This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
1. Introduction
Acute respiratory tract infections (ARTIs) are one of the main causes of hospitalization and death in children under 5 years old [1]. At present, respiratory viruses are still the most common pathogens [2], but Mycoplasma pneumoniae(M. pneumoniae, MP) and Chlamydia pneumoniae (C. pneumoniae, CP) infections are becoming increasingly prominent in respiratory infections, causing approximately 10–40% and 5–10% of children’s infections, respectively, and there are 1-2% mixed infections of M. pneumoniae and C. pneumoniae [3–5]. The clinical symptoms of infection with M. pneumoniae and C. pneumoniae lack specificity, and empirical treatment with macrolide antibiotics may lead to an increase in the drug resistance rate. Currently, the drug resistance rate of M. pneumoniae ranges from 85% to 100% [6–8]. Therefore, it is important to have a rapid and accurate laboratory diagnosis before conducting antibacterial treatment. The widely used identification methods in clinical include isolating culture, serum antibody testing, and molecular biology. M. pneumoniae rapidly proliferates in the culture medium, decomposes glucose to produce acid, and changes the pH value of the culture medium so that M. pneumoniae can determine the culture positive by observing the color change of the culture medium. However, M. pneumoniae cultivation conditions are harsh, time-consuming, and the positive rate is low [9, 10], which cannot meet the needs of rapid clinical diagnosis. C. pneumoniae is a microorganism that grows within cells and cannot be cultured in vitro. For the serum antibody detection method, MP-IgM and CP-IgM increase around 1 week of onset, reaching a peak at 3–6 weeks [11]. In the acute phase (within 1 week of onset), MP-IgM is found to be positive in 14%–45% patients [12], so this method cannot achieve the detection purpose in the early stage of infection. The exact sensitivity and specificity of PCR methods vary with the corresponding amplification platform and detection form [13]. Routine PCR needs to be analyzed in agarose gel electrophoresis, which takes a long time and has low sensitivity. The real-time fluorescent PCR method has high sensitivity and good detection specificity, but the requirements for complex equipment and well-trained personnel make it difficult to be widely used in small community hospitals and point-of-care diagnosis [14]. Loop-mediated isothermal amplification (LAMP) technology is a relatively new form of nucleic acid amplification testing, widely used for direct detection of clinically important pathogens, including M. pneumoniae [15]. However, traditionally, detecting turbidity changes in reaction mixtures requires the use of a spectrophotometer, which will limit its widespread use in restricted environments. Although visual detection reagents (VDRs) are an alternative method, the results may become less accurate at low template concentrations [16]. PCR-based DNA biosensors have been designed for the detection of pathogens and drug-resistant genes in the form of test strip nucleic acid detection, with advantages such as rapidity, specificity, sensitivity, low detection limit, and cost-effectiveness [17–21]. This study aimed to establish a multiplex PCR-dipstick DNA chromatography assay for the joint detection of M. pneumoniae and C. pneumoniae based on PCR and strip DNA biosensors.
2. Materials and Methods
2.1. Standard Strain
Standard strains of M. pneumoniae (ATCC15531) and C. pneumoniae (ATCC53592) were purchased from the Guangdong Culture Collection Center.
2.2. Clinical Samples
The study was approved by the medical ethics committee, and consent was obtained from patients’ parents or legal guardians. 300 nasopharyngeal swab specimens and serum samples from hospitalized children with acute respiratory infections at the Second People’s Hospital of Guangdong Province and the People’s Hospital of Guangxi Zhuang Autonomous Region from January 2021 to December 2022 were collected. Nasopharyngeal swab specimens were detected by the multiplex PCR-dipstick DNA chromatography assay, and all PCR products were sent to DNA sequencing. Serum was used for MP-IgM and CP-IgM detection, which MP-IgM and CP-IgM positive indicates corresponding infection.
