Molecular characterization of IncFII plasmid carrying blaNDM-5 in a Salmonella enterica serovar Typhimurium ST34 clinical isolate in China

Abstract

ABSTRACT

The detection rate of carbapenem-resistant nontyphoidal Salmonella (NTS) is relatively low. However, carbapenem-sensitive and carbapenem-resistant Salmonella enterica serovar Typhimurium (S. enterica serovar Typhimurium) were isolated from a clinical outpatient within a span of 10 days, named 1104–65 and 1104–75. We aimed to reveal the mechanism of carbapenem resistance in S. enterica serovar Typhimurium isolates in this case. The resistance phenotype of S. enterica serovar Typhimurium was analyzed by the VITEK-2 Compact equipment and Kirby-Bauer disc diffusion method. Whole-genome sequencing was used to analyze the serotype, ST type, genetic relationship, resistance genes, plasmid replicon, the genetic environment of bla_NDM-5, and the characteristics of IncFII plasmid carrying bla_NDM-5 in S. enterica serovar Typhimurium. The transferability of the IncFII plasmid carrying bla_NDM-5 was verified by the conjugation assay and PCR. The serotypes of both NTS are S. enterica serovar Typhimurium, belonging to ST34. Single nucleotide polymorphisms analysis showed that they were the same clone. A conjugative IncFII plasmid pIncFII-NDM5 with transferability was detected in isolate 1104–75, which harboring the bla_NDM-5 gene was the primary mechanism responsible for mediating carbapenem resistance in S. enterica serovar Typhimurium. The genetic environment of bla_NDM-5 on pIncFII-NDM5 is “IS26-ΔIS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC -cutA-IS26”, which was confirmed as a novel structure not previously reported in the NCBI database. Although the mechanism is rarely reported in NTS, the prevalence of IncFII plasmid pIncFII-NDM5 will pose a great threat to the clinical treatment of S. enterica serovar Typhimurium. Meanwhile, the coexistence of bla_CTX-M-55, qnrS1, bla_NDM-5, and mph(A) in S. enterica serovar Typhimurium ST34 warrants additional attention.

IMPORTANCE

In this study, an IncFII plasmid pIncFII-NDM5 carrying bla_NDM-5 was found in carbapenem-resistant Salmonella enterica serovar Typhimurium (S. enterica serovar Typhimurium), which has conjugative transferability and carried bla_NDM-5, ble_MBL, mph(A), and bla_TEM-1 four resistance genes that can mediate resistance to multiple antibiotics including cephalosporins, beta-lactamase inhibitor combinations, carbapenems, and macrolides. Phylogenetic analysis showed that 1104–65 and 1104–75 were closely related to other S. enterica serovar Typhimurium in this area. The above-mentioned S. enterica serovar Typhimurium chromosome carries bla_CTX-M-55, qnrS1, and tet(A) genes, so the antibiotic resistance of isolates will be further enhanced after obtaining the pIncFII_NDM5-like plasmid. Meanwhile, we discovered a novel genetic structure of bla_NDM-5 mediated by the IS26 composite transposon, which will expand our understanding of the emergence and spread of carbapenem-resistance genes. Altogether, the presence of the IncFII plasmid pIncFII-NDM5 further underscores the need for vigilant surveillance and appropriate infection control measures to mitigate the impact of carbapenem-resistant S. enterica serovar Typhimurium in clinical settings.

INTRODUCTION

Nontyphoidal Salmonella (NTS) is a prevalent bacterial cause of gastrointestinal diseases worldwide, with over 2,600 serotypes. Salmonella Typhimurium (Salmonella enterica serovar Typhimurium) is one of the most common serotypes, infecting both humans and animals (1, 2). NTS infection is a self-limiting disease, but in immunocompromised persons, such as children and the elderly, it can progress to severe systemic disease and antibiotic therapy is also necessary (3, 4). During recent decades, as the primary antibiotic therapy choices for NTS, fluoroquinolones, and extended-spectrum cephalosporins (ESCs) were used in anti-infective therapy more frequently, which has led to an increasing resistance rate in NTS (5–7). Carbapenem antibiotics are β-lactam antibiotics with broad activity, which are specially used for the treatment of severe bacterial infections (8, 9). Therefore, carbapenem antibiotics may be the last resort for patients with aggressive, multidrug-resistant NTS infections (10).

