rbcL gene. The NCBI GenBank accession numbers for our sequences are OQ175012–OQ175015 for the 16S rRNA gene, OQ175019–OQ175020 for 16S–23S ITS, and OQ200111 for the rbcL gene.
2.5. Secondary Structure Analyses of the 16S–23S Internal Transcribed Spacer (ITS) Region
The 16S–23S ITS operons of the closest taxa to CSML-F035 strain were downloaded from the NCBI GenBank. The RNA structure v6.2 software [45] was used to predict the conserved domains of the 16S–23S ITS regions D1–D1′, V2, Box–B, and V3. We also compared the lengths of the domains in the 16S–23S ITS region, including D1–D1′, Spacer + D2, D3 + Spacer, tRNAisoleucine (tRNA–Ile), V2 + tRNAalanine (tRNA–Ala) Spacer + Box–B + Spacer, Box–A, D4 + Spacer, V3, and the D5 region among CSML-F035 and the other strains under investigation.
2.6. Calculation of p-Distance for the 16S rRNA Gene and 16S–23S ITS Region; Nomenclature
The distance matrix for the percentage similarity of the 16S rRNA gene sequences among strains of Stenomitos and CSML-F035 was determined after pairwise alignment and then viewed on the Distances panel (presented in %) in Geneious Prime. For the 16S–23S rRNA ITS region, similarity was estimated in MEGA v7.0.26 [44], where the p-distances were determined by calculating the sequence dissimilarity based on the formula (1 − p) × 100. Finally, the name for CSML-F035 was established and proposed as Stenomitos nagquensis according to the International Code of Nomenclature for Algae, Fungi, and Plants.
3. Results
3.1. Taxonomic Treatment
Order Leptolyngbyales
Family Leptolyngbyaceae
Stenomitos nagquensis M. Pecundo, X. Wen and T. Chen sp. nov. (Figure 2 and Figure 3):
Description: Colonies were thin, flat, and blue–green, slowly spreading on the surface of solid BG11 medium. Filaments were thin, occasionally coiled, and sometimes appearing loosely parallel or spirally arranged. Two overlapping trichomes in one firm sheath were rarely observed, with false or true branching absent. Trichomes were isopolar, untapered, and clearly constricted at the cross-walls. Mucilaginous sheaths were colorless, firm, hyaline, persistent, and widened in the younger stages, while they were thin in older colonies. Vegetative cells were bright blue–green in younger colonies, green in older stages, isodiametric to slightly longer than wide in younger cells, and wider than long when compressed, particularly in the older stages, reproducing through simple binary fission in a single plane. Polar granules were evident in some vegetative cells, mostly granulated in older stages. Vegetative cells were 0.4–2.2 µm long and 0.5–1.2 µm wide. Apical cells were rounded to slightly conical, rarely elongated, and similar in size with most vegetative cells. Hormogonia were motile and usually composed of 3–10 cells. Thylakoids were parietal. Necridia were present.
Etymology: “nagquensis” refers to the source locality—Nagqu Prefecture, where the cyanobacterial strain was collected and isolated.
Holotype: Metabolically inactive, freeze-dried from cultured material of strain CSML-F035 deposited in the herbarium of Shenzhen Fairy Lake Botanical Garden (SZG); available under accession no. FLBG-CSML 035.
Type locality: Isolated from a wet fresh water meadow in Jiali County, Nagqu, Tibet Autonomous Region, 93°2′48.41 E, 31°5′32.69 N, 4922 m above sea level; sample collected on 6 August 2020 by X. Wen.
Habitat/Source: Free-living in fresh water.
Reference strain: An actively growing culture of CSML-F035 is maintained at Cycad Symbiotic Microbiology Laboratory, Fairy Lake Botanical Garden, Shenzhen, China.
Reference sequences: The GenBank accession numbers for the holotypes 16S rRNA, 16S–23S ITS, and rbcL are OQ175012, OQ175019, and OQ200111, respectively.
3.2. 16S rRNA Gene Sequence Similarity and Phylogenetic Analyses
The four copies of 16S rRNA gene sequences from strain CSML-F035 showed similarity values of 99.4–100% (calculation not shown). The 16S rRNA gene sequence of strain CSML-F035 and the sequences from strains of Stenomitos retrieved from GenBank showed similarities that ranged from 97.2 to 99.3% (Supplementary Table S2, Figure 4), except against S. pantisii, where the sequence similarity was 90.8% (Supplementary Table S2, Figure 4). Specifically, our novel strain had the highest 16S rRNA gene sequence similarity to Stenomitos frigidus BEA 0966B and Stenomitos tremulus CPCC 471, at 99.3% and 99.2%, respectively (Supplementary Table S2, Figure 4). These two strains were isolated from a freshwater source in Las Palmas, Spain and a benthos pond on Bylot Island, Canada, respectively. Furthermore, the sequence similarity of CSML-F035 against other closely related taxa in Leptolyngbyaceae was <95%; in particular, it was 89.0–90.2% against the generitype Leptolyngbya, 95.5% to Neosynechococcus sphagnicola sy1 (Figure 4), 90.8% to Plectolyngbya, 93.9% to Scytolyngbya, 94.6% to Kovacikia muscicola HA7619–LM3, and 90.4% to Myxacorys (calculation not shown). Two sequences from the novel strain CSML-F035 joined the clade of the Stenomitos sensu stricto but positioned in a unique node with strong supporting values from the ML, BI, and NJ analyses. The 16S rRNA gene phylogeny also showed that Stenomitos sensu stricto is a sister group of the newly described taxon Neosynechococcus sphagnicola sy1 isolated from a peat bog in Slovakia (Figure 4). We observed the low support values in the external clades in all of the phylogenies, but the stable position of our novel strain in the Stenomitos was consistent, as inferred by different methods, and was not affected by the unstable placement of other groups in Leptolyngbyaceae. In particular, the placement of the novel strain together with its sister taxon Stenomitos frigidus BEA 0966B in one branch is close to the clade containing six strains labelled Stenomitos frigidus isolated from the Antarctic region (where all of the strains bear ANT on their codes) and “Leptolyngbya nostocorum” UAM 387 isolated from a biofilm sample on a rock surface in the Guadarrama River in Madrid, Spain (Figure 4). It seems that the strain UAM 387 is a member of Stenomitos sensu stricto rather than Leptolyngbya, as was noted in the name of the deposited sequence. The rbcL gene sequence was also successfully amplified from the novel strain CSML-F035. In the rbcL gene phylogenetic tree, our strain formed a clade together with uncultured cyanobacterial strains from deglaciated soils on the Tibetan Plateau, and a sister clade to the strain Stenomitos frigidus ACSSI_171 from solonetz (soil) in Russia (Figure 5). Our novel strain and the cyanobacterial strain ACSSI_171 were placed in different clades in the same larger branch in the monophyletic group of Stenomitos in the 16S rRNA phylogeny (Figure 4). Particularly, ACSSI_171 is close to the clade of Stenomitos frigidus strains CANT/11 and CAU10/11 from biological soil crusts from semiarid regions of Europe, and of Stenomitos sp. UMPCCC 1204 isolated from a water sample in Holland Lake.