2.3. Sample Preparation
The nasopharyngeal swab sample was placed in 1 mL sterile physiological saline, stirred 20 times, and centrifuged at a speed of 15,000 rpm for 5 minutes, and then, the supernatant was discarded as much as possible. According to the manufacturer’s instructions, the Magen HiPure bacterial DNA kit was used to extract genomic DNA content from nasopharyngeal swabs. The serum samples were centrifuged at a speed of 3,000 rpm for 5 minutes and sent to the laboratory for MP-IgM and CP-IgM testing.
2.4. Primer and Probe Design
Primers were designed according to the conserved sequence of MP and CP using prime 5.0. The 5′ end of the forward primer is labeled with oligonucleotide (Tag), the 5′ end of the reverse primer is labeled with biotin, and the forward primer end is connected to Tag with spacer C3, which can ensure that Tag remains single-stranded during amplification. In order to verify the DNA extraction efficiency and reaction performance of the sample, an internal control (IC) was designed, which is a synthetic sequence with extremely low sequence homology and will not cross react with other genomes. A pair of primers was also designed for IC. The primers and the probes (Table 1) were synthesized by TBA (Tohoku Bio-Array, TBA, Sendai, Japan).
Table 1
The primers for the PCR-dipstick DNA chromatography assay.
| Primers | Gene | Tag | Sequence (5′-3′) | Amplicon size (bp) |
| MP-F | RI3 | tagctaagtggtccataact | Tag-C3-AAGGAAGCTGACTCCGACAA | 107 |
| MP-R | Biotin-CCAAACACCAAAAGCGCTTG | |||
| CP-F | AR39 | ctgcgggtatagaagccct | Tag-C3-GCACTTTCATGGGAGCCTTT | 92 |
| CP-R | Biotin-GCGCATTCCAAAAGCTTCAC | |||
| Internal control: F | NM-005157 | gctctagccaccaatgaatctaa | Tag IC-C3-CAGAGCACAGAGACACCACT | 153 |
| Internal control: R | Biotin-GGCGCTCATCTTCATTCAGG | |||
F: forward primer; R: reverse primer.
2.5. Establishment of Multiplex PCR-Dipstick DNA Chromatography
2.5.1. Multiplex PCR Reaction
The reaction system includes 2.5 μL 10 × PCR buffer, 5 μL DNA template, 0.5 μL forward and reverse primers of MP and CP (10 μM), respectively, 0.5 μL IC forward and IC reverse primers (2 μM), respectively, 1 μL IC DNA (1 nM), 1.2 μL RT enzyme mixture, 1 μL dUTP + dNTP mixture, 0.02 μL uracil N-glycosylase (UNG), 0.3 μL Taq HS polymerase, and 10.98 μL deionized water, in a total volume of 25 μL. The PCR amplification reaction procedure was performed at 95°C for 3 minutes, and the amplification programme for a total of 40 cycles is as follows: 95°C for 5 s; 60°C for 20 s.
2.5.2. Dipstick DNA Chromatography
The dipstick strip, manufactured by Tohoku Bio-Array, Co., contains three primary components: a polyvinyl chloride (PVC) membrane provides stability and adhesiveness, an absorbent area made of absorbent filter paper, and a sample application area made of a nitrocellulose (NC) membrane. Complementary oligonucleotide probes (cTag) were immobilized on an NC membrane to form M. pneumoniae and C. pneumoniae test lines and an internal control line. In addition, the sample application area was printed with four red position lines. The red line is used as a marker line to locate different bacterial test lines. Biotin at the 5′end of the reverse primer combined with the blue latex microspheres coated with streptavidin to generate signals. Target DNA amplicons with Tag and a biotinylated terminus were coupled with latex beads through a streptavidin-biotin interaction, and then, Tag hybridized with cTag on the strip. The accumulation of captured latex beads on the test line and IC line produced blue bands, enabling visual detection with the naked eye. After PCR amplification, 10 μL PCR products, 9 μL eluent (containing detergent, blocking agent, PBS, and salt solution), and 1 μL of streptavidin-coated blue latex were added to the test tube to form a mixture, and then, the test strip was inserted into the mixture. After 10 minutes, the corresponding test lines and IC lines turn blue, indicating that the target bacteria are positive. If only the IC line shows color, it is negative. If the IC line does not show color, it indicates that the test strip is invalid. The schematic diagram of multiplex PCR-dipstick DNA chromatography is shown in Figure 1.
