Citation:Martin M, López-Madrigal S, Newton ILG (2024) The Wolbachia WalE1 effector alters Drosophila endocytosis. PLoS Pathog 20(3): e1011245. https://doi.org/10.1371/journal.ppat.1011245
Editor:Matthew C. Wolfgang, UNC-Chapel Hill: The University of North Carolina at Chapel Hill, UNITED STATES
Received:February 25, 2023; Accepted:March 18, 2024; Published: March 28, 2024
Copyright: © 2024 Martin et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Data Availability:All data are included in supplementary tables within the publication.
Funding:This work was supported by a National Institutes of Health, National Institutes of Allergy and Infectious Diseases (NIAID) grant R01AI144430 to ILGN. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing interests: The authors have declared that no competing interests exist.
Introduction
Wolbachia pipientis is an obligate intracellular microbe and arguably the most successful infection on our planet, colonizing 40–60% of insect species, as well as other arthropods and nematodes [1,2]. Wolbachia are alpha-proteobacteria, part of the anciently intracellular Anaplasmataceae, and related to the important human pathogens Anaplasma, Rickettsia, and Ehrlichia [3]. However, Wolbachia do not infect mammals, but instead are well known for their reproductive manipulations of insect populations, inducing phenotypes such as male-killing, feminization, or sperm-egg incompatibility [4]. In the last decade, Wolbachia have also been shown to provide a benefit to insects, where the infection can inhibit RNA virus replication within the host [5], a phenomenon known as pathogen blocking. Because insects are vectors for disease, and Wolbachia alter the ability of these vectors to harbor important human pathogens, Wolbachia are being used to control the spread of diseases such as Dengue.
Like all intracellular bacteria, Wolbachia need to manipulate the host cell to invade and persist. Many microbes accomplish this via secretion systems, nanomachines that enable the microbes to directly transfer proteins from the bacterium into the cytosol of host cells. Based on analyses of the genomes of all sequenced strains, Wolbachia symbionts encode a functional type IV secretion system (T4SS) [6–8], which is expressed by Wolbachia within its native host [7,9]. However, only a few proteins secreted by Wolbachia have been identified and characterized. These proteins, referred to as effectors, often act to manipulate or usurp host cell processes to promote bacterial infection [10,11]. These modes include (but are not limited to) attacking the host cell surface to form pores, inactivating host cytosol machinery to collapse the cytoskeleton, or entering the nucleus to manipulate host gene regulation [12]. At each stage of attack, the bacterial effectors often interact directly and specifically with host proteins to perturb a biological process that enables pathogen entry into or defense from the host cell [13–19]. Understanding how bacterial effectors function, therefore, has taught scientists not only how pathogens cause disease, but also how fundamental cell biological mechanisms work in healthy tissue [20]. While effectors are bacterial in origin, they act within eukaryotic cells and hence often encode domains that share structural, functional, and sequence similarity with eukaryotic proteins [10,11,21,22].
The first characterized Wolbachia effector, WalE1, is an actin-bundling protein that increases Wolbachia abundance in the next generation when over-expressed in transgenic flies [8]. The WalE1 protein contains an N-terminal alpha-synuclein domain [8] which may mediate some interactions with host proteins and pathways. WalE1 is upregulated by Wolbachia during host pupation and purified WalE1 protein co-sediments with filamentous actin and increases actin bundling in vitro and in vivo. As the actin cytoskeleton is important for Wolbachia’s maternal transmission [23], and for its internalization by host cells [24], the WalE1 effector likely plays an important role in Wolbachia’s biology.
In this study, we sought to characterize the patterns of expression of native WalE1, its host targets (beyond actin) and identify specific host pathways influenced by the effector. We used an antibody made to the full-length protein to visualize the effector during Wolbachia infection of Drosophila melanogaster cells and ovaries. The native protein appears as large aggregates in cultured host cells and early egg chambers. We used co-immunoprecipitation and mass spectrometry to determine host proteins with which WalE1 interacts and identify Past1 as a target of WalE1. Past1 was previously shown to influence endocytosis [25]; Garland cells from homozygous Past1 mutant larvae were defective in their ability to endocytose fluorescently-labeled avidin. We therefore characterized endocytosis defects upon both WalE1 expression in yeast and flies and Past1 abrogation in flies. Finally, we show an interaction between Wolbachia colonization and Past1 dosage in whole animals, where Wolbachia abundance increases in Past1 mutant flies, suggesting that Wolbachia targets the protein to alter its function. Our results shed light on the molecular mechanisms used by a ubiquitous symbiont to alter host biology.
Results
Native WalE1 localizes to aggregates in the host cell cytosol
We had previously shown phenotypes for overexpression of RFP-tagged WalE1 in whole flies [8]. However, this experiment could have been affected by the use of tags and non-native expression; tags can alter protein localization and we were necessarily studying an artificial system and not native expression and secretion of the effector by Wolbachia. We therefore generated an antibody to full-length WalE1 and used it to probe cells and flies infected with Wolbachia (S1 Fig). The α-WalE1 antibody does not stain Drosophila JW18 cells cleared of their Wolbachia infection with tetracycline. However, in JW18 cells infected with strain wMel, the fly’s native Wolbachia strain, WalE1 is found as large aggregates in the cells and these aggregates do not seem to co-localize with Wolbachia (stained with DAPI, Fig 1). In ovaries, we observe similar aggregates of WalE1 in Wolbachia-infected flies only. These aggregates appear most numerous in early stages of oogenesis (in the germarium and stages 2–4), when Wolbachia is most numerous [23], and seem to disappear in later egg chambers (Fig 2).
[Figure omitted. See PDF.]
Fig 1. WalE1 native expression in Wolbachia-infected JW18 cells.
Antibody made against full-length WalE1 was used to probe Wolbachia-infected (JW18) and uninfected (JW18-tet) cells. Native WalE1 expression is only seen in JW18 cells, where the protein localizes in large aggregates, that seem to be larger than Wolbachia cells (stained with DAPI). Arrowheads point to WalE1 aggregates in overlay.
https://doi.org/10.1371/journal.ppat.1011245.g001
[Figure omitted. See PDF.]
Fig 2. WalE1 native expression in Wolbachia-infected fly ovarioles.