Although carbapenem-resistant NTS is still extremely rare, it will pose a serious threat to antimicrobial therapy once it occurs (11, 12). Several carbapenemases have been reported in NTS, including KPC, IMP, NDM, VIM, and OXA-48 (11, 13–15). Here, we report an NDM-5-producing carbapenem-resistant S. enterica serovar Typhimurium from an outpatient. With two amino acid changes (Val88Leu and Met154Leu), the NDM-5 variant of NDM-1 has a higher resistance to carbapenems and ESCs than NDM-1 (16). Since it was first discovered in Escherichia coli (E. coli) in 2011, NDM-5 carbapenemase has occasionally been discovered in other Enterobacteriaceae, such as Klebsiella pneumoniae (KP) and NTS (11). In this case, a carbapenem-resistant clinical S. enterica serovar Typhimurium was discovered in the Fifth Affiliated Hospital, Southern Medical University located in Conghua District, Guangzhou in November 2021. Therefore, this study aims to investigate the mechanism of carbapenem resistance in a clinical S. enterica serovar Typhimurium isolate.

RESULTS

Isolate identification and antimicrobial susceptibility testing results

Two NTS strains were successively isolated from the stool samples of the same outpatient. In November 2021, strain 1104–65 was isolated from the patient’s stool, followed by strain 1104–75 in another stool specimen 10 days later. Unfortunately, we did not collect further details about this outpatient treatment, so it is unclear what the patient’s treatment program was during 10 days. Both isolates were typed S. enterica serovar Typhimurium (O4: Hi). The antibiotic susceptibility results are shown in Table 1. Compared with 1104–65, isolate 1104–75 had increased minimum inhibitory concentration (MIC) to ceftazidime (CAZ), cefepime (FEP), and azithromycin (AZM), among which FEP became resistant (MIC ≥32 µg/mL), and was resistant to cefoxitin (FOX), amoxicillin-clavulanic acid (AMC), piperacillin-tazobactam (TZP), imipenem (IPM), and ertapenem (ETP). Both isolates were intermediary to levofloxacin (LVX) and ciprofloxacin (CIP). The resistance profiles of 1104–65 and 1104–75 to other antibiotics were broadly similar.

TABLE 1

The antibiotic susceptibility results of the isolates^a

Isolate	MIC (µg/mL)												Zone diameter (mm)
	CXM	CRO	CAZ	FEP	FOX	AMC	TZP	LVX	SXT	IPM	ETP	TGC	AMP	CIP	AZM	CHL
1104–65	≥64	≥64	32	8	≤4	4	≤4	1	≤1	≤0.25	≤0.12	1	6	27	11	26
1104–75	≥64	≥64	≥64	≥32	≥64	≥32	128	1	≤1	≥16	≥8	≤0.5	6	28	6	21
C600	16	≤0.25	0.5	≤0.12	8	4	≤4	0.5	≤1	≤0.25	≤0.12	≤0.5	14	29	25	24
C-1104–75	≥64	≥64	≥64	16	≥64	≥32	≥128	0.5	≤1	≥16	≥8	≤0.5	6	28	8	24

^a

CXM, cefuroxime; CRO, ceftriaxone; SXT, cotrimoxazole; TGC, tigecycline; AMP, ampicillin; CHL, chloramphenicol.

Plasmid and resistance gene analysis

The whole genome sequence revealed that compared with isolate 1104–65, isolate 1104–75 additionally harbored IncFII plasmid replicon and Col156_1. In addition, 1104–75 also possessed four resistant genes (bla_NDM-5, ble_MBL, mph(A), and bla_TEM-1, which, respectively, confer resistance to carbapenems, bleomycin, and macrolides), all of which were located on the IncFII plasmid (named pIncFII-NDM5). Both chromosomes carried tet(B), bla_CTX-M-55, and qnrS1 resistance genes.