[figure(s) omitted; refer to PDF]
2.6. Specificity of Multiplex PCR-Dipstick Chromatography
The PCR-dipstick chromatography assay was utilized to detect a concentration of 105CFU/mL of various bacterial pathogens, including M. pneumoniae, C. pneumoniae, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Haemophilus influenzae, Streptococcus pneumoniae, Staphylococcus aureus, Acinetobacter baumannii, Acinetobacter johnsonii, Enterobacteriaceae cloacae, Klebsiella aerogenes, Haemophilus parainfluenzae, Pseudomonas fluorescens, Aeromonas hydrophila, Staphylococcus epidermidis, and Chlamydia psittaci to assess the specificity of this assay.
2.7. Sensitivity of Multiplex PCR-Dipstick Chromatography
In order to assess the limit of detection (LOD) of the PCR-dipstick chromatography assay, serial 10-fold dilutions of M. pneumoniae and C. pneumoniae strain DNA (10–107 CFU/mL) were analyzed by the PCR-dipstick DNA chromatograph assay to determine the sensitivity, and the lowest concentration with a visible blue band at the corresponding detection line was the LOD of the PCR-dipstick chromatography assay.
2.8. Clinical Sample Validation
300 nasopharyngeal swab samples were detected by the PCR-dipstick chromatography assay, and the PCR products were sent for sequencing. The PCR-dipstick chromatography detection results were compared with MP-IgM, CP-IgM, and DNA sequencing, respectively. The diagnostic sensitivity, specificity, positive predictive value, and negative predictive value of the PCR-dipstick chromatography assay were evaluated with DNA sequencing as the gold standard. We used the SPSS pairing χ2 test (McNemar test) to compare the diagnostic efficiency of the PCR-dipstick chromatography assay with MP-IgM, CP-IgM, and DNA sequencing, respectively.
3. Results
3.1. Specificity of Multiplex PCR-Dipstick Chromatography
We detected M. pneumoniae, C. pneumoniae, and 15 pathogens (Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, Haemophilus influenzae, Streptococcus pneumoniae, Staphylococcus aureus, Acinetobacter baumannii, Acinetobacter johnsonii, Enterobacteriaceae cloacae, Klebsiella aerogenes, Haemophilus parainfluenzae, Pseudomonas fluorescens, Aeromonas hydrophila, Staphylococcus epidermidis, and Chlamydia psittaci) by the PCR-dipstick chromatography assay to evaluate the specificity of PCR-dipstick chromatography. There are visible blue bands in the corresponding test line for detection of M. pneumoniae and C. pneumoniae, but none of nonspecific amplification for 15 pathogens, consistent with negative results, implying no cross reaction with the 15 pathogens. Multiplex PCR-dipstick chromatography was applied to detect M. pneumoniae and C. pneumoniae strains’ equivalent mixture (105 CFU/mL), and M. pneumoniae and C. pneumoniae joint detection was observed (Figure 2). The results illustrated multiplex PCR-dipstick chromatography has good specificity and no cross reactivity with other pathogens.
[figure(s) omitted; refer to PDF]
3.2. Sensitivity of Multiplex PCR-Dipstick Chromatography
In order to assess the limit of detection (LOD) of multiplex PCR-dipstick chromatography, serial 10-fold dilutions of M. pneumoniae and C. pneumoniae (10–107 CFU/mL) were analyzed by multiplex PCR-dipstick DNA chromatography to determine the sensitivity. M. pneumoniae and C. pneumoniae sensitivity of the PCR-dipstick chromatography assay was 10 CFU/mL, respectively (Figure 3).