Antibody made against full-length WalE1 was used to probe Wolbachia-infected and uninfected ovaries. Native WalE1 expression is seen as puncta in Wolbachia-infected germaria through stage 9 egg chambers. Also shown are DNA (stained with DAPI) and actin (stained with fluorescent phalloidin).
https://doi.org/10.1371/journal.ppat.1011245.g002
WalE1 interacts with host Past1 and the endocytosis pathway
Because native WalE1 localized to aggregates in the cell, we sought to identify what host proteins may be localized to those aggregates, interacting with WalE1. Towards that end, we performed a co-immunoprecipitation experiment using α-WalE1 antibody. Infected and tetracycline-cleared Drosophila JW18 cells were lysed and each incubated with α-WalE1 antibody-coated magnetic beads. As controls we included beads alone. After washes on a magnetic column, bound proteins were eluted and subjected to mass spectrometry. We identified one protein, significantly enriched in our pull down, which came down in the JW18 lysate but was absent from the JW18-tet lysate: Putative Achaete Scute Target 1 (Past1) (Tables 1 and S1). We sought to confirm direct interaction between WalE1 and Past1 and used a yeast-2-hybrid approach. However, we could not recapitulate interaction between WalE1 and Past1 using this model, which may suggest that WalE1 does not directly interact with Past1 but instead, co-immunoprecipitated a complex, on which Past1 is found (S2 Fig). Alternatively, it may be that the lack of recapitulation in the yeast-2-hybrid is due to the assay itself, which requires fusion protein interactions in the context of the yeast cell nucleus. Int erestingly, WalE1 co-immunoprecipitated with several uncharacterized Wolbachia proteins and components of the type IV secretion machinery (the Vir proteins in S1 Table), suggesting it may interact with other secreted effectors and supporting its secretion via the T4SS.
[Figure omitted. See PDF.]
Table 1. Co-immunoprecipitation of WalE1 using α-WalE1 antibody pulls down host Past1 protein from wMel infected cell line JW18, but not from uninfected cells.
Shown are top six hits. For full mass spectrometry results see S1 Table.
https://doi.org/10.1371/journal.ppat.1011245.t001
Past1 is an EHD (Eps15 Homology Domain) ortholog in Drosophila and known to contribute to endocytosis [25]. Eps15 Homology Domain containing proteins in other models are involved in the recycling of proteins and lipids to the plasma membrane [26–30]. Indeed, Past1 has previously been shown to play a role in endocytosis; Garland cells from Past1110-1 homozygous null flies do not endocytose fluorescently-labeled avidin to the same extent as wildtype [25]. As WalE1 interacts with Past1, we therefore wondered if WalE1 expression might also impact endocytosis. We used FM4-64 labeling of yeast to measure extent of endocytosis in a pulse chase experiment. Yeast expressing WalE1 internalize less FM4-64 than control yeast carrying vector alone (Fig 3, χ2 = 24.706, df = 1, p = 6.676e-07). This result suggests that WalE1 expression may impact endocytosis, perhaps through direct or indirect interaction with Past1.
[Figure omitted. See PDF.]
Fig 3. Yeast expressing WalE1 internalize less FM464 dye than control yeast carrying vector alone.
Yeast carrying control vector or expressing walE1 were exposed to FM464 membrane dye for a pulse and internalization of dye was quantified after 60 minutes based on fluorescence intensity (N > 40 for each; χ2 = 24.706, df = 1, p = 6.676e-07).
https://doi.org/10.1371/journal.ppat.1011245.g003
We then moved to transgenic flies to confirm endocytosis defects induced by WalE1. The larval nephrocytes (garland cells) are a model system for understanding endocytosis in fruit flies. We measured uptake of fluorescently-labeled dextran over time in garland cells expressing WalE1 (using the Hand-GAL4driver, specific to garland cells and cardiac tissue) compared to genetic controls. Importantly, although the Garland cells were kept at 4°C during exposure to dextran, and unbound dextran was washed off before shifting samples to room temperature. At each time point, the samples were fixed and stained with a fluorescently-labelled antibody to horse radish peroxidase (HRP) that recognizes oligosaccharide epitopes on garland cell plasma membranes. before imaging. Wild-type garland cells endocytose some dextran while on ice, leading to significant differences even at the zero timepoint. Interestingly, although wild-type garland cells are quickly able to endocytose and clear the labeled dextran, garland cells expressing WalE1 do not (Fig 4; Glm, poisson model, χ2 = 839123511, df = 1, p < 0.001). Likewise, the anti-HRP fluorescence confirms that the oligosaccharide epitopes remain on the garland cell plasma membrane surface with WalE1 overexpression. These results suggest that WalE1 expression abrogates endocytosis in garland cells. We next moved our analyses to functionally characterize Drosophila Past1.
[Figure omitted. See PDF.]
Fig 4. Expression of WalE1 in Drosophila garland cells limits endocytosis.
Red-eyed flies carrying a UAS-WalE1 construct and the Hand-GAL4 driver or genetic controls from a parallel cross were dissected and garland cells were exposed to fluorescently-labeled dextran on ice before a shift to room temperature. Uptake of dextran was imaged (shown in green) and quantified (boxplot panel) across the time course [0 (on ice), 15, and 30 minutes (warming to room temperature)]. Anti-HRP staining (shown below the dextran channel) was used to identify garland cell plasma membranes and to corroborate update of dextran [49,50,54,55]. We observed a significant effect of genotype (Glm, poisson model, χ2 = 839123511, df = 1, p < 0.001).
https://doi.org/10.1371/journal.ppat.1011245.g004
Past1 mutant flies do not suffer fertility or viability defects
Past1 mutants were previously characterized to suffer from fertility defects, exhibit sensitivity to temperature, and have a reduced lifespan [25]. In order to assess the reproducibility of these phenotypes in our hands, we acquired the two most commonly used alleles (Past160-4 and Past1110-1) and two new deficiency stocks that cover the region in question entirely (the one used in [25], Df(3R)Kar-Sz37), was not available to us). Both Past1 alleles were previously made by imprecise excision of a P-element insertion, which resulted in Past1 nulls as further confirmed by western blot experiments (S3 Fig) [25]. Our first western blot experiments confirmed that these mutants are indeed nulls for Past1 (S3 Fig). The larger deficiency (Df(3R)BSC486) led to greater levels of lethality, while the smaller one (Df(3R)Kar-Sz29) allowed for high levels of viability and displayed no oogenesis defects (Fig 5). These results suggest that something else in the background of the Past160-4 and Past1110-1 flies contributes to the viability and fertility defects previously observed. Importantly, prior work did not specify if the allele used (Past1110-1) was in a white- background. The P-element used (EY01852) carries mini-white+, and white mutants impair several biological functions–from mobility to lifespan to stress tolerance [31,32]. Therefore, it is entirely possible that the viability and fertility defects previously published were confounded by the background of these mutations when analyzed as homozygous chromosomes.