Phylogenetic analysis

The bioinformatics analysis showed that the serotype 1104–65 and 1104–75 both were S. enterica serovar Typhimurium, belonging to ST34. The phylogenetic relationship of 1104–65, 1104–75, and other S. enterica serovar Typhimurium (n = 67) in this area from our previous study were assessed using S. enterica serovar Typhimurium ATCC14028 as a reference strain (see Fig. S1). Sixty-seven strains of other S. enterica serovar Typhimurium in this area were isolated from the stools of patients from May 2020 to February 2021 in the Fifth Affiliated Hospital, Southern Medical University (for details, see Table S1). Single nucleotide polymorphisms (SNPs) analysis showed that there were 17 SNPs between 1104-65 and 1104–75, indicating that they belonged to the same clone. Meanwhile, the SNPs between the two and other S. enterica serovar Typhimurium ST34 in this area ranged from 0 to 157, showing a close genetic relationship. It is worth noting that the resistance gene spectrum of 1104–65 is consistent with S24, S79, S36, S49, S34, S42, and S133. All of these strains carry bla_CTX-M-55, qnrS1, and tet(B). Moreover, our previous studies have shown that these three resistance genes were located on the chromosome of S. enterica serovar Typhimurium and can be transmitted vertically.

Characterization of plasmid pIncFII-NDM5

The transconjugant was successfully obtained through the conjugation experiment and named C-1104–75. PCR and sequencing results showed that the transconjugant carried IncFII plasmid replicon and bla_NDM-5 gene, which indicates that the plasmid pIncFII-NDM5 carrying the bla_NDM-5 gene is a conjugative plasmid with transferability. The drug susceptibility results of C-1104–75 are shown in Table 1. Compared with the recipient strain E. coli C600, pIncFII-NDM5 confers the transconjugant with resistance to ESCs, FOX, AMP, AMC, TZP, IPM, ETP, and AZM.

The plasmid pIncFII-NDM5 has a total length of 77,785 bp. Download the sequence of IncFII plasmids (with or without bla_NDM-5) similar to pIncFII-NDM5 in other studies through NCBI: (I) Plasmid pST41-NDM (no. CP016389) was isolated from S. enterica serovar Typhimurium detected in stool samples of children with acute diarrhea in Guangzhou, China. The full length is 84,565 bp, carrying four resistance genes bla_NDM-5, ble_MBL, mph(A), and bla_TEM-1. (II) Plasmid p47733_NDM_5 (no.CP050367) was isolated from KP and detected in rectal swab of patients in a hospital in Prague, Czech Republic. The full length is 103,085 bp, carrying nine resistance genes erm(B), mph(A), bla_TEM-1, rmt(B), bla_NDM-5, ble_MBL, sul1, aadA2 (2 copy number), and dfrA12. (III) Plasmid pKP1814-3 (no. KX839209) was isolated from KP detected in a hospital in Hangzhou, China. The full length is 95,701 bp, carrying five resistance genes dfrA17, aadA2, sul1, erm(B), and mph(A). (IV) Plasmid pRCS61 (no. LT985267) was isolated from E. coli in Evry, France. The full length is 87,290 bp, carrying four resistance genes bla_CTX-M-15, bla_TEM, erm(B) (2 copy number), and aacC2. (V) Plasmid pWP7-S17-ESBL-01_2 (no. AP022175) was isolated from E. coli detected in waste water treatment plant effluent in Tokyo, Japan. The full length is 63,140 bp, with no resistance genes present. Through the comparison of pIncFII-NDM5 and the above IncFII plasmid sequence (Fig. 1), it was found that the backbone structure of IncFII plasmids was almost identical, mainly including related genes encoding proteins involved in replication, maintenance and conjugative transfer. However, most of the mobile genetic elements and resistance genes were located in the variable region of IncFII plasmids. It can be seen from Fig. 1 that the two IncFII plasmids carrying bla_NDM-5 from S. enterica serovar Typhimurium are highly similar in variable regions, but the mobile genetic elements of pST41-NDM are more abundant than pIncFII-NDM5. Notably, the IS3000 upstream of bla_NDM-5 of pIncFII-NDM5 was incomplete (469/3235), and one end of the ISAba125 sequence truncated by IS5 was also missing. It indicates that the IncFII plasmid carrying bla_NDM-5 is still evolving in S. enterica serovar Typhimurium. Simultaneously, the gene encoding the conjugative transfer-associated protein of IncFII plasmid confers it with conjugative transferability, which will pose a significant clinical risk. In addition, IS26 appears to play an important role in the acquiring of resistant gene segments in the variable region.

Fig 1

Linear comparison of plasmid pIncFII-NDM5 with other similar IncFII plasmids (with or without bla_NDM-5). Gray shading indicates regions of shared homology among different elements. Open reading frames are marked by colored arrows, orange indicates genes encoding plasmid replicon, blue indicates genes encoding plasmid stabilizing proteins, green indicates mobile genetic elements, red indicates resistance genes, purple indicates genes encoding conjugal transfer proteins, and gray indicates other genes.