[figure(s) omitted; refer to PDF]
3.3. Data of Clinical Specimens
Nasopharyngeal swab samples of 300 children with an acute respiratory tract infection were detected by the multiplex PCR-dipstick chromatography assay and DNA sequencing. Meanwhile, blood samples from each child were identified by the MP-IgM and CP-IgM antibody assay. As shown in Tables 2 and 3, among the samples from children with an acute respiratory tract infection, 53 (17.7%) of them were positive for MP, 16 (5.3%) of them were positive for CP, and 4 (1.3%) of them were simultaneously positive for MP and CP by the multiplex PCR-dipstick chromatography assay. DNA sequencing showed that 55 cases (18.3%) were MP positive, 17 cases (5.7%) were CP positive, and 4 cases (1.3%) were simultaneously positive for MP and CP. There was no statistical significance for MP and CP detection between the multiplex PCR-dipstick chromatography assay and DNA sequencing (MP:
Table 2
Comparison of clinical specimens of MP data between multiplex PCR-dipstick chromatography assay, DNA sequencing, and MP-IgM.
| PCR-dipstickchromatography | DNA sequencing | Total | MP-IgM | Total | ||||
| Positive | Negative | Kappa value | Positive | Negative | Kappa value | |||
| Positive | 57 | 0 | 57 | 39 | 18 | 57 | ||
| Negative | 2 | 241 | 243 | Kappa = 0.979 | 3 | 240 | 243 | Kappa = 0.747 |
| Total | 59 | 241 | 300 | 42 | 258 | 300 | ||
Table 3
Comparison of clinical specimens of CP data between multiplex PCR-dipstick chromatography assay, DNA sequencing, and CP-IgM.
| PCR-dipstickchromatography | DNA sequencing | Total | CP-IgM | Total | ||||
| Positive | Negative | Kappa value | Positive | Negative | Kappa value | |||
| Positive | 20 | 0 | 20 | 11 | 9 | 20 | ||
| Negative | 1 | 279 | 280 | Kappa = 0.974 | 1 | 279 | 280 | Kappa = 0.671 |
| Total | 21 | 279 | 300 | 12 | 288 | 300 | ||
Blood samples of all children were tested by the MP-IgM and CP-IgM assay. Among 300 samples, 40 cases (13.3%) were positive for MP-IgM, 10 cases (3.3%) were positive for CP-IgM, and 2 cases (0.67%) were simultaneously positive for MP-IgM and CP-IgM. The multiplex PCR-dipstick chromatography assay for detecting MP and CP showed statistical significance compared to serum MP-IgM and CP-IgM, with
4. Discussion
Atypical pneumonia caused by M. pneumoniae and C. pneumoniae has similar respiratory manifestations to bacterial and viral infections, which is prone to misdiagnosis and missed diagnosis. Therefore, rapid, sensitive, and specific detection methods are necessary for clinical diagnosis. In order to improve laboratory diagnosis and reduce the cost and time of detecting M. pneumoniae and C. pneumoniae, we designed and validated a multiplex PCR-dipstick chromatography assay that can simultaneously detect M. pneumoniae and C. pneumoniae. The results indicated that we successfully developed a multiplex PCR-dipstick chromatography assay in this study to achieve rapid detection of M. pneumoniae and C. pneumoniae within 2 hours. Real-time fluorescence quantitative PCR detection is often used to identify M. pneumoniae due to its high sensitivity and specificity [22, 23]. The limit of detection (LOD) of multiplex PCR-dipstick chromatography for M. pneumoniae and C. pneumoniae was 10 CFU/mL, which is not lower than that of real-time fluorescence quantitative PCR. In addition, this assay has strong specificity and does not require complex and expensive equipment. It only requires a regular PCR amplification instrument, which has broad prospects for promotion and application. Using DNA sequencing as the diagnostic gold standard, 300 clinical samples were analyzed by multiplex PCR-dipstick chromatography. The sensitivity, specificity, positive predictive value, and negative predictive value of the multiplex PCR-dipstick chromatography assay for the diagnosis of M. pneumoniae were 96.61%, 100%, 100%, and 99.18%, respectively, and the sensitivity, specificity, positive predictive value, and negative