[Figure omitted. See PDF.]
Fig 5. Past1 null mutants are viable.
Male genotype for each cross is shown at top right, and females on the lefthand side. Total number of flies counted is noted in parentheses and viability is calculated as a percentage. Severely reduced viability is observed with the large deficiency Df(3R)BSC486, which covers adjacent genes, but other combinations of hemizygous past1 null alleles lead to full or higher percentages of viable offspring. Past1 nulls shown in light orange.
https://doi.org/10.1371/journal.ppat.1011245.g005
We sought to genetically isolate any effects that may be related to Past1 in our assays and therefore generated new CRISPR-Cas9 based mutants in Past1 (Past1M10 and Past1F15). These mutants generate an identical two nucleotide deletion that generates a frameshift and eventual stop codon after 83 amino acids; no protein form, truncated or not, is detected by western blot (S3 Fig). We used transheterozygotes of the previously generated allele Past160-4 and our two CRISPR generated null alleles (Past1M10 and Past1F15) in these experiments. Our genetic controls were progenitor flies from the Cas9 process, that are wild-type for Past1.
Past1 mutant flies, and flies overexpressing WalE1 in garland cells, exhibit endocytosis defects
Previously, endocytosis defects were observed for past1 mutant flies [25]. In that prior study, the authors had used Drosophila garland cells to evaluate endocytosis in the fly as they are the equivalent of a kidney, filtering the fly haemolymph. One straightforward way to test for fly garland cell function is to expose flies to silver nitrate (AgNO3); if the fly harbors mutations that alter the function of the garland cells, they will be more sensitive to AgNO3 toxicity [33]. We therefore subjected larvae expressing WalE1 and larvae carrying mutations in Past1 to AgNO3 throughout development and monitored viability over time, counting the number of pupae and adults derived from these conditions. Control flies did not show any phenotype when reared in the presence of AgNO3 and indeed, no statistical differences were observed across all fly backgrounds reared in normal food without AgNO3. However, flies expressing the Wolbachia effector were exquisitely sensitive to AgNO3, to the same extent as those carrying Past1 null mutations (Fig 6). While 90% of control flies survive AgNO3, WalE1 overexpression resulted in 5% survival on average (Fig 6). This result confirms prior observations regarding the effect of Past1 on endocytosis [25] and supports a role for WalE1 in modifying endocytosis as well. Importantly, all flies used in this experiment did not have a white mutation nor balancer chromosomes, to remove confounding background sensitivity effects (S3 Table, [31]).
[Figure omitted. See PDF.]
Fig 6. Survival of adult flies subjected to silver nitrate exposure during development.
Flies expressing WalE1 using the Hand-GAL4 driver or carrying mutations in Past1 are sensitive to AgNO3 (gray) exposure compared to survival on control food (orange). Control flies show no lethal phenotype. N > 100, across 5 separate vials for each condition.
https://doi.org/10.1371/journal.ppat.1011245.g006
Wolbachia increase in abundance in Past1 null flies
Because we identified Past1 as a potential target of WalE1, and because both proteins are involved in modifying endocytosis in Drosophila, we wondered if there would be an interaction between Past1 null mutants and Wolbachia abundance. We reasoned that if Wolbachia was using WalE1 to modify Past1, reduction of the dosage of Past1 might influence Wolbachia biology. Therefore, we began by examining Wolbachia abundance in flies with different copy numbers of Past1. We used western blot targeting the Wolbachia surface protein (wsp) and observed a clear and statistically significant effect of Past1 dosage on Wolbachia abundance (ANOVA; df = 2, F = 40.611, p < 0.001). Flies that are null for Past1 have the highest Wolbachia abundance (t = -7.675, df = 13, p < 0.001) followed by flies with a half dose of Past1, although the abundance in these flies is not significantly different from wild-type (t = -2.632, df = 10, p = 0.457) (Fig 7). Importantly, these results by western blot are recapitulated by quantitative PCR targeting the Wolbachia wsp locus (S4 Fig).
[Figure omitted. See PDF.]
Fig 7. Wolbachia titer increases in flies in a Past1 dose-dependent manner.
Entire flies were used in a western-blot targeting Wolbachia’s surface protein (WSP). WSP Band intensity was measured relative to α-Actin band intensity as a loading control. Wolbachia titers increase in whole flies and are highest in the Past1 null flies (Past160-4/Df(3R)Kar-Sz29), intermediate in titer in ½ dose Past1 flies (Past160-4 or Df(3R)Kar-Sz29/Past1+ on balancer) flies, and lowest titer in flies with two copies of Past1+ (WT, wild-type flies) (ANOVA: df = 2, F = 40.611, p < 0.001).
https://doi.org/10.1371/journal.ppat.1011245.g007
We next wondered if this whole-animal increase in Wolbachia load would be observed in the ovary tissue as well, the tissue best studied for Wolbachia abundance and localization. We dissected ovaries from Past160-4 /Df(3R)Kar-Sz29 flies and sibling controls with a half dose of Past1. Wolbachia abundance was quantified by Wolbachia-specific antibody staining (α-FtsZ) in ovarioles as indicated in the methods. We noticed that Wolbachia staining was most intense in the germarium for both backgrounds (as expected) but as oogenesis progressed, flies null in Past1 harbored more Wolbachia in older egg chambers (Fig 8, GLM χ2 = 10.477; df = 3; p = 0.001). The most differentiation in Wolbachia abundance between these backgrounds was observed for stages 7–8 (Fig 8; GLM χ2 = 39.449; df = 3; p < 0.001). This result is reminiscent of the increase in Wolbachia abundance observed upon over-expression of WalE1 in our prior work [8].
[Figure omitted. See PDF.]
Fig 8. Wolbachia titer within the ovary of Past1 mutant flies increases during oogenesis.