3.3. ITS p-Distance Dissimilarity and Secondary Structures of 16S–23S ITS
We obtained three copies of the 16S–23S ITS region from Stenomitos nagquensis CSML-F035, for which all sequences had the two tRNA-encoding genes tRNA–Ile and tRNA–Ala. We determined the p-distance dissimilarity of our strain CSML-F035 against strains for which the ITS operons also have both of these tRNAs (Table 1). This resulted in the comparison of CSML-F035 to 13 closely related strains. The ITS region of our novel strain differed in length in comparison to the closely related strains that we used for analysis. For instance, most of the strains of Stenomitos frigidus Antarctic (ANT) have an ITS region that is 500–600 nucleotides (nt) long, while that of our strain was 700–750 nt long. Comparing the conserved domains of the 16S–23S ITS region among these taxa, most of the strains were similar in length, with only a few nt differences observed in some of the domains. For example, the length of the D1–D1′ helices among the strains compared, including our novel strain, was typically 65 nt, and only the strain KPBAG 10,004 showed 64 nt (Table 2). Likewise, the lengths observed for the Spacer + D2 (with 36–38nt), D3 + Spacer (10 nt), Box-B (39–43 nt), Box–A (26 nt), D4 (13–14 nt), and V3 helices (92–96 nt) were similar (Table 2). On comparison, the V2 helices were remarkably different in length among the taxa, ranging from 65 to 77 nt (Table 2). In fact, two known described species (Stenomitos rutilans HA7619–LM2 and Stenomitos kolaensis Pasv RS28) had only 5 nt in their V2 helices and, therefore, were not included for comparison of the V2 helices.
Lineage separation between species can be considered if the dissimilarity in the 16S–23S rRNA ITS region is more than 7%. The dissimilarity in the 16S–23S ITS region between Stenomitos nagquensis sp. nov. and the 13 comparative related strains ranged from 11.2 to 22.8% (Table 1), further supporting the separation of S. nagquensis sp. nov. from other known strains described in this genus. For the comparison of the folded secondary structures, the D1–D1’ helix of strains in Stenomitos—including S. nagquensis sp. nov.—showed a consistent similar basal region up to the mid-stem below the mid-helix, with minimal differences in the bases on the terminal loop (Figure 6). The same case was observed for the Box–B helices in which S. nagquensis sp. nov was distinct only on the terminal loop consisting of AGCUU nucleoside bases (Figure 7). The V2 and V3 helices were extensive and greatly varied in structure among the strains under investigation (Figure 6 and Figure 7), with only similarity in the most basal region 5′–GUC-GAC–3′ for V3, but slightly varied (5′–GAG/A-UUU/C–3′) for V2 helices. Furthermore, the V2 helix of S. nagquensis is composed of only 2 internal bulges, in comparison to other strains with 3–5 internal bulges (Figure 6). In addition, the V3 helix of our novel strain consists of several unpaired bases from the middle to the top part of the helix (Figure 7) thereby creating an extensive number of small internal bulges compared to the other related strains used for comparison.
4. Discussion
Stenomitos was separated from the polyphyletic and morphologically poorly defined Leptolyngbya in 2016 by a modern polyphasic approach—specifically, by morphology, monophyletic clustering on 16S rRNA-based phylogeny, and p-distance dissimilarity and secondary structures based on the 16S–23S ITS regions [21]. Morphologically, Stenomitos is characterized by thin filaments without false and true branching, trichomes with thin sheaths, and cells with parietal thylakoids [21,46]. Six species collected from a wide range of geographic locations have been described in this group so far, including the type species Stenomitos rutilans [21], S. hiloensis, S. kolaensis [46], S. pantisii [47], S. frigidus (formerly known as Phormidium frigidum [48] and S. tremulus (formerly known as Pseudanabaena tremula) [21]. Herein, we present a cyanobacterial strain S. nagquensis sp. nov., collected and isolated from a freshwater sample in meadow wetland in the Tibet Autonomous Region, which appears to be a new member of this group based on its morphologic characteristics, genetic data, and ecological distinctness.
The established workflow for the description of new taxa begins with the analysis of the genetic distance by comparing the 16S rRNA gene sequences with closely related taxa [49,50]. As previously suggested and followed in contemporary studies on cyanobacterial taxonomic research, 93.4–95% is the similarity cutoff range proposed for species in different genera [51,52], while 98.65–98.7% is the threshold set for strains to be presumed to be different species [53]. However, this may not be the case for several taxa of cyanobacteria proposed as novel species, where the similarity values appear less or more than the reported threshold. For instance, S. pantisii was observed with low 16S rDNA sequence similarity against species of Stenomitos, including our novel strain S. nagquensis (Table S2). In this study, Stenomitos nagquensis was 99.3% similar to Stenomitos frigidus BEA 0966B and 99.2% similar to the type species S. tremulus. In this group alone, newly described taxa show similarity values of >98.7%, i.e., S. kolaensis is 99.2% similar to S. hiloensis, as is S. hiloensis to S. tremulus (Table S2). Similar circumstances were observed for cyanobacterial taxa in other lineages. For example, Odorella benthonica shows 99.92% similarity to Pleurocapsa minor (JQ070059) and is separated by distinct morphology and ecological differences [54], as cited in [55]. In the heterocystous Nostocaceaen group, Desmonostoc muscorum Lukesova 1/87 shows 99.3% 16S rRNA gene sequence similarity to D. geniculatum HA4340-LM1 [21], and D. magnisporum AR6-PS shows 99.1% similarity to D. punense MCC 2741, as both shown in [34,35]. In this circumstance, the p-distance method based on the 16S rRNA gene cannot be used as the only absolute basis for separating terminal taxonomic levels (i.e., genera and species). Therefore, apart from utilizing the gold standard 16S-rRNA-gene-based phylogeny, other informative molecular characteristics—including the analysis of the p-distance dissimilarity of 16S–23S ITS and the prediction of secondary structures—have proven their usefulness as strong additional sources of evidence to support the high similarity values given by the 16S rRNA gene sequence comparison across cyanobacterial lineages [55,56,57].