predictive value for the diagnosis of C. pneumoniae were 95.24%, 100%, 100%, and 99.64%, respectively. The positive rate of the multiplex PCR-dipstick chromatography assay was significantly higher than that of the serum IgM antibody assay, with M. pneumoniae (17.7% vs. 13.3%), C. pneumoniae (5.7% vs. 3.3%), and mixed infection of M. pneumoniae and C. pneumoniae (1.3% vs. 0.67%). For 57 positive cases of M. pneumoniae detected by the multiplex PCR-dipstick chromatography assay, only 39 cases were MP-IgM positive and 18 cases were MP-IgM negative. Among the 20 positive cases of CP detected by the multiplex PCR-dipstick chromatography assay, 11 cases were CP-IgM positive and 9 cases were CP-IgM negative. Reviewing the case data of 18 patients with negative MP-IgM and 9 patients with negative CP-IgM, 12 cases of the 18 patients with negative MP-IgM had a disease course of less than one week and 6 cases had a disease course of 7–10 days. Among the 9 patients with negative CP-IgM, 6 cases had a course of less than one week, 2 had a course of 8-9 days, and 1 case had a course of 12 days. Due to the increase of IgM in about one week of onset and reaches its peak in 3–6 weeks [11], the inconsistency between the multiplex PCR-dipstick chromatography assay and serum IgM antibody levels may stem from the presence of an antibody production window during serum antibody testing. This window refers to a specific timeframe in which the body either does not produce antibodies or produces them in such low concentrations that they may not be detected. In this study, three cases of MP IgM positive and one case of CP IgM positive were identified, however, all four samples showed negative results by multiplex PCR-dipstick chromatography assay. To further investigate this discrepancy, DNA sequencing was performed on the four samples. Only one sample that had tested positive for MP IgM yielded a positive result through DNA sequencing. This finding suggested that the inconsistency observed in this case might be attributed to the low concentration of the bacterium in the nasopharyngeal swab samples, which was below the detection limit of the multiplex PCR-dipstick chromatography assay. On the other hand, the remaining two cases of MP IgM positive and one case of CP IgM positive, which had shown negative results by multiplex PCR-dipstick chromatography, were further confirmed as negative through DNA sequencing. Their inconsistency results between multiplex PCR-dipstick chromatography assay and serum IgM antibody was believed as improper sampling technique leading to false-negative results of PCR-dipstick chromatography assay. The multiplex PCR-dipstick chromatography assay and DNA sequencing showed a high statistical consistency between MP and CP (MP: kappa value = 0.979; CP: kappa value = 0.974). The results indicated that the multiplex PCR-dipstick chromatography assay is an effective and valuable diagnostic tool for clinical detection of M. pneumoniae and C. pneumoniae in the early stages of infection.
Remaining DNA can last for 8 months or even longer after M. pneumoniae and C. pneumoniae infection. Thus, the obvious limitation of the multiplex PCR-dipstick chromatography assay is that it can only be used for early infection diagnosis but not suitable for determining the clearance rate of pathogens after medication. A positive result cannot distinguish between carriers and recent or past infection status. Second, macrolide-resistant strains of M. pneumoniae and C. pneumoniae have emerged in the past few years, with a high incidence rate in China and Japan, which may lead to treatment failure. Therefore, the detection of resistance to macrolide drugs is also crucial, but this assay cannot determine drug resistance.
With the development of the signal processing, probe, and multiplex PCR technology of the strip biosensor, resistance genes to macrolide antibiotics should be incorporated in a PCR-dipstick chromatography assay.