Past160-4 /Df(3R)Kar-Sz29 flies are compared to their wild type counterparts (sibling controls with a null mutant copy of Past1 and a balancer with Past1+). Wolbachia titer is quantified by α-FtsZ staining in ovarioles (GLM χ2 = 10.477; df = 3; p = 0.001).
https://doi.org/10.1371/journal.ppat.1011245.g008
Discussion
Wolbachia is a ubiquitous intracellular symbiont, infamous for reproductive manipulations induced in insects, such as cytoplasmic incompatibility and male killing [34]. However, all the dramatic effects induced by Wolbachia require the bacterium to infect and persist in the insect host. Although a few proteins facilitating Wolbachia’s reproductive manipulations have been identified [35], we know even less about Wolbachia’s basic biology and how it maintains its infection. The first characterized Wolbachia effector was WalE1, an actin-bundling protein that increased Wolbachia abundance in the oocyte upon overexpression [8]. Purified WalE1 sediments with actin, and when heterologously expressed in flies and yeast, co-localizes with actin filaments [8]. Here, we explored the native expression of WalE1 during a Wolbachia infection in Drosophila and find that it forms aggregates within both cell lines and oocytes. We characterized host proteins that may interact with WalE1 using co-immunoprecipitation and mass spectrometry and identified Past1 as a putative WalE1 target. We confirmed that Drosophila Past1 plays a role in endocytosis, and showed that WalE1 plays a similar role in both yeast and flies. Finally, we show that Wolbachia abundance increases in egg chambers within Past1 null flies. This result echoes our previously published work showing that overexpression of WalE1 increased Wolbachia abundance in the developing oocyte [8].
Here we show that a Wolbachia-secreted effector impacts host endocytosis. Many bacterial pathogens deploy effectors that alter host endocytosis and vesicle trafficking, as these cellular processes are important for signaling, interactions with the extracellular environment, and metabolism. Indeed, the Wolbachia strain that colonizes filarial nematodes (wBm) encodes a protein that when overexpressed in yeast, decouples actin patches from sites of endocytosis (wBm0076, [36]), and it is likely that multiple Wolbachia strains use similar strategies for host interaction. By altering host endocytosis and vesicle trafficking, pathogens can avoid phago-lysozome fusion, as Mycobacterium tuberculosis does using EsxH [37], or even induce uptake of the microbe, as is the case for Helicobacter pylori’s CagA [38]. The Legionella pneumophila effector AnkX, which encodes a FIC domain that transfers a phosphocholine to Rab1b, interferes with host endocytic recycling and localizes to tubular membrane compartments [39]. Similarly, Shigella alters the composition of lipids in the vacuolar membrane–especially phosphoinositide composition–altering the stability of the Shigella-containing vacuole [40]. Our results show that expression of WalE1 alters host endocytosis and that this Wolbachia protein pulls down host Past1, which is also implicated in endocytic recycling. The way Wolbachia’s WalE1 might interact with Past1, directly or indirectly, and the specific downstream impact of such interaction on the cell biology of Wolbachia/host symbiosis is part of future work.
Although we have characterized native WalE1 and a putative target, many questions remain. As EHD proteins form large oligomers on membranes, does WalE1 co-localize with Past1? Unfortunately, our Past1 antibody, useful for western blot, did not function in immunohistochemistry, making that question more difficult to answer at the moment. EDH proteins like Past1 are involved in trafficking but we do not know if WalE1 is targeting Past1 to impact specific cargo. What we have shown is that Past1 null flies harbor higher Wolbachia abundance, suggesting that WalE1 antagonizes Past1 to promote Wolbachia infection. We hypothesize that by abrogating Past1 function, WalE1 alters the endocytic recycling of membrane-associated receptors or proteins important for Wolbachia infection. The WalE1 effector is conserved across a wide swathe of the Wolbachia genus [8], and is found within both insect-associated Wolbachia strains and those that infect nematodes. It would be interesting to know if these other homologs function similarly in their respective hosts–bundling actin and affecting host endocytosis–or if their functions have diverged. Also, Past1 is the only EHD protein in the Drosophila genome. When Wolbachia infects other insects, does WalE1 target their Past1 homolog(s)? Our work begins to shed some light on how Wolbachia impinges upon host biology and cell biological targets of Wolbachia effectors.
Materials and methods
Yeast WalE1 expression and endocytosis assay
Previously published yeast strains and constructs were used for this assay [8]. Briefly, yeast strain S288C (BY4741 MATa) was transformed with sequence-verified pFus-WalE1 expression vectors generated using the PEG/Lithium acetate method [41]. Yeast transformants were inoculated into selective synthetic media with 2% (w/v) glucose. These cultures were grown overnight to saturation (at 30°C) before back dilution to an OD600 of 0.1 into media containing 2% galactose for induction of the construct for 6 hours. The cultures were harvested and kept at 4°C while FM4-64 (ThermoFisher) was added 1:50 to the cells for 10 minutes. Yeast cells were then washed and mounted on agar pads, placed at 30°C, and imaged live for a 2-hour time course with a 60x oil objective. FM464 staining intensity per image was determined using Nikon NIS Elements software.
Yeast-two-hybrid assay
The putative, direct interaction between WalE1 and Past1 was assessed through a Yeast-Two-Hybrid (Y2H) assay. Towards that end, we used S. cerevisiae strains Y8930 and Y8800 carrying the recombinant, expression vectors pDest-DB/WalE1 and pDest-AD/Past1 (pDest-DB and AD were acquired from AddGene), respectively. Both strains were grown overnight in liquid, selective media (either Leucine or Tryptophan drop-out) allowing for the maintenance of the expression vectors. Broth density was adjusted to OD600 = 1 prior to yeast strains co-incubation (10uL each) in 160uL YPD (30°C, 24hrs). Then, 24uL (three, 8uL drops) of the incubated mix were plated on solid medium selecting for both Y8930/Y8800 hybrids and WalE1/Past1 direct interaction (Leucine, Tryptophan, and Histidine drop-out + 1mM 3-amino-1,2,4-triazole). Plated yeast were incubated at 30°C for 48 more hours. Both a negative (pDest-DB, and pDest-AD transformed Y8930 and Y8800, respectively), and a positive (pDest-DB/Fos, and pDest-AD/Jun transformed Y8930 and Y8800, respectively) control was run in parallel.