Comparative analysis of the genetic environment of bla_NDM-5

The genetic environment of bla_NDM-5on pIncFII-NDM5 was intercepted for correlation analysis, about 9256 bp, compared with the BLAST database (http://www.ncbi.nlm.nhi.gov/blast/) and downloaded the plasmid sequence (GenBank accession number MH286949) of the most similar fragment. Meanwhile, literatures of S. enterica serovar Typhimurium carrying bla_NDM-5 were searched through the PubMed database (https://www.ncbi.nlm.nih.gov/pubmed/), and the plasmid sequences carrying bla_NDM-5 were downloaded to compare and analyze the genetic environment of bla_NDM-5 (see Fig. 2). The relevant information of the above plasmids is shown in Table 2. Three different genetic environments were found surrounding bla_NDM-5.

Fig 2

The genetic environments of bla_NDM-5. Different colored arrows represent various open reading frames (ORFs), and the arrow’s direction indicates the direction of transcription. Homogeneous regions are represented by light gray shadows.

TABLE 2

Information about plasmid carrying bla_NDM-5 in Fig. 2

Name	Isolate	Inca	Origin	Country	Year of isolation	Reference	Types of blaNDM-5 genetic structurec
pNDM5-SSH006	S. enterica serovar Typhimurium	IncX	Patient feces	Shanghai, China	2015	(17)	Ⅰ
pNDM5_SH160	S. enterica serovar Typhimurium	IncX	Retail pork	Shanghai, China	2016	(18)	Ⅰ
pST41-NDM	S. enterica serovar Typhimurium	IncFII	Patient feces	Guangzhou, China	2017	(13)	Ⅰ
pHNAH687	E. coli	Inc X	Chicken feces	Anhui, China	2018	BLASTb	Ⅱ
pYZPW131	S. enterica serovar Typhimurium	IncX	Retail pork	Jiangsu, China	2019	(14)	Ⅰ
pIncFII-NDM5	S. enterica serovar Typhimurium	IncFII	Patient feces	Guangzhou, China	2021	This study	Ⅲ

^a

Inc, incompatibility group.

^b

BLAST, the plasmid carrying the region most similar to the bla_NDM-5 gene environment on pIncFII-NDM5 by BLAST search on the NCBI database.

^c

Type Ⅰ was “IS3000-ISAba125Δ-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”, type Ⅱ was “IS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF -dsbC-cutA-IS26”, and type Ⅲ was “IS26-ΔIS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”.

Type I “IS3000-ISAba125Δ-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA- IS26” was the most common type of structure, discovered in the IncFII plasmid pST41-NDM and three IncX3 plasmids isolated from S. enterica serovar Typhimurium. The genetic structure of bla_NDM-5 on the IncFII plasmid pIncFII-NDM5 isolated in this study was type III “IS26-ΔIS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”, while the most similar structure on the IncX3 plasmid pHNAH687 isolated from E. coli was type II “IS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”. The differences between the three types were IS3000 (complete/incomplete), IS26 (presence/absence), and one end of ISAba125 truncated by IS5 (presence/absence). Beyond comprehensive analysis, we speculate that type I evolved into type II after the loss of ISAba125Δ (1–1018/1087). After a new IS26 was inserted and truncated into IS3000 of type II, it formed a composite transposon with IS26 downstream of bla_NDM-5 to mediate the transfer of bla_NDM-5, and type II evolved into type III. To our knowledge, the IS26 composite transposon has never been described to mediate bla_NDM-5 transfer in previous studies.

DISCUSSION

NTS is a major cause of foodborne illness in animals and humans worldwide. With the emergence and rapid development of NTS-resistance phenotype ACSSuT (defined as resistance to AMP, CHL, streptomycin, sulfamethoxazole, and tetracycline), fluoroquinolones (FQs) and ESCs are commonly used as a first-line agent for the treatment of NTS infections (17–21). However, with widespread use, the detection rate of NTS resistant to ESCs and QRs has been increasing in recent years (1, 22–25). Therefore, carbapenems may be the last resort for patients with invasive, multidrug-resistant (MDR, resistance to three or more classes of antimicrobials) NTS infection (26).