5. Conclusion
This study successfully established a multiplex PCR-dipstick chromatography assay for the joint detection of M. pneumoniae and C. pneumoniae. It is fast, sensitive, and specific and is expected to become a new technical means for clinical diagnosis and rapid screening, which is suitable for small laboratories and point-of-care diagnosis.
Disclosure
Liuyang Hu and Xiuri Wang are the co-first authors.
Authors’ Contributions
Liuyang Hu and Xiuri Wang contributed equally to this work.
[1] A. Bjarnason, J. Westin, M. Lindh, L. M. Andersson, K. G. Kristinsson, A. Löve, O. Baldursson, M. Gottfredsson, "Incidence, etiology, and outcomes of community-acquired pneumonia: a population-based study," Open Forum Infectious Diseases, vol. 5 no. 2,DOI: 10.1093/ofid/ofy010, 2018.
[2] J. Richter, C. Panayiotou, C. Tryfonos, D. Koptides, M. Koliou, N. Kalogirou, E. Georgiou, C. Christodoulou, "Aetiology of acute respiratory tract infections in hospitalised children in Cyprus," PLoS One, vol. 11 no. 1,DOI: 10.1371/journal.pone.0147041, 2016.
[3] Z. Chen, W. Ji, Y. Wang, Y. Yan, H. Zhu, X. Shao, J. Xu, "Epidemiology and associations with climatic conditions of Mycoplasma pneumoniae and Chlamydophila pneumoniae infections among Chinese children hospitalized with acute respiratory infections," The Italian journal of pediatrics, vol. 39 no. 1,DOI: 10.1186/1824-7288-39-34, 2013.
[4] A. Defilippi, M. Silvestri, A. Tacchella, R. Giacchino, G. Melioli, E. Di Marco, C. Cirillo, P. Di Pietro, G. A. Rossi, "Epidemiology and clinical features of Mycoplasma pneumoniae infection in children," Respiratory Medicine, vol. 102 no. 12, pp. 1762-1768, DOI: 10.1016/j.rmed.2008.06.022, 2008.
[5] K. Hamano-Hasegawa, M. Morozumi, E. Nakayama, N. Chiba, S. Y. Murayama, K. Sunakawa, K. Ubukata, R. Takayanagi, S. Iwata, "Comprehensive detection of causative pathogens using real-time PCR to diagnose pediatric community-acquired pneumonia," Journal of Infection and Chemotherapy, vol. 14 no. 6, pp. 424-432, DOI: 10.1007/s10156-008-0648-6, 2008.
[6] D. X. Guo, W. J. Hu, R. Wei, H. Wang, B. P. Xu, W. Zhou, S. J. Ma, H. Huang, X. G. Qin, Y. Jiang, X. P. Dong, "Epidemiology and mechanism of drug resistance of Mycoplasma pneumoniae in Beijing, China: a multicenter study," Bosnian Journal of Basic Medical Sciences, vol. 19 no. 3, pp. 288-296, DOI: 10.17305/bjbms.2019.4053, 2019.
[7] C. Y. Kuo, W. C. Tsai, H. F. Lee, T. S. Ho, L. M. Huang, C. F. Shen, C. C. Liu, T. P. I. D. Alliance, "The epidemiology, clinical characteristics, and macrolide susceptibility of Mycoplasma pneumoniae pneumonia in children in Southern Taiwan, 2019-2020," Journal of Microbiology, Immunology, and Infection, vol. 55 no. 4, pp. 611-619, DOI: 10.1016/j.jmii.2021.09.010, 2022.
[8] F. Zhao, J. Li, J. Liu, X. Guan, J. Gong, L. Liu, L. He, F. Meng, J. Zhang, "Antimicrobial susceptibility and molecular characteristics of Mycoplasma pneumoniae isolates across different regions of China," Antimicrobial Resistance and Infection Control, vol. 8 no. 1,DOI: 10.1186/s13756-019-0576-5, 2019.