The 16S rRNA phylogenetic tree revealed that our strain CSML-F035 joined the large cluster of cyanobacteria with strains labelled as Stenomitos frigidus. However, this group is polyphyletic and still in need of taxonomic revision. By looking at the branch containing our strain, a close cluster consisting of Stenomitos frigidus Antarctic (ANT) strains appeared to represent two different species, as already mentioned in [46]. Furthermore, other closely related strains bearing the same name—including strains CAU/CANT (from the semiarid Tabernas Desert, Spain), ACSSI 171 (Russia), AR3 (Valleys, Antarctica), and BEA (Lake, Spain)—are all polyphyletic and occupy their own distinct placement in the 16S rRNA phylogeny; therefore, they require further investigation to merit new names. However, S. frigidus BEA 0966B (GenBank accession number ON032979), to which our novel strain is most similar in terms of genetic distance, and which also sits in one clade in the 16S rRNA phylogeny, lacks published morphological descriptions, 16S–23S ITS regions, and other genetic data, limiting further comparative analysis. This strain shares similar ecological habitats with our novel strain, and both were isolated from freshwater sources, but from two geographically distant areas. Further revisionary work on these strains, including characterization using both molecular and morphological features, will provide a clearer resolution on their taxonomic status. In addition, the geographical range and ecological differences among these strains also provide important notes as to why these species are potentially distinctive from one another. Related ecological factors encompass the concept of cyanobacterial taxonomic descriptions and can be considered as an extension of the polyphasic approach [20,55]. In addition, the use of other molecular markers that have been utilized in previous studies—especially for groups with cryptic traits—could help in the assessment of phylogenetic relationships at the cyanobacterial genus and species levels [35,37]. In this study, the rbcL gene was used as an additional genetic marker for characterizing S. nagquensis sp. nov.
Cyanobacterial morphologies and ultrastructure are remarkably diverse in nature, with the presence of many cryptic taxa that exhibit unrecognizable morphological distinctions. The common problems include either a lack of unique features for diagnosis, the possession of overlapping features with different or unrelated groups [11,55], or both. For example, a cyanobacterial strain (ZJJ01) from a freshwater pond isolated from Zhangjiajie National Forest Park, China, appeared to be morphologically similar to Leptolyngbya but was found to belong to the genus Nodosilinea after further morphologic examination and confirmation from molecular data [57]. Members of the genus Stenomitos are not exempt from morphological plasticity, and they exhibit morphological variability as well. In fact, several species within the genus are described as exactly alike, while other members are more morphologically similar to members from other lineages. For instance, S. pantisii showed exactly the same morphological features as S. kolaensis [47] (see also the morphological comparisons in Table 3), while S. kolaensis itself was reported to be morphologically more similar to Tildeniella nuda (Oculatellaceae) [11,46] than to any previously described member of Stenomitos. S. nagquensis showed strong overlapping morphological features with S. hiloensis, exhibiting smaller cells and a similar shape of vegetative cells, rather than with the generitype S. rutilans or other species described in this genus (Table 3). However, the novel S. nagquensis described in this study was derived from a very different habitat from that of S. hiloensis, which was recovered from the seep wall in a tropical rainforest [46].
The utility of the 16S–23S ITS region has become an effective tool for recognizing intrageneric and intergeneric limits within cyanobacteria [58,59]. It should be noted that many cryptic taxa of cyanobacteria were resolvable through analysis of the 16S–23S ITS region [60]. The percentage dissimilarity within the 16S–23S ITS region is equally useful for delimiting species of cyanobacteria. The percentage dissimilarity within the same species has always been less than 3%, while the percentage dissimilarity between species is typically more than 7.0% [34,59,60]. In this study, all known species and unnamed strains of Stenomitos for which the 16S–23S ITS region was available in NCBI GenBank were retrieved and compared against our strain. Stenomitos nagquensis is distinct from other strains of Stenomitos based on the percentage dissimilarity of the ITS region, which is >11.2%, and fits well within the criteria for species delimitation based on a percentage dissimilarity of >7.0%. This further substantiates the recognition of S. nagquensis as new. However, the p-distance comparison of the ITS region was not made against S. pantisii, since its 16S–23S rRNA ITS region was not available and the given accession number MN185751 [47] is incorrect and was registered to a different organism. Furthermore, only the D1-D1’ and Box-B helices were drawn for S. pantisii [47], but they were both distinct from the D1-D1’ and Box-B structures of S. nagquensis. Altogether, S. nagquensis sp. nov presented significant differences in the paired regions and loops in all of the secondary structures of the D1–D1′, Box–B, V2, and V3 helices when compared to any strains in Stenomitos and other closely related taxa, strongly supporting the recognition of this species as a new member within the genus.
In conclusion, strain CSML-F035 was found to be unique ecologically, phylogenetically, genetically, and in the secondary structures of the 16S–23S ITS region. The evidence substantially supports recognition of Stenomitos nagquensis as new and adds to the knowledge of cyanobacteria in the Tibet region.
Conceptualization, M.H.P., T.C., H.C. and N.L.; methodology and resources, M.H.P., X.W. and Y.W.; software, validation, formal analysis, investigation, data curation, and writing—original draft preparation, M.H.P.; writing—review and editing, and project administration, M.H.P. and T.C.; supervision, Z.H., H.C. and N.L.; funding acquisition, N.L., H.C. and Z.H. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
Not applicable.
We sincerely thank David Boufford for advising on some technical terms and English editing to improve the manuscript.
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1. (a) General appearance of the sampling site; (b) mass of visible macroscopic colonies in fresh water. Photos were taken by X. Wen.