Western blots
Proteins were separated on 4–20% Tris-Glycine NB precast minigels (NuSep) and transferred to PVDF membrane in Tris-Glycine transfer buffer with 15% methanol at 40v on ice for 3 hours. The membranes were blocked for 5 minutes in SuperBlock (TBS) Blocking Buffer (ThermoFisher Scientific), followed by incubation with antibodies diluted in SuperBlock (TBS) Blocking Buffer (for 1 hour at room temperature or overnight at 4°C) according to standard protocols. PageRuler Prestained Protein Ladder (ThermoFisher Scientific) was used as a molecular mass marker. Antibodies utilized include mouse anti-actin at 1:10,000 (Seven Hills Bioreagents, LMAB-C4), which was used to detect total actin; rabbit anti-Past1 at 1:1000 (from Mia Horowitz at Tel Aviv University [25]) and mouse anti-Wsp at 1:10,000 (BEI Resources, Inc. NR-31029). F(ab’)2-Goat anti-Rabbit IgG (H+L) (A24531) and goat anti-mouse IgG (G-21040) secondary antibodies conjugated to horseradish peroxidase (HRP) were used at 1:5,000 (ThermoFisher Scientific Invitrogen). SuperSignal West Pico Chemiluminescent Substrate was used to detect HRP on immunoblots per manufacturer instructions (ThermoFisher Scientific). Blots were re-probed after stripping (100mM Glycine, 0.15 ND-40, 1% SDS, pH 2) for 1 hour at room temperature, then overnight or up to three days at 4°C. The rabbit anti-Past1 antisera was not purified and also detects a protein band of ~ 50 KD in wMel-containing lysates that is not observed when the sera are preabsorbed with strips of PVDF membrane containing total E. coli lysate. Therefore we used preadsorption to remove that background. To prepare the E. coli-PVDF for use in preadsorption, a 2 ml liquid culture of E. coli (K12) was inoculated and grown overnight at 37°C on a rotating wheel. One mL of the culture was centrifuged for 1 min at 8,000g. The supernatant was discarded and the pellet resuspended in 100 ul of PBS with added 1X Halt Protease Inhibitor Cocktail (ThermoFisher Scientific) and 5 mM EDTA. This resuspension was mixed with protein sample buffer to a 1X concentration, heated at 100°C for 10 minutes and centrifuged for 3 minutes at 10,000g. The supernatant was loaded and run in multiple lanes of a 4–20% polyacrylamide gel (Nu-Sep), followed by transfer to PDVF membrane. Prepared strips of PVDF were used immediately or stored at 4°C for up to 2 weeks before use with similar results.
Drosophila cell culture and maintenance
Drosophila melanogaster JW18 cells, which carry a GFP-Jupiter construct [24], were treated with 10 μg/mL tetracycline to remove Wolbachia infection. The infection status was confirmed by PCR after four passages in the presence of antibiotic. Cells with and without Wolbachia bacteria were maintained in the dark, in T25 unvented cell culture flasks at room temperature. Schneider’s insect medium was used and supplemented with 10% heat-treated fetal bovine serum and 1% penicillin/streptomycin solution with the addition of 3.3 ug/mL tetracycline.
DNA extraction and quantitative PCR of Wolbachia
DNA was extracted from whole flies utilizing the Qiagen DNeasy Blood and Tissue Kit (Qiagen) according to directions with the following modification. Flies were ground in a 1.5ml centrifuge tube using a disposable pestle and an electric hand drill in 180 μl PBS, 200 μl ALT buffer, and 20 μl Proteinase K solution. The samples were incubated at 56°C for 10 minutes with vigorous shaking and then centrifuged briefly to pellet debris before continuing with the ethanol precipitation in the kit protocol. Nucleic acids were quantified by measuring absorbance at 260nm using an Epoch spectrophotometer (Biotek). Quantitative PCR was performed on the DNA to detect the Wolbachia abundance (targeting the wsp gene, using a host gene (Rpl32) as a reference) using an Applied Biosystems StepOne Real-time PCR system and SybrGreen chemistry (Applied Biosystems). We used wsp primers for Wolbachia (Forward: CATTGGTGTTGGTGTTGGTG; Reverse: ACCGAAATAACGAGCTCCAG) and Rpl32 primers for the host (Forward: CCGCTTCAAGGGACAGTATC; Reverse: CAATCTCCTTGCGCTTCTTG) at the following temperatures: 95°C for 10 min, then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. Reactions were performed in a 96-well plate and calibration standards were used in every run to calculate primer efficiencies. These efficiencies, along with the CT values generated by the machine, were used to calculate the relative amounts of Wolbachia using the ΔΔ Ct (Livak) and Pfaffl methods.
Drosophila cell and ovary immunochemistry and microscopy
The Drosophila melanogaster JW18 cell line, naturally infected with Wolbachia strain wMel, was used to visualize WalE1 in an infection [42]. JW18-TET cells were passaged with 3.3 μg/μl tetracycline added to the culture medium and were used as an uninfected control cell line. Confluent monolayers were harvested from 25 cm2 non-vented tissue culture flasks, counted using a disposable hemocytometer (Fisher Scientific), and overlaid as 100 μl of 2 x 106 or 200 μl of 1 x 106 cells onto Concanavalin-A coated No. 1.5 coverslips (ConA 0.5 mg/ml applied and dried on to sterile, acid-washed coverslips and leaving a 2 mm ConA-free border) [43, 44]. Cells were allowed to settle, attach, and spread out overnight before cells were fixed in 4% paraformaldehyde in PBS for 20 minutes, followed by four 1 mL washes of 1X PBST (0.2% Tween-20 added to 1X PBS). Coverslips were then exposed to blocking solution (PBST 0.2% Tween-20 and 0.5% BSA) for 15 minutes at room temperature before transfer to primary antibody (at concentrations indicated below) overnight in blocking solution at 4°C. In the morning, coverslips were washed in PBST and then allowed to incubate for 1–2 hours at room temperature in the dark in 100 μl of secondary antibodies diluted in the blocking solution. Coverslips were washed for 5 minutes 3–4 times with one mL PBST, followed by a final dip in a 500 mL beaker of distilled water. Excess moisture was wicked off the edge of the coverslip with a tissue followed by mounting in 10 μl of Prolong Gold Antifade Reagent with DAPI (Invitrogen) per coverslip on glass slides.