[9] F. Zhao, J. Liu, D. Xiao, L. Liu, J. Gong, J. Xu, H. Li, S. Zhao, J. Zhang, "Pathogenic analysis of the bronchoalveolar lavage fluid samples with pediatric refractory mycoplasma pneumoniae pneumonia," Frontiers in Cellular and Infection Microbiology, vol. 10,DOI: 10.3389/fcimb.2020.553739, 2020.
[10] J. Qu, J. Zhang, Y. Chen, Y. Huang, Y. Xie, M. Zhou, Y. Li, D. Shi, J. Xu, Q. Wang, B. He, "Aetiology of severe community acquired pneumonia in adults identified by combined detection methods: a multi-centre prospective study in China," Emerging Microbes & Infections, vol. 11 no. 1, pp. 556-566, DOI: 10.1080/22221751.2022.2035194, 2022.
[11] K. B. Waites, D. F. Talkington, "Mycoplasma pneumoniae and its role as a human pathogen," Clinical Microbiology Reviews, vol. 17 no. 4, pp. 697-728, DOI: 10.1128/cmr.17.4.697-728.2004, 2004.
[12] D. F. Talkington, S. Shott, M. T. Fallon, S. B. Schwartz, W. L. Thacker, "Analysis of eight commercial enzyme immunoassay tests for detection of antibodies to Mycoplasma pneumoniae in human serum," Clinical and Vaccine Immunology, vol. 11 no. 5, pp. 862-867, DOI: 10.1128/cdli.11.5.862-867.2004, 2004.
[13] K. B. Waites, L. Xiao, Y. Liu, M. F. Balish, T. P. Atkinson, "Mycoplasma pneumoniae from the respiratory tract and beyond," Clinical Microbiology Reviews, vol. 30 no. 3, pp. 747-809, DOI: 10.1128/cmr.00114-16, 2017.
[14] S. Li, W. Jiang, J. Huang, Y. Liu, L. Ren, L. Zhuang, Q. Zheng, M. Wang, R. Yang, Y. Zeng, Y. Wang, "Highly sensitive and specific diagnosis of COVID-19 by reverse transcription multiple cross-displacement amplification-labelled nanoparticles biosensor," European Respiratory Journal, vol. 56 no. 6,DOI: 10.1183/13993003.02060-2020, 2020.
[15] Z. H. Cai, Y. Y. Dai, L. Y. Huang, W. S. Zhang, X. G. Guo, "Diagnosis of mycoplasma pneumoniae by loop-mediated isothermal amplification: systematic review and meta-analysis," BMC Infectious Diseases, vol. 19 no. 1,DOI: 10.1186/s12879-019-3799-4, 2019.
[16] F. Xiao, J. Zhou, C. Sun, X. Huang, B. Zheng, J. Fu, N. Jia, Z. Xu, X. Cui, Y. Wang, "Loop-mediated isothermal amplification coupled with nanoparticle-based biosensor: a rapid and sensitive method to detect mycoplasma pneumoniae," Frontiers in Cellular and Infection Microbiology, vol. 12,DOI: 10.3389/fcimb.2022.882855, 2022.
[17] T. Ohshiro, C. Miyagi, Y. Tamaki, T. Mizuno, T. Ezaki, "Development of a rapid diagnostic method for identification of Staphylococcus aureus and antimicrobial resistance in positive blood culture bottles using a PCR-DNA-chromatography method," Journal of Infection and Chemotherapy, vol. 22 no. 6, pp. 372-376, DOI: 10.1016/j.jiac.2016.02.013, 2016.
[18] K. Koiwai, T. Kodera, J. Thawonsuwan, S. Riani, M. Kawase, H. Kondo, I. Hirono, "Rapid diagnosis of three shrimp RNA viruses using RT-PCR-DNA chromatography," Journal of Fish Diseases, vol. 41 no. 8, pp. 1309-1312, DOI: 10.1111/jfd.12821, 2018.