Figure 3. Light micrographs of Stenomitos nagquensis sp. nov. from the strain CSML-F035: (a) Parallel trichomes; isodiametric cells. (b–f) Detail of trichomes with varying shapes of apical cells; some trichomes also showing clear constrictions at the cross-walls. (S) Sheaths; (N) necridia; (A) apical cells; scale bar: 10 µm.
Figure 4. Maximum-likelihood (ML) phylogenetic tree based on the 16S rRNA gene, with node supports from ML, neighbor-joining, and Bayesian inference. Bootstrap and posterior probability values from 99 to 100/1.0 are represented by asterisks (*). The novel species Stenomitos nagquensis, written in bold, is separated on a unique node with high support values. Accession numbers are provided after each taxon name, and the numbers in parentheses after the accession numbers are the percentage similarity values between Stenomitos nagquensis and the taxon.
Figure 5. Maximum-likelihood phylogenetic tree based on the rbcL gene, with node support from ML and Bayesian inference. Bootstrap and posterior probability values from 99 to 100 are represented by asterisks (*). The novel species is written in bold.
Figure 6. Predicted secondary structures of the D1–D1′ and V2 helices of the 16S–23S ITS region of strains of Stenomitos. The novel strain is labelled in bold.
Figure 7. Predicted secondary structures of Box-B and V3 helices of the 16S–23S ITS region of strains of Stenomitos. The novel species is labelled in bold.
Percentage dissimilarity based on 16S–23S ITS sequences for operons containing both tRNA genes among Stenomitos nagquensis sp. nov. and its closely related strains.
Strain | Stenomitos nagquensis CSML-F035 | Stenomitos rutilans HA7619-LM2 | Stenomitos hiloensis HA6792-KK3 | Stenomitos kolaensis Pasv RS28 | Stenomitos frigidus ANT.L52B.3 | Stenomitos frigidus ANT.L8.1 | Stenomitos frigidus ANT.L53B.1 | Stenomitos sp. BACA0708 | Stenomitos sp. BACA0054 | Stenomitos sp. BACA0618 | Stenomitos sp. WJT24NPBG20 | Stenomitos sp. SAG 37.90 | Stenomitos sp. KPABG 610003 |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Stenomitos nagquensis CSML-F035 | |||||||||||||
Stenomitos rutilans HA7619-LM2 | 15.1 | ||||||||||||
Stenomitos hiloensis HA6792-KK3 | 14.1 | 12.3 | |||||||||||
Stenomitos kolaensis Pasv RS28 | 11.2 | 11.6 | 8.6 | ||||||||||
Stenomitos frigidus ANT.L52B.3 | 22.8 | 20.9 | 23.3 | 20.3 | |||||||||
Stenomitos frigidus ANT.L8.1 | 14.1 | 15.6 | 13.8 | 12.6 | 22.8 | ||||||||
Stenomitos frigidus ANT.L53B.1 | 14.1 | 15.3 | 13.6 | 12.6 | 22.8 | 0 | |||||||
Stenomitos sp. BACA0708 | 12.6 | 10.9 | 3.9 | 7.7 | 22.2 | 14.2 | 14.0 | ||||||
Stenomitos sp. BACA0054 | 16.3 | 12.3 | 11.7 | 11.6 | 23.9 | 16.5 | 16.2 | 11.4 | |||||
Stenomitos sp. BACA0618 | 17.2 | 12.0 | 10.7 | 10.8 | 23.5 | 18.1 | 17.8 | 10.1 | 10.8 | ||||
Stenomitos sp. WJT24NPBG20 | 20.1 | 14.2 | 17.5 | 15.2 | 20.7 | 23.8 | 23.8 | 17.2 | 17.2 | 19.1 | |||
Stenomitos sp. SAG 37.90 | 15.7 | 10.6 | 12.7 | 9.3 | 23.3 | 16.6 | 16.3 | 12.2 | 13.0 | 11.8 | 18.7 | ||
Stenomitos sp. KPABG 610003 | 15.7 | 12.9 | 14.3 | 9.9 | 20.7 | 15.0 | 14.7 | 13.9 | 16.3 | 16.3 | 21.3 | 15.8 | |
Stenomitos sp. KPABG 610004 | 15.0 | 15.5 | 13.5 | 12.2 | 24.0 | 11.7 | 11.7 | 13.2 | 15.4 | 16.3 | 21.0 | 15.6 | 14.2 |
Lengths of conserved domains of the 16S–23S rRNA ITS region among Stenomitos nagquensis sp. nov. and its closely related strains.
Strain | D1-D1′ Helix | Spacer + D2 | D3 + Spacer | tRNA–Ile | V2 Helix | tRNA–Ala | Spacer | Box–B Helix | Spacer + Box–A | D4 + Spacer | V3 Helix | D5 region |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Stenomitos nagquensis CSML-F035 | 65 | 38 | 10 | 79 | 65 | 73 | 39 | 39 | 26 | 13 | 94 | 28 |
Stenomitos rutilans HA7619-LM2 | 65 | 36 | 10 | 79 | – | 73 | 48 | 40 | 26 | 14 | 92 | 28 |
Stenomitos hiloensis HA6792-KK3 | 65 | 36 | 10 | 79 | 69 | 73 | 40 | 39 | 26 | 13 | 93 | 28 |
Stenomitos kolaensis Pasv_RS28 | 65 | 37 | 10 | 79 | – | 73 | 42 | 40 | 26 | 13 | 93 | 28 |
Stenomitos frigidus ANT.L52B.3 | 65 | 36 | 10 | 79 | 77 | 73 | 41 | 42 | 26 | 14 | 94 | 17 |
Stenomitos frigidus ANT.L8.1/ANT L53B.1 | 65 | 36 | 10 | 79 | 69 | 73 | 40 | 40 | 26 | 13 | 96 | 17 |
Stenomitos sp. BACA0708 | 65 | 36 | 10 | 79 | 69 | 73 | 37 | 39 | 26 | 13 | 93 | 28 |
Stenomitos sp. BACA0054 | 65 | 36 | 10 | 79 | 75 | 73 | 41 | 39 | 26 | 14 | 93 | 28 |
Stenomitos sp. WJT24NPBG20 | 65 | 36 | 10 | 79 | 74 | 73 | 40 | 43 | 26 | 14 | 93 | 27 |
Stemonitos sp. SAG 37.90 | 65 | 37 | 10 | 79 | 74 | 73 | 41 | 40 | 26 | 14 | 94 | 26 |
Stenomitos sp. KPABG 610003 | 65 | 37 | 10 | 79 | 73 | 73 | 42 | 39 | 26 | 14 | 94 | 28 |
Stenomitos sp. KPABG 61004 | 64 | 37 | 10 | 79 | 68 | 73 | 40 | 40 | 26 | 13 | 96 | 25 |
Stenomitos sp. BACA0618 | 65 | 37 | 10 | 79 | 74 | 73 | 43 | 40 | 26 | 14 | 93 | 28 |
Morphological comparisons of Stenomitos nagquensis sp. nov and known Stenomitos species.