For immunolocalization of proteins in developing egg chambers, ovaries from mated four-day old females were dissected in cold PBS before transfer to 1.5 mL microcentrifuge tubes with 100ul Devitt’s solution (5.3% paraformaldehyde, 0.5% NP-40, 1X PBS) and 600 ul heptane [45]. The ovary tubes were vigorously shaken by hand for 30 seconds to create an emulsion, before rocking for 10 minutes at room temperature. After three rinses of ovaries, gently pelleted by 5-second spins in a mini microcentrifuge (6000 rpm, 2,000g), in PBST (0.2% Tween-20 added to 1X PBS), the ovaries were soaked in blocking solution (PBST 0.2% Tween-20 and 0.5% BSA) for 15 minutes at room temperature before addition of primary antibody and overnight incubation rocking at 4°C. The next day, four 500–750 microliter rinses with blocking solution, after pelleting with the mini microcentrifuge, preceded the addition of secondary antibodies in the dark, for two hours, at room temperature. Three short rinses with blocking solution after pelleting then followed before mounting 5 to 10 ovary pairs. The ovaries were teased apart on glass slides with tungsten needles or insect pins, and excess buffer was carefully removed by wicking with a tissue before addition of room temperature Prolong Gold Antifade Reagent with DAPI (Invitrogen) and No 1.5 glass coverslips.
Full-length wMel WalE1 and wAna FtsZ protein-encoding constructs were synthesized by GenScript using codons optimized for E. coli and cloned into pCR-TOPO before subcloning into the pUC57 expression vector (using BamHI and XhoI restriction enzymes). Sequence-verified constructs were expressed in E. coli BL21* and purified using Ni-NTA columns (Sigma-Aldrich). Because pUC57 contains a TEV cleavage site, N-terminal His-tags were removed from these proteins before sending them to Cocalico Biologicals for antibody generation. Pre-inoculation sera from 4 rabbits was screened on blots of whole fly protein with and without infection and the rabbits with lowest background reactivity chosen for inoculation. Rabbit polyclonal antibody sera against both full-length purified proteins were generated (Cocalico Biologicals, Inc) and used separately for immunohistochemistry (α-WalE1 at 1:500 and α-FtsZ at 1:150) (S1 Fig). Secondary antibodies to rabbit and mouse IgGs that were highly purified to reduce cross reactivity were used with 488, 594 and 647 AlexaFluor conjugates at 1:1000 dilution in PBST with 0.5% BSA (Invitrogen ThermoFisher A11070, A-21244, A-21203, A-31571). For F-actin detection, we used Rhodamine-labelled Phalloidin or Acti-stain 488 Fluorescent Phalloidin (Cytoskeleton, Inc), per manufacturer instructions, depending on the cross and the wavelengths of fluorophores utilized.
Images were taken as Z-series stacks at 0.3 to 1.0 um intervals using a Nikon Ti2 fluorescent microscope with 60x oil objective and processed using NIS Elements software (Nikon). Care was taken such that exposure times and stack intervals were normalized across compared experimental conditions. For quantification of Wolbachia within the developing oocyte, maximum projections of stacks were used, excluding the peritoneal sheath. The irregular blob tool was used to outline entire egg chambers, using cortical actin staining as a guide, and DAPI DNA staining along with actin staining was used to determine egg chamber stages.
Co-immunoprecipitation and mass spectrometry
Confluent wMel-infected JW18 cells and uninfected TET-JW18 cells were harvested from 25 cm2, 50 mL non vented tissue-culture culture flasks. Cells were pelleted and washed three times with 1 ml volumes of PBS to remove culture medium and each cell type pellet was resuspended in 200 μl Lysis Buffer II (10mM Tris pH 7.4, 150mM NaCl, 10mM NaH2PO4, 1% Triton X-100) with added 1X Halt Protease Inhibitor Cocktail (ThermoFisher Scientific) and 5 mM EDTA on ice for 10 minutes, vortexing every 2 minutes. Debris and nuclei were pelleted at 10K rpm for 10 minutes in a microfuge (9391 g), 4°C rotor. Five μl of rabbit pAb-WalE1 antisera were added to 100 μl each of JW18 and JW18-TET lysate supernatants. A protein-A magnetic bead and column kit was used for co-immunoprecipitation and enrichment per manufacturer protocols with the following specific parameters: 30 minute 4°C incubation of immune complexes and magnetic protein A beads; prewetting columns with 200 μl of 70% ethanol; and use of a stringent high-salt wash buffer (500 mM NaCl, 1% Igepal CA630 (NP-40), 50 mM Tris HCl (pH 8.0) before elution of proteins from the columns (Miltenyi Biotech, Inc). Eluted fractions were run 1–2 centimeters into a 4–20% PAGE minigel (NuSep) and the wedge of gel cut out from dye front to wells was submitted for analysis to the Indiana University Laboratory for Biological Mass Spectrometry. Peptides from Drosophila melanogaster and Wolbachia pipientis were identified and analyzed by LC-MS on an Orbitrap Fusion Lumos Tribrid equipped with an Easy NanoLC 1200. Past1 was identified as a protein of interest because it was co-immunoprecipitated with α-WalE1 only in JW18 cells infected with Wolbachia and was recovered with high coverage and a high number of unique peptides.
Transgenic Drosophila stocks, Wolbachia infection detection and clearing
All genetic backgrounds and fly stocks used in this study, including those obtained from the Bloomington Drosophila Stock Center are indicated in S2 Table. The wMel infection status for all strains was determined by PCR of a wsp gene fragment or western blot of WSP protein (see S2 Table). Three Crispr guide RNAs were designed using the target finder at FlyCrispr (https://flycrispr.org/target-finder/) to the 5’ half of the Past1 gene for interruption of function in both the ubiquitous (B) and testes specific (A) splice variants. The three targets synthesized within the CRISPR forward DNA primers were: Target 1 3R:12698125..12698147 GAAGCGCG|AGAAGAACACCC; Target 4 3R:12698221..12698243 GTTCCACGACTT|TCACTCGC and Target 6 3R:12698304..12698326 CGGGCAAGACGA|CCTTCATC (Integrated DNA Technologies, Inc for forward and reverse primer synthesis). The guide RNAs were made per methods described in [46] and shipped out on dry ice to be mixed and injected into Drosophila embryos (Rainbow Transgenics, Inc). Two independent lines including a Past1 abrogation were recovered (S2 Fig). Past1 primers used for amplification and sequencing through an 833 bp region that includes the three CRISPR targets were: forward primer ATAACTGCCGTAGTCGTCGC (3R:12697988–12698007) and reverse primer GGAGCCGATGTAGACACGAG (3R:12698851–12698870). Standard methods were used for all crosses and culturing, and flies were maintained and crosses were performed at 22.5°C. Twelve stocks used in this study were obtained from the Bloomington Drosophila Stock Center (BDSC) at Indiana University (http://flystocks.bio.indiana.edu/, S2 Table). Stocks carrying P{w[+mC] = UASp-RFP.WalE1} on the 3rd chromosome (created in a w[1118] background and previously published [8]) were also used. Prior to use, the Wolbachia infection status of all stocks was investigated by PCR amplification of a ~500 bp segment of the wMel Wolbachia surface protein (wsp) gene (wspF1 GTCCAATARSTGATGARGAAAC and wspR1 CYGCACCAAYAGYRCTRTAAA) and/or western blotting to detect the WSP protein. To make genetically similar stocks without Wolbachia infection, flies were treated with tetracycline and repopulated with other microbiome members as previously reported [47].