[19] L. Luo, Q. Chen, S. Qin, Q. Luo, Z. Liu, Q. Li, S. Zheng, X. Huang, P. Ke, X. Yang, H. Xiao, "Design and evaluation of multiplex one-step reverse transcription PCR-dipstick chromatography method for the analysis of seven respiratory pathogens," Current Microbiology, vol. 78 no. 10, pp. 3656-3666, DOI: 10.1007/s00284-021-02621-7, 2021.
[20] R. K. Shanmugakani, Y. Fujiya, Y. Akeda, "Rapid multiplex detection of the resistance genes mecA, vanA and vanB from Gram-positive cocci-positive blood cultures using a PCR-dipstick technique," Journal of Medical Microbiology, vol. 69 no. 2, pp. 249-255, DOI: 10.1099/jmm.0.001159, 2020.
[21] L. Luo, Q. Chen, Q. Luo, S. Hamaguchi, S. Hamada, K. Tomono, "Establishment and performance evaluation of multiplex PCR-dipstick DNA chromatography assay for simultaneous diagnosis of four sexually transmitted pathogens," Journal of Microbiological Methods, vol. 186,DOI: 10.1016/j.mimet.2021.106250, 2021.
[22] W. Li, Y. Liu, Y. Zhao, R. Tao, Y. Li, S. Shang, "Rapid diagnosis of Mycoplasma pneumoniae in children with pneumonia by an immuno-chromatographic antigen assay," Scientific Reports, vol. 5 no. 1,DOI: 10.1038/srep15539, 2015.
[23] E. Di Marco, "Real-time PCR detection of Mycoplasma pneumoniae in the diagnosis of community-acquired pneumonia," Methods in Molecular Biology, vol. 1160, pp. 99-105, DOI: 10.1007/978-1-4939-0733-5_9, 2014.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Copyright © 2023 Liuyang Hu et al. This is an open access article distributed under the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License. https://creativecommons.org/licenses/by/4.0/
Abstract
Background and Objective. Mycoplasma pneumoniae (MP) and Chlamydia pneumoniae (CP) infections are becoming increasingly prominent in respiratory infections. This study established a rapid, simple, sensitive, accurate multiplex PCR-dipstick DNA chromatography assay for Mycoplasma pneumoniae and Chlamydia pneumoniae detection. Methods. Nasopharyngeal swab samples of 300 children with an acute respiratory tract infection were detected by a multiplex PCR-dipstick chromatography assay, and the results were compared with the DNA sequencing and serum IgM antibody assay. Results. A multiplex PCR-dipstick DNA assay can specifically detect Mycoplasma pneumoniae and Chlamydia pneumoniae and shows a good specificity, with a minimum detection limit of 10 CFU/mL, respectively. Using DNA sequencing results as the gold standard, the sensitivity, specificity, positive predictive value, and negative predictive value of the multiplex PCR-dipstick DNA chromatography assay for the diagnosis of Mycoplasma pneumoniae were 96.61%, 100%, 100%, and 99.18% respectively, and those of Chlamydia pneumoniae were 95.24%, 100%, 100%, and 99.64% respectively. There was no statistical significance MP and CP diagnosis by the multiplex PCR-dipstick DNA assay and DNA sequencing (MP:
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
; Wang, Xiuri 2 ; Cao, Donglin 3 ; Cheng, Qiuchen 2 ; Li, Qiong 4 1 Department of Laboratory Medicine, The People’s Hospital of Guangxi Zhuang Autonomous Region, Guangxi Academy of Medical Sciences, Nanning 530016, China
2 Department of Gastroenterology, The People’s Hospital of Guangxi Zhuang Autonomous Region, Guangxi Academy of Medical Sciences, Nanning 530016, China
3 Department of Laboratory Medicine, Guangdong Second Provincial General Hospital, Guangzhou 510317, China
4 Guangzhou Biotron Technology Co., Ltd., Guangzhou 510336, China