Strain | Color and Appearance of Trichomes | Size of Vegetative Cells Length (µm) | Shapes of Cells | Apical Cells | Appearance of Mucilaginous Sheath | Presence of Necridia | Isolation Source/Habitat Locality | Reference |
---|---|---|---|---|---|---|---|---|
Stenomitos nagquensis CSML-F035 | Bright-to-pale blue–green/short, unbranched, constricted at the cross-walls | 0.4–2.2 | Isodiametric, rarely elongated | Round to slightly conical | Colorless, firm, hyaline | Present | Freshwater, meadow wetland, Tibet, China | This study |
Stenomitos pantisii TAU-MAC 4318 | Blue–green/constricted at the cross-walls | 1.5–2.5 | Isodiametric-to-elongated | Round to slightly conical, elongate | Soft, colorless, hyaline-to-firm | Present | Rocks, grava cave in Corfu Island, Greece | Panou and Gkelis [ |
Stenomitos hiloensis HA6792-KK3 | Blue–green/isopolar, unbranched, untapered, constricted near the cell walls | 0.5–1.2 | Isodiametric | Round | Firm, thin, colorless | Present, frequent | Seep wall, Hilo, |
Shalygin et al. [ |
Stenomitos kolaensis Pasv_RS28 | Bright-to-pale blue–green/constricted at the cross-walls | 1.5–2.5 | Isodiametric-to-elongated | Round to slightly conical, elongated | Soft, colorless, hyaline-to-firm | Present | Soil, Kola, Russia | Shalygin et al. [ |
Stenomitos rutilans HA7619-LM2 | Red–brown/short, tapered, unconstricted at the cross-wall | 2.8–4.8 | Thin, longer than broad | Thin, longer than broad | Absent or present as thin and colorless | Absent | Cave wall, Waikapala’e Cave, Oahu, Hawaii | Miscoe et al. [ |
Stenomitos tremulus UTCC471 | Blue–green/short, straight, bent | 3.0–7.0 | Longer than broad | Bluntly round | Colorless, open | Absent | Pond, Bylot Island, Northwest Canada | Casamatta et al. [ |
Stenomitos frigidus | Blue–green/constricted | 1.0–2.4 | – | Round | Hyaline | Absent | Streams, Antarctica | Miscoe et al.; Fritsch [ |
Supplementary Materials
The following supporting information can be downloaded at
References
1. Komárek, J. Cyanobacterial taxonomy current problems and prospects for the integration of traditional and molecular approaches. Algae; 2006; 2, pp. 249-375. [DOI: https://dx.doi.org/10.4490/ALGAE.2006.21.4.349]
2. Taton, A.; Grubisic, S.; Ertz, D.; Hodgson, D.A.; Piccardi, R.; Biondi, N.; Tredici, M.R.; Mainini, M.; Losi, D.; Marinelli, F. et al. Polyphasic study of Antarctic Cyanobacterial Strains. J. Phycol.; 2006; 42, pp. 1257-1270. [DOI: https://dx.doi.org/10.1111/j.1529-8817.2006.00278.x]
3. Johansen, J.R.; Casamatta, D.A. Recognizing cyanobacterial diversity through adoption of a new species paradigm. Algol. Stud.; 2005; 117, pp. 71-93. [DOI: https://dx.doi.org/10.1127/1864-1318/2005/0117-0071]
4. Komárek, J. Recent changes (2008) in cyanobacteria taxonomy based on a combination of molecular background with phenotype and ecological consequences (genus and species concept). Hydrobiologia; 2010; 1, pp. 245-259. [DOI: https://dx.doi.org/10.1007/s10750-009-0031-3]
5. Johansen, J.R.; Bohunická, M.; Lukešová, A.; Hrčková, K.; Vaccarino, M.A.; Chesarino, N.M. Morphological and molecular characterization within 26 strains of the genus Cylindrospermum (Nostocaceae, Cyanobacteria), with descriptions of three new species. J. Phycol.; 2014; 50, pp. 187-202. [DOI: https://dx.doi.org/10.1111/jpy.12150]
6. Davydov, D.; Vilnet, A. Review of the Cyanobacterial Genus Phormidesmis (Leptolyngbyaceae) with the Description of Apatinema gen. nov. Diversity; 2022; 14, 731. [DOI: https://dx.doi.org/10.3390/d14090731]
7. Wilmotte, A.; Herdman, M. Phylogenetic relationships among cyanobacteria based on 16S rRNA sequences. Bergey’s Manual of Systematic Bacteriology; Boone, D.R.; Castenholz, R.W. Springer: New York, NY, USA, 2001; pp. 487-493.
8. Robertson, B.R.; Tezuka, N.; Watanabe, M. Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. Int. J. Syst. Evol. Microbiol.; 2001; 51, pp. 861-871. [DOI: https://dx.doi.org/10.1099/00207713-51-3-861]
9. Komárek, J.; Kastovsky, J.; Mareš, J.; Johansen, J.R. Taxonomic classification of cyanoprokaryotes (cyanobacterial genera) using a polyphasic approach. Preslia; 2014; 86, pp. 295-335.