Resistance to carbapenems in Enterobacteriaceae occurs involves multiple mechanisms, such as production of carbapenemases, production of extended-spectrum β-lactamases (ESBLs) or AmpC enzymes combined with the loss of specific outer membrane porins, increased efflux pump activity (12, 27, 28). The drug resistance mechanisms mentioned above are commonly observed in E. coli and KP but are rarely reported in NTS (11, 29, 30). The first carbapenemase gene isolated in NTS was bla_KPC-2, which was found in S. enterica serovar Cubana isolated from the stool of a 4-year-old boy with diarrhea in the United States in 1998 (31). Subsequently, carbapenemase genes bla_IMP-4, bla_NDM-1, bla_NDM-5, bla_VIM-2, and bla_OXA-48 were successively reported in NTS (11). Carbapenem-resistant NTS has become a serious clinical problem due to limited treatment options. In this study, the mechanism that mediates the resistance of S. enterica serovar Typhimurium clinical isolate 1104–75 to carbapenems is the production of NDM-5 carbapenemase.

NDM-5 carbapenemase is currently primarily detected in E. coli and is still uncommon in other Enterobacteriaceae such as NTS and KP (32). The most prevalent plasmid type in Enterobacteriaceae to contain bla_NDM-5 is IncX3 (33, 34). Compared with 1104–65, the MIC of 1104–75 carrying bla_NDM-5 to ESCs, β-lactam/β-lactamase inhibitor, and carbapenems increased significantly, which was consistent with previous research results (13, 16, 35). The bla_NDM-5 in this study is located on the IncFII plasmid pIncFII-NDM5 of S. enterica serovar Typhimurium clinical isolate 1104–75. By searching the PubMed database, it is found that bla_NDM-5 is also mainly located on the IncX3 plasmid in Salmonella (14, 36–39). Only one article (13) reported that bla_NDM-5 was localized on the IncFII plasmid pST41-NDM in S. enterica serovar Typhimurium isolated from a stool of a child with acute diarrhea in Guangzhou, China. The IncFII plasmid has a narrow host range was commonly found in E. coli, and has been involved in the global spread of the bla_CTX-M-15 gene in the E. coli clone ST131 (40). Notably, pIncFII-NDM5 carrying the bla_NDM-5 gene is a transferable conjugative plasmid that confers high levels of resistance to ESCs and carbapenems in clinical S. enterica serovar Typhimurium isolate 1104–75. Through the comparison of plasmid sequences, it was found that the backbone of pIncFII-NDM5 was very similar to other IncFII plasmids, with most genes encoding conjugative transfer proteins, which may be the main reason for the conjugative transferability of pIncFII-NDM5 (41). The IncFII plasmid pIncFII-NDM5 and pST41-NDM also carry the mph(A) gene, which confers AZM resistance. AZM is FDA-approved for the treatment of systemic Salmonella infections, particularly those caused by S. enterica serovar Typhimurium, due to increased rates of resistance to ESCs and FQs (42). Meanwhile, AZM is widely used in the treatment of various infections in children due to it is well tolerated in the presence of multiple co-morbidities and medications (43, 44). Additionally, it is worth noting that the genetic structure “IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA -IS26 -mph(A)-mrx-mph(R)-IS6100” located on the pIncFII-NDM5 and pST41-NDM plasmids are completely identical, about 9096 bp. Through the BLAST tool, it was found that this framework also exists on the IncFII plasmid pGZ_NDM5 (no. CP017981) in E. coli. Although the bla_NDM-5 and mph(A) gene combinations have been reported in previous literature, it has not been noticed both are located on the same genetic framework (45, 46). This suggests that clinicians should be alert to the phenomenon of co-transfer of bla_NDM-5 and mph(A).

S. enterica serovar Typhimurium has a broad host range and is one of the major NTS serotypes responsible for outbreaks of infectious diarrhea and foodborne disease worldwide (47). ST34 is the most common ST type of S. enterica serovar Typhimurium and is often associated with ACSSuT resistance patterns (48). In this study, 1104–75 and 1104–65 have a relatively close genetic relationship with other S. enterica serovar Typhimurium ST34 isolates in this area (see Fig. S1). This means that pIncFII-NDM5 will be extremely dangerous if it becomes widespread among S. enterica serovar Typhimurium ST34 in this area. In our previous studies, it has been reported that there may be a potential epidemic clone of S. enterica serovar Typhimurium ST34 in this region with bla_CTX-M-55 and qnrS1 localized on the chromosome (49). The qnrS1 gene can mediate low-level resistance to FQ, and its presence can provide a selective advantage for strains exposed to FQs, thereby accelerating the development of chromosome-mediated FQs resistance in strains (50). More importantly, this study reported the emergence of NTS carrying four resistance genes (bla_CTX-M-55, qnrS1, bla_NDM-5, and mph(A)). Thus, the phenomenon of 1104–65-like clone S. enterica serovar Typhimurium ST34 carrying pIncFII_NDM5-like plasmid warrants additional attention because it may accelerate the development and spread of NTS coresistant to ESCs, FQs, carbapenems, and macrolide antibiotics.