Drosophila silver nitrate toxicity assays
Red-eyed fly stocks (white[+] locus, no Wolbachia infection) were created for the Hand-GAL4 driver line (BDSC #48396, w[1118]; P{y[+t7.7] w[+mC] = GMR88D05-GAL4}attP2) [48], the UAS-WalE1 stock (P{w[+mC] = UASp-RFP.WalE1}7M and 4M insert on the third chromosome created originally in a w[1118] background [8], and the parental w[1118] stock (otherwise wild-type parental background) by out-crossing all three stocks to an uninfected, w[+], third-chromosome balancer stock (BDSC #3644; TM3, Sb [1]/TM6B, Tb [1] Dr[Mio]). Nephrocyte expression of Hand-GAL4 was verified by crossing to a second-chromosome, UAS-nuclear localized GFP responder stock (BDSC 4775, w[1118]; P{w[+mC] = UAS-GFP.nls}14) which distinguishes the uniquely binucleate garland cells from surrounding gut tissues in the F1 progeny [49]. Sets of 10–20 virgin females (uninfected, w[+] eyes) and 15–30 male flies were mated in small cages on standard fly food for two days and then allowed to lay eggs for 24 hours on grape agar (Genesee Scientific) plates (60 x 15 mm) with a little pile of yeast paste (1 g live baker’s yeast per 2 ml water) for 4–5 days. The 24 hour old plates were incubated at room temperature in a moist chamber another day until 48 hours, at which point 1st instar larvae were collected in a 100 micron disposable sieve, rinsed with room temperature water to remove food and debris, and were placed in groups of 10 larvae per plastic vial of 5 mL of minimal medium (5 g agar, 5 g dextrose, 360 mL distilled water, solubilized using heat and aliquoted) with ~60 μl of yeast paste made with water or a 0.003% silver nitrate solution (AgNO3) applied to the surface of the minimal medium (based on method described in [33]). Vials were observed daily through the remainder of development. Pupal formation, adult emergence, and adult marker phenotypes were recorded for each vial through ~19 days.
Drosophila larval nephrocyte (garland cell) endocytosis assays
Uptake of fluorescently-labelled 1 mg/ml dextran (ThermoFisher Scientific, Invitrogen Dextran, Alexa Fluor 488; 10,000 MW, anionic, fixable) was used to assess endocytosis in Drosophila melanogaster larval nephrocytes (garland cells) using the methods described in Odenthal and Brinkkoetter, 2019 [50], briefly outlined here with included modifications and details specific to this study. Red-eyed fly stocks (white[+] locus, no Wolbachia infection) were created for the Hand-GAL4 driver line (BDSC #48396, w[1118]; P{y[+t7.7] w[+mC] = GMR88D05-GAL4}attP2) [48], the UAS-WalE1 stock (P{w[+mC] = UASp-RFP.WalE1}7M insert on the third chromosome created originally in a w[1118] background [8], and the parental w[1118] stock (otherwise wild-type parental background) by out-crossing all three stocks to an uninfected, w[+], third-chromosome balancer stock (BDSC #3644; TM3, Sb [1]/TM6B, Tb [1] Dr[Mio]). Nephrocyte expression of Hand-GAL4 was verified by crossing to a second-chromosome, UAS-nuclear localized GFP responder stock (BDSC 4775, w[1118]; P{w[+mC] = UAS-GFP.nls}14) which distinguishes the uniquely binucleate garland cells from surrounding gut tissues in the F1 progeny [49]. Late-third-instar F1 progeny from crosses of the homozygous Hand-GAL4 flies to either the wild-type control stock or the homozygous UAS-WalE1.7M were dissected to harvest garland cells attached to a section of gut at room temperature, in 500 μl of filter-sterilized, osmotically-balanced HL3 buffer (HL3; 70 mM NaCl, 5 mM KCl, 1.5 mM CaCl2·2H2O, 20 mM MgCl2·6H2O, 10 mM NaHCO3, 5 mM Trehalose, 115 mM Sucrose, 5 mM HEPES; pH7.2 [51],). Gut-garland cell preps in dissection dishes were shifted to ice-cold HL3 buffer in a multi-well glass dissection dish with forceps, kept on ice, and incubated 5 minutes with 100 μl of 1 mg/mL green fluorescent 10K MW dextran (diluted immediately before use from a 10 mg/ml fluorescent dextran, 100 mM Tris pH 8 stock, stored at -20 C in darkness). Foil was used to protect the preps from light as much as possible. The unbound dye was washed out with three 1–2 minute 500 microliter ice-cold washes of HL3 buffer. One third of control and experimental gut-garland cell preps were transferred with forceps to ice-cold 4% paraformaldehyde in HL3 buffer for the zero time point (20 minutes fixation, followed by three 5 minute washes in room temperature, sterile PBS). The multi-well dissecting dish with the remaining two-thirds of gut-garland preps were moved off ice to a room temperature bench and half of the preps (1/3 of total) were transferred to fix 15 minutes after the temperature shift, and the remainder of preps were fixed at 30 mins post temperature shift. After fixative was washed out, all preps were incubated with 1X PBST-BSA (filter-sterilized PBS with 0.1% Tween-80 and 0.5% bovine serum albumin) at room temperature for 5 minutes, followed by incubation with a fluorescently-labelled antibody that reacts well with garland cell membranes ([50, 52–55] Jackson ImmunoResearch Labs, Inc., catalogue #323-605-021, Alexa Fluor 647 AffiniPure Rabbit Anti-Horseradish Peroxidase) diluted 1:1000 in PBSTBSA, for 2 hours at room temperature, followed by three 500 microliter washes for 5 minutes each with PBS. Each control and experimental time group of 5–10 gut preps was mounted in 10 ul of Prolong Gold with DAPI under a 22 x 22 mm No. 1.5 glass coverslip and microscopy was performed using a 100X oil immersion Nikon objective lens, and z-stacks off entire clumps of garland cells were collected with 0.2 micron steps. Deconvolution was performed using the Nikon NiElements software. For analysis, Z-series Nikon nd2 micrograph files were maximally projected, and the Bezier tool was used to outline groups of garland cells as regions of interest (ROI) using the combination of the FITC and CY5 channels to define the limits of each group of garland cells as a ROI. Total green fluorescence for each ROI was divided by the area of the ROI, and that ratio was used in statistical analyses described below.