10. Sciuto, K.; Moro, I. Detection of the new cosmopolitan genus Thermoleptolyngbya (Cyanobacteria, Leptolyngbyaceae) using the 16S rRNA gene and 16S–23S ITS region. Mol. Phylogenetics Evol.; 2016; 105, pp. 15-35. [DOI: https://dx.doi.org/10.1016/j.ympev.2016.08.010]
11. Mai, T.; Johansen, J.R.; Pietrasiak, N.B.M.; Martin, M.P. Revision of the Synechococcales (Cyanobacteria) through recognition of four families including Oculatellaceae fam. nov. and Trichocoleaceae fam. nov. and six new genera containing 14 species. Phytotaxa; 2018; 365, pp. 1-59. [DOI: https://dx.doi.org/10.11646/phytotaxa.365.1.1]
12. Caires, T.A.; Lyra, G.D.; Hentschke, G.S.; da Silva, A.M.S.; de Araujo, V.L.; Sant’Anna, C.L.; Nunes, J.M.D. Polyphasic delimitation of a filamentous marine genus, Capillus gen. nov. (Cyanobacteria, Oscillatoriaceae) with the description of two Brazilian species. Algae; 2018; 33, pp. 291-304. [DOI: https://dx.doi.org/10.4490/algae.2018.33.11.25]
13. Maltseva, S.; Kezlya, E.; Krivova, Z.; Gusev, E.; Kulikovskiy, M.; Maltsev, Y. Phylogeny and fatty acid profiles of Aliinostoc vietnamicum sp. nov. (Cyanobacteria) from soils of Vietnam. J. Phycol.; 2022; 58, pp. 789-803. [DOI: https://dx.doi.org/10.1111/jpy.13283] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36054495]
14. Strunecký, O.; Ivanovaš, A.P.; Mareš, J. An updated classification of cyanobacterial orders and families based on phylogenomic and polyphasic analysis. J. Phycol.; 2022; 59, pp. 12-51. [DOI: https://dx.doi.org/10.1111/jpy.13304] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36443823]
15. Casamatta, D.A.; Johansen, J.R.; Vis, M.L.; Broadwater, S.T. Molecular and morphological characterization of ten polar and near-polar strains within the Oscillatoriales (Cyanobacteria). J. Phycol.; 2005; 41, pp. 421-438. [DOI: https://dx.doi.org/10.1111/j.1529-8817.2005.04062.x]
16. Komárek, J.; Anagnostidis, K. Cyanoprokaryota II. Süsswasserflora von Mittleuropa 19/2; Büdel, B.; Krienitz, L.; Gärtner, G.; Schagerl, M. Elsevier/Spektrum: München, Germany, 2005; 759.
17. Johansen, J.R.; Olsen, C.E.; Lowe, R.L.; Fučíková, K.; Casamatta, D.A. Leptolyngbya species from selected seep walls in the Great Smoky Mountains National Park. Algol. Stud.; 2008; 126, pp. 21-36. [DOI: https://dx.doi.org/10.1127/1864-1318/2008/0126-0021]
18. Perkerson, R.B.; Johansen, J.R.; Kovacik, L.; Brand, J.; Kastovsky, J.; Casamatta, D.A. A unique pseudanabaenalean (Cyanobacteria) genus Nodosilinea gen. nov. based on morphological and molecular data. J. Phycol.; 2011; 47, pp. 1397-1412. [DOI: https://dx.doi.org/10.1111/j.1529-8817.2011.01077.x]
19. Dadheech, P.W.; Mahmoud, H.; Kotut, K.; Krienitz, L. Haloleptolyngbya alcalis gen.et sp. nov., a new filamentous cyanobacterium from the soda lake Nakuru, Kenya. Hydrobiologia; 2011; 637, pp. 269-283.
20. Vaz, M.G.M.V.; Genuário, D.B.; Andreote, A.P.D.; Malone, C.F.S.; Sant´Anna, C.L.; Barbiero, L.; Fiore, M.F. Pantanalinema gen. nov. and Alkalinema gen. nov.: Novel pseudanabaenacean genera (Cyanobacteria) isolated from saline-alkaline lakes. Int. J. Syst. Evol. Microbiol.; 2015; 65, pp. 298-308. [DOI: https://dx.doi.org/10.1099/ijs.0.070110-0]
21. Miscoe, L.H.; Johansen, J.R.; Vaccarino, M.A.; Pietrasiak, N.; Sherwood, A.R. The diatom flora and cyobacteria from caves on Kauai, Hawaii. II. Novel cyanobacteria from caves on Kauai, Hawaii. Bibl. Phycol.; 2016; 123, pp. 75-152.
22. Dvořák, P.; Hašler, P.; Pitelková, P.; Tabáková, P.; Casamatta, D.A.; Poulíčková, A. A new cyanobacterium from the Everglades, Florida—Chamaethrix gen. nov. Fottea; 2017; 17, pp. 269-276. [DOI: https://dx.doi.org/10.5507/fot.2017.017]
23. Becerra-Absalón, I.; Johansen, J.R.; Muñoz-Martín, M.A.; Gustavo, M. Chroakolemma gen. nov. (Leptolyngbyaceae, Cyanobacteria) from soil biocrusts in the semi-desert Central Region of Mexico. Phytotaxa; 2018; 367, pp. 201-218. [DOI: https://dx.doi.org/10.11646/phytotaxa.367.3.1]
24. Zammit, G. Systematics and biogeography of sciophilous cyanobacteria; an ecological and molecular description of Albertania skiophila (Leptolyngbyaceae) gen. & sp. nov. Phycologia; 2018; 57, pp. 481-491.