The most typical bla_NDM-5 genetic structure, Type I “IS3000-ISAba125Δ-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”, is frequently observed in IncX3 plasmids (51, 52). Of note, the genetic environment (type I) of bla_NDM-5 on the IncFII plasmid pST41-NDM was the same as the genetic environment of bla_NDM-5 on the IncX3 plasmid carried by other Enterobacteriaceae (E. coli, KP, and Enterobacter cloacae) from the same hospital. It suggested that the genetic environment of bla_NDM-5 in the variable region of pST41-NDM may be derived from the IncX3 plasmid (13). The genetic structure of bla_NDM-5 on the IncFII plasmid pIncFII-NDM5 isolated in this study was type III “IS26-ΔIS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26”. Compared with another IncFII plasmid pST41-NDM, pIncFII-NDM5 has a new IS26 inserted and truncated IS3000 (2754–3222/3235), and one end of ISAba125 (1–1018/1087) was missing in the genetic structure. From type I to type III, we speculate that there are two main steps. Meanwhile, it was brought to our attention that IS3000on pST41-NDM, pNDM5_SH160, pNDM5-SSH006, and pYZPW131 was complete, whereas IS3000on pHNAH687 was incomplete (1–3222/3235), which provides stronger evidence for our conjecture. Mediated by mobile elements, the genetic environment of bla_NDM-5 is constantly changing during the transfer process. Currently, the genetic structure of bla_NDM-5 shares two common features (33, 39): (I) the insertion sequence ISAba125 (complete or truncated) is present upstream of bla_NDM-5. (II) The downstream of bla_NDM-5 includes the ble_MBL gene that mediates bleomycin resistance, followed by trpF (encoding phosphoribosyl anthranilate isomerase), dsbC (also known as tat, encoding a twin-arginine translocation pathway signal sequence domain protein), and cutA (also known as dct, encoding a periplasmic divalent cation tolerance protein). According to reports, trpF and dsbC play key roles in the stability, retention, or spread of bla_NDM-5, or promotion of enzyme function (53). Currently, insertion sequences found in the genetic environment of bla_NDM-5 include ISAba125 (complete or truncated), IS91, IS26, IS5, IS3000 (complete or truncated), and ISCR1 (54–60). IS26, a member of the IS6 insertion sequence family, promotes the spread of antibiotic-resistance genes in Gram-negative bacteria mainly through the formation of composite transposons (61). Two IS26s in the same or opposite direction often form a composite transposon to mediate the transfer of resistance genes between them (62). For example, the IS26 composite transposon in this study is involved in the mobilization of bla_NDM-5. Its flanking elements are frequently deleted when IS26 is inserted (63). This may be the reason why IS3000 (2754–3222/3235) was truncated in Type III. A higher copy number of IS26 was found in the variable region of IncFII plasmids in Fig. 1, which may be involved in the recombination of plasmids MDR region, thereby endowing isolates with resistance to multiple antibacterial drugs, ultimately limiting clinical treatment options. All in all, various evidences indicated that the genetic environment of bla_NDM-5 composed of the IS26 composite transposon is identified clinically for the first time in this study.

Conclusion

In this study, an IncFII plasmid pIncFII-NDM5 carrying bla_NDM-5 was isolated from S. enterica serovar Typhimurium detected from a stool sample of an outpatient in Conghua District, Guangzhou, which mediated resistance to carbapenems in S. enterica serovar Typhimurium. The genetic environment of bla_NDM-5 “IS26-ΔIS3000-IS5-ΔISAba125-bla_NDM-5-ble_MBL-trpF-dsbC-cutA-IS26” was different from the previous typical structure, and IS26 at both ends constitutes a composite transposon to mediate the gene transfer, which is also the first report of this type of genetic environment in bla_NDM-5. Currently, reports of IncFII plasmids carrying bla_NDM-5 in NTS are still rare. Our results suggest that the IncFII plasmid carrying bla_NDM-5 may still be evolving and this type of plasmid can mediate high levels of resistance to ESCs and carbapenem. Meanwhile, bla_CTX-M-55, qnrS1, bla_NDM-5, and mph(A) cotransfer warrants additional attention because it may accelerate the development and spread of NTS coresistant to ESCs, FQs, carbapenems, and macrolide antibiotics.