25. Chakraborty, S.; Maruthanayagam, V.; Achari, A.; Mahansaria, R.; Pramanik, A.; Jaisankar, P.; Mukherjee, J. Euryhalinema mangrovii gen. nov., sp. nov., and Leptoelongatus litoralis gen. nov., sp. nov. (Leptolyngbyaceae) isolated from an Indian mangrove forest. Phytotaxa; 2019; 422, pp. 58-74. [DOI: https://dx.doi.org/10.11646/phytotaxa.422.1.4]
26. Radzi, R.; Muangmai, N.; Broady, P.; Wan, M.; Merican, F. Nodosilinea signiensis sp. nov. (Leptolyngbyaceae, Synechococcales), a new terrestrial cyanobacterium isolated from mats collected on signy island, south orkney islands, antarctica. PLoS ONE; 2019; 14, e0224395. [DOI: https://dx.doi.org/10.1371/journal.pone.0224395]
27. Song, G.; Jiang, Y.; Li, R. Scytolyngbya timoleontis gen et sp. nov. (Leptolyngbyaceae, Cyanobacteria): A novel false branching Cyanobacteria from China. Phytotaxa; 2015; 224, pp. 72-84. [DOI: https://dx.doi.org/10.11646/phytotaxa.224.1.5]
28. Geng, R.; Wang, Y.; Cai, F.; Zhang, Y.; Yang, P.; Dai, G.; Li, R.; Yu, G. Neochroococcus gongqingensis gen. et sp. nov., a new member of coccoid cyanobacteria from a watercourse, Eastern China. Fottea; 2021; 21, pp. 44-52. [DOI: https://dx.doi.org/10.5507/fot.2020.015]
29. Geng, R.; Li, W.; Chao, A.; Guo, X.; Li, H.; Yu, G.; Li, R. Establishment of a New Filamentous Cyanobacterial Genus, Microcoleusiopsis gen. nov. (Microcoleaceae, Cyanobacteria), from Benthic Mats in Open Channel, Jiangxi Province, China. Diversity; 2021; 13, 548. [DOI: https://dx.doi.org/10.3390/d13110548]
30. Geng, R.Z.; Wen, Q.Z.; Wang, Y.L.; Yang, P.; Dai, G.F.; Li, R.H.; Yu, G.L. A novel filamentous cyanobacterium Microseira minor sp. nov. (Oscillatoriaceae, Cyanobacteria) from the Ganfu Channel, Jiangxi, China. Phytotaxa; 2021; 524, pp. 178-190. [DOI: https://dx.doi.org/10.11646/phytotaxa.524.3.2]
31. Wu, Q.L.; Xing, P.; Liu, W.-T. East Tibetan lakes harbour novel clusters of picocyanobacteria as inferred from the 16S–23S rRNA internal transcribed spacer sequences. Microb. Ecol.; 2010; 59, pp. 614-622. [DOI: https://dx.doi.org/10.1007/s00248-009-9603-z]
32. Cai, F.; Wang, Y.; Yu, G.; Wang, J.; Pen, X.; Li, R. Proposal of Purpurea gen. nov. (Nostocales, Cyanobacteria), a novel cyanobacterial genus from wet soil samples in Tibet, China. Fottea; 2020; 20, pp. 86-97. [DOI: https://dx.doi.org/10.5507/fot.2019.018]
33. Cai, F.; Li, R. Purpureonostoc, a new name for a recently described genus of Nostoc-like cyanobacteria. Fottea; 2020; 20, 111. [DOI: https://dx.doi.org/10.5507/fot.2020.007]
34. Pecundo, M.H.; Cai, F.; Chang, A.C.G.; Ren, H.; Li, N.; Li, R.; Chen, T. Polyphasic approach identifies two new species of Desmonostoc (Nostocales, Cyanobacteria) in the coralloid roots of Cycas fairylakea (Cycadales). Phycologia; 2021; 60, pp. 653-668. [DOI: https://dx.doi.org/10.1080/00318884.2021.1987697]
35. Maltseva, S.; Bachura, Y.; Erst, T.; Kulikovskiy, M.; Maltsev, Y. Description of Desmonostoc caucasicum sp. nov. (Cyanobacteria) using an integrative taxonomic approach. Phycologia; 2022; 61, pp. 514-527. [DOI: https://dx.doi.org/10.1080/00318884.2022.2086428]
36. Iteman, I.; Rippka, R.; Tandeau De Marsac, N.; Herdman, M. Comparison of conserved structural and regulatory domains within divergent 16S rRNA–23S rRNA spacer sequences of cyanobacteria. Microbiology; 2000; 146, pp. 1275-1286. [DOI: https://dx.doi.org/10.1099/00221287-146-6-1275] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10846207]
37. Singh, P.; Fatma, A.; Mishra, A.K. Molecular phylogeny and evogenomics of heterocystous cyanobacteria using rbcl gene sequence data. Ann. Microbiol.; 2015; 65, pp. 799-807. [DOI: https://dx.doi.org/10.1007/s13213-014-0920-1]
38. Katoh, K.; Standley, D.M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol.; 2013; 30, pp. 772-780. [DOI: https://dx.doi.org/10.1093/molbev/mst010]
39. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C. et al. Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics; 2012; 28, pp. 1647-1649. [DOI: https://dx.doi.org/10.1093/bioinformatics/bts199]
40. Trifinopoulos, J.; Nguyen, L.T.; von Haeseler, A.; Minh, B.Q. W-IQTREE: A fast-online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res.; 2016; 44, pp. 232-235. [DOI: https://dx.doi.org/10.1093/nar/gkw256]
41. Darriba, D.; Taboada, G.L.; Doallo, R.; Posada, D. JModelTest 2: More models, new heuristics and parallel computing. Nat. Methods; 2012; 9, 772. [DOI: https://dx.doi.org/10.1038/nmeth.2109]
42. Miller, M.A.; Pfeiffer, W.; Schwartz, T. The CIPRES science gateway: A community resource for phylogenetic analyses. Proceedings of the 2011 TeraGrid Conference: Extreme Digital Discovery; Salt Lake City, UT, USA, 18-21 July 2011; pp. 1-8.
43. Ronquist, F.; Huelsenbeck, J.P. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics; 2003; 19, pp. 1572-1574. [DOI: https://dx.doi.org/10.1093/bioinformatics/btg180]
44. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol.; 2018; 35, pp. 1547-1549. [DOI: https://dx.doi.org/10.1093/molbev/msy096] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29722887]
45. Mathews Lab. RNAstructure, 1996–2019, Version 6.2. Available online: http://rna.urmc.rochester.edu/RNAstructure.html (accessed on 10 June 2021).
46. Shalygin, S.; Shalygina, R.R.; Redkina, V.V.; Gargas, C.B.; Johansen, J.R. Description of Stenomitos kolaensis and S. hiloensis sp. nov. (Leptolyngbyaceae, Cyanobacteria) with an emendation of the genus. Phytotaxa; 2020; 440, pp. 108-128. [DOI: https://dx.doi.org/10.11646/phytotaxa.440.2.3]
47. Panou, M.; Gkelis, S. Unravelling unknown cyanobacteria diversity linked with HCN production. Mol. Phylogenetics Evol.; 2022; 166, 107322. [DOI: https://dx.doi.org/10.1016/j.ympev.2021.107322] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34626811]
48. Fritsch, F.E. Freshwater algae. National Antarctic Expedition 1901–1904 Natural History Zoology and Botany [Part 3]; Anon,. British Museum: London, UK, 1912; Volume VI, pp. 1-66.
49. Stackebrandt, E.; Ebers, J. Taxonomic parameters revisited: Tarnished gold standards. Microbiol. Today; 2006; 33, pp. 152-155.
50. Staley, J.T. The bacterial species dilemma and the genomic–phylogenetic species concept. Philos. Trans. R. Soc.; 2006; 361, pp. 1899-1909. [DOI: https://dx.doi.org/10.1098/rstb.2006.1914]
51. Wayne, L.G.; Brenner, D.J.; Colwell, R.R.; Grimont, P.A.D.; Kandler, O.; Krichevsky, M.I.; Starr, M.P. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Evol. Microbiol.; 1987; 37, pp. 463-464. [DOI: https://dx.doi.org/10.1099/00207713-37-4-463]
52. Pietrasiak, N.; Mühlsteinová, R.; Siegesmund, M.A.; Johansen, J.R. Phylogenetic placement of Symplocastrum (Phormidiaceae, Cyanophyceae) with a new combination S. californicum and two new species: S. fletchnerae and S. torsivum. Phycologia; 2014; 53, pp. 529-541. [DOI: https://dx.doi.org/10.2216/14-029.1]
53. Kim, M.; Oh, H.S.; Park, S.C.; Chun, J. Towards a taxonomic coherence between average nucleotide identity and 16S rRNA gene sequence similarity for species demarcation of prokaryotes. Int. J. Syst. Evol. Microbiol.; 2014; 64, pp. 346-351. [DOI: https://dx.doi.org/10.1099/ijs.0.059774-0]
54. Shalygin, S.; Huang, I.; Allen, E.H.; Burkholder, J.M.; Zimba, P.V. Odorella benthonica gen. & sp. nov. (Pleurocapsales, Cyanobacteria): An odor and prolific toxin producer isolated from a California aqueduct. J. Phycol.; 2019; 55, pp. 509-520.
55. Jung, P.; Mikhailyuk, T.; Emrich, D.; Baumann, K.; Dultz, S.; Büdel, B. Shifting boundaries: Ecological and geographical range extension based on three new species in the cyanobacterial genera Cyanocohniella, Oculatella, and Aliterella. J. Phycol.; 2020; 56, pp. 1216-1231. [DOI: https://dx.doi.org/10.1111/jpy.13025]
56. Rasouli-Dogaheh, S.; Komárek, J.; Chatchawan, T.; Hauer, T. Thainema gen. nov. (Leptolyngbyaceae, Synechococcales): A new genus of simple trichal cyanobacteria isolated from a solar saltern environment in Thailand. PLoS ONE; 2022; 17, e0261682. [DOI: https://dx.doi.org/10.1371/journal.pone.0261682] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34995289]
57. Cai, F.; Li, S.; Zhang, H.; Yu, G.; Li, R. Nodosilinea hunanesis sp. nov. (Prochlorotrichaceae, Synechococcales) from a Freshwater Pond in China Based on a Polyphasic Approach. Diversity; 2022; 14, 364. [DOI: https://dx.doi.org/10.3390/d14050364]
58. Johansen, J.R.; Kovacik, L.; Casamatta, D.A.; Fučiková, K.; Kaštovský, J. Utility of 16S-23S ITS sequence and secondary structure for recognition of intrageneric and intergeneric limits within cyanobacterial taxa: Leptolyngbya corticola sp. nov. (Pseudanabanaceae, Cyanobacteria). Nova Hedwig.; 2011; 92, pp. 283-302. [DOI: https://dx.doi.org/10.1127/0029-5035/2011/0092-0283]
59. Osorio-Santos, K.; Pietrasiak, N.; Bohunická, M.; Miscoe, L.H.; Kovaácik, L.; Martin, M.P.; Johansen, J.R. Seven new species of Oculatella (Pseudanabaenales, Cyanobacteria). Eur. J. Phycol.; 2014; 49, pp. 450-470. [DOI: https://dx.doi.org/10.1080/09670262.2014.976843]
60. Pietrasiak, N.; Osorio-Santos, K.; Shalygin, S.; Martin, M.P.; Johansen, J.R. When is a lineage a species? A case study in Myxacorys gen. nov. (Synechococcales: Cyanobacteria) with the description of two new species from the Americas. J. Phycol.; 2019; 55, pp. 976-996. [DOI: https://dx.doi.org/10.1111/jpy.12897]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
A novel cyanobacterial strain (CSML-F035) here described as Stenomitos nagquensis sp. nov. was isolated from a plateau meadow wetland habitat in the Tibet Autonomous Region. The novel strain was studied based on a polyphasic approach by combining characteristics of cell morphology and evidence from molecular data and ecology. Phylogenetic analyses based on the 16S rRNA and rbcL genes indicated that the novel strain is a member of the genus Stenomitos (Leptolyngbyaceae) but is positioned in a unique clade, with strongly supported values from BI, ML, and NJ methods. The percentage similarity of the 16S rRNA gene sequence of CSML-F035 compared with known strains of Stenomitos was >97%. Morphologically, S. nagquensis sp. nov. possesses overlapping morphological characteristics with other Stenomitos species, with thin trichomes enclosed in a firm, colorless, hyaline, persistent mucilage. However, the strain appeared to have slightly smaller cells compared to most known species of Stenomitos. Further analyses of the 16S–23S ITS region showed dissimilarity at 11.2–22.8% compared to known species of Stenomitos. The secondary helices—including D1–D1, V2, Box–B, and V3—that were predicted based on the 16S–23S ITS region for Stenomitos nagquensis sp. nov. were also distinct, thereby providing strong additional support for the separation of this species. This study highlights the importance of unexplored habitats in the Tibet region in which cyanobacterial diversity can be deemed high, with many potential new species that remain poorly explored.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details



1 Shenzhen Engineering Laboratory of Marine Algal Biotechnology, Guangdong Provincial Key Laboratory of Plant Epigenetics, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China;
2 Fairy Lake Botanical Garden, Chinese Academy of Sciences, Shenzhen 518004, China;
3 Tibet Plateau Institute of Biology, Lhasa 850001, China;
4 Shenzhen Engineering Laboratory of Marine Algal Biotechnology, Guangdong Provincial Key Laboratory of Plant Epigenetics, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China;
5 Shenzhen Engineering Laboratory of Marine Algal Biotechnology, Guangdong Provincial Key Laboratory of Plant Epigenetics, Longhua Innovation Institute for Biotechnology, College of Life Sciences and Oceanography, Shenzhen University, Shenzhen 518060, China;