MATERIALS AND METHODS

Bacterial collection, culture, and identification

The carbapenem-sensitive isolate 1104–65 and carbapenem-resistant isolate 1104–75 used in this study were collected from the stool of the same outpatient in Fifth Affiliated Hospital, Southern Medical University in Conghua District, Guangzhou. Strain 1104–65 was isolated from the patient’s stool in November 2021, and 1104–75 was isolated from another stool specimen 10 days later. Extract a sufficient amount of stool sample and use an inoculation loop to inoculate it onto blood agar plates, SS medium, and MacConkey agar plates. The typical colony morphology of Salmonella on SS medium is colorless, transparent, and black in the center. After incubation at 37°C for 16–18 hours, a single colony was selected and drawn on a blood agar plate to obtain pure isolates for identification and antimicrobial susceptibility tests. Isolates were analyzed and identified by the VITEK-2 COMPACT automatic microbial identification system (bioMérieux, Marcy-l'Étoile, France). Salmonella serotyping was conducted by using the slide agglutination test with specific antisera (Tianrun, Ningbo, China) according to the manufacturer’s instructions.

Antimicrobial susceptibility testing

The MIC values for CTX, CRO, CAZ, FEP, FOX, AMC, TZP, LVX, SXT, IPM, ETP, and TGC were performed using the VITEK-2 Compact equipment. The diameter of the inhibition zone (mm) of the NTS isolates against AMP, CIP, AZM, and CHL was determined by the Kirby-Bauer disc diffusion method on Muller–Hinton (MH) agar plates. All of the procedures and results interpretation were followed by the Clinical and Laboratory Standards Institute (CLSI M100, 33th edition) guidelines.

Whole-genome sequencing (WGS) and bioinformatics analysis

Sample preparation steps and genome sequencing

Isolates 1104–65 and 1104–75 were inoculated in Luria-Bertani broth and cultured at 37°C in a 200-rpm shaker until it reached a logarithmic phase. The broth was centrifuged at 10,000 rpm for 10 min at 4°C. After centrifugation, the supernatant was removed and rinsed 3–5 times with sterile water until the supernatant were clear. Samples were placed on dry ice for transportation immediately after sampling. All library preparation and sequencing were performed by the Novogene Bioinformatics Technology (Tianjin, China).

Analysis of whole genome sequencing data

Sequence reads were assembled using Unicycler 0.4.8 (64) and annotated using Prokka 1.14.5 (65). The predicted serotype and multi-locus sequence typing (MLST) types were identified using the Salmonella in Silico Typing Resource (SISTR 1.1.1) (66), and MLST 2.18.0 (67). The antibiotic-resistance genes and plasmid replicons were predicted using ResFinder 4.1 (68) and PlasmidFinder 2.1 (69), respectively, the default parameters were applied with minimum thresholds of sequence identity (>90%) and sequence coverage (>60%). Transposon and insertion sequence (IS) elements were scanned using the ISfinder database (70). Phylogenetic analysis was performed using Parsnp (71), the phylogenetic tree was visualized using Evolview online (72), and the SNPs among the core genomes of NTS were determined by using MEGA X (73). Close relatedness of isolates was defined as  <21 allele differences in cgMLST (74). The genetic environment was visualized by the EasyFig software (75) and Adobe Illustrator (AI).

Conjugation experiments

Rifampicin-resistant E. coli C600 was used as the recipient strain and imipenem-resistant isolate 1104–75 was used as donor strain to determine the transferability of carbapenem-resistance phenotype. Transconjugant was selected on Luria–Bertani plates containing 100 µg/mL rifampicin plus 2 µg/mL imipenem, and the resistance phenotype was investigated by AST. PCR and sequencing were used to confirm whether the transconjugant carried the carbapenem resistance gene (NDM-F: ATGGAATTGCCCAATATTATGCAC, NDM-R: TCAGCGCAGCTTGTCGGC) and the related plasmid replicon (FII-F: CTGATCGTTTAAGGAATTTT, FII-R: CACACCATCCTGCACTTA).