Statistical analyses
All statistical analyses were performed in RStudio (v2022.07.01). Intensity data from Nikon NiE Elements were tested for normalcy and overdispersion in R. For each dataset, we calculated the likelihood ratio (or deviance in the case of the glm) to compare models to each other. For yeast endocytosis assays, a Kruskal Wallis test was used. For Wolbachia abundance in whole flies, quantified by western blot, normalized band intensities were used and an ANOVA applied to test for differences based on genotype. For Wolbachia abundance in Past1 mutant egg chambers, a GLM with a Quasipoisson distribution (glm in the stats library) was used to test for significant differences in the intensity of Wolbachia staining in each egg chamber across genotypes. For dextran uptake by garland cells, a GLM with a poisson distribution (glm in the stats library) was used to test for significant differences in the intensity of staining across genotypes.
Supporting information
S1 Fig. Antisera against the Wolbachia WalE1 protein does not detect its presence in JW18 cells that do not carry the bacterium (JW18-tet).
WalE1 with a 6xHis tag, expressed and purified from E. coli shown as positive control in lane 5. Wolbachia bacteria were isolated from JW18 cells using cell disruption and differential centrifugation (wMel-iso) [24] or the full lysate was used for the western blot (lysate).
https://doi.org/10.1371/journal.ppat.1011245.s001
(PDF)
S2 Fig. WalE1 and Past1 do not interact via a yeast-2-hybrid assay.
Constructs for Past1 and WalE1 were co-expressed in diploid yeast to drive expression of a metabolic marker (HIS3) that allows growth on media lacking histidine. Although our positive control (Fos x Jun) grew, hybrid yeasts with WalE1 and Past1 grew similarly to vector alone (AD only or DB only).
https://doi.org/10.1371/journal.ppat.1011245.s002
(PDF)
S3 Fig. Antisera against the Past1 protein does not detect its production in CRISPR mutants F15 or M10.
https://doi.org/10.1371/journal.ppat.1011245.s003
(PDF)
S4 Fig. Wolbachia abundance increases in the Past1 null flies compared to wild-type.
Wolbachia load was measured using qPCR targeting the wsp locus (relative to host gene rpl32). Past1 null flies have a larger relative abundance of Wolbachia compared to wild type flies.
https://doi.org/10.1371/journal.ppat.1011245.s004
(PDF)
S1 Table. Mass spectrometry results from co-immunoprecipitation of WalE1 using anti-WalE1 sera.
https://doi.org/10.1371/journal.ppat.1011245.s005
(XLSX)
S2 Table. List of stocks used in this study and their provenance.
https://doi.org/10.1371/journal.ppat.1011245.s006
(XLSX)
S3 Table. Fly genotype is a variable in AgNO3 viability assay.
White and vermillion mutations, as well as balancer chromosomes, make flies more sensitive to silver nitrate.
https://doi.org/10.1371/journal.ppat.1011245.s007
(XLSX)
Acknowledgments
We thank members of the Newton laboratory for feedback on earlier versions of this manuscript and support for development of the assays used herein. We thank Osvaldo Marinotti for help in generating the constructs used in the yeast-2-hybrid assay. We thank Fay Munro of Nikon for assistance in deconvolution of images. We thank the Indiana University Laboratory for Biological Mass Spectrometry for their help in identifying peptides from our experiments. Stocks obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537) were used in this study. We thank Mia Horowitz of Tel Aviv University for generously sharing past1 polyclonal antibody sera and depositing past1 mutant Drosophila stocks in the BDSC. We thank Kevin Cook of the BDSC for his expertise in international acquisitions of Drosophila stocks.
References
1. 1. Zug R, Hammerstein P. 2012. Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7:e38544. pmid:22685581
* View Article
* PubMed/NCBI
* Google Scholar
2. 2. LePage D, Bordenstein SR. 2013. Wolbachia: Can we save lives with a great pandemic? Trends Parasitol 29:385–93. pmid:23845310
* View Article
* PubMed/NCBI
* Google Scholar
3. 3. Andersson SG, Kurland CG. 1999. Origins of mitochondria and hydrogenosomes. Curr Opin Microbiol 2:535–41. pmid:10508728
* View Article
* PubMed/NCBI
* Google Scholar
4. 4. Werren JH, Baldo L, Clark ME. 2008. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol 6:741–51. pmid:18794912
* View Article
* PubMed/NCBI
* Google Scholar
5. 5. Teixeira L, Ferreira A, Ashburner M. 2008. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol 6:e2. pmid:19222304
* View Article
* PubMed/NCBI
* Google Scholar
6. 6. Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, McGraw EA, Martin W, Esser C, Ahmadinejad N, Wiegand C, Madupu R, Beanan MJ, Brinkac LM, Daugherty SC, Durkin AS, Kolonay JF, Nelson WC, Mohamoud Y, Lee P, Berry K, Young MB, Utterback T, Weidman J, Nierman WC, Paulsen IT, Nelson KE, Tettelin H, O’Neill SL, Eisen JA. 2004. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol 2:E69. pmid:15024419
* View Article
* PubMed/NCBI
* Google Scholar
7. 7. Bhattacharya T, Newton ILG. 2017. Mi Casa es Su Casa: how an intracellular symbiont manipulates host biology. Environ Microbiol pmid:29076641
* View Article
* PubMed/NCBI
* Google Scholar
8. 8. Sheehan KB, Martin M, Lesser CF, Isberg RR, Newton IL. 2016. Identification and Characterization of a Candidate Wolbachia pipientis Type IV Effector That Interacts with the Actin Cytoskeleton. mBio 7. pmid:27381293
* View Article
* PubMed/NCBI
* Google Scholar
9. 9. Rances E, Voronin D, Tran-Van V, Mavingui P. 2008. Genetic and functional characterization of the type IV secretion system in Wolbachia. J Bacteriol 190:5020–30. pmid:18502862
* View Article
* PubMed/NCBI
* Google Scholar
10. 10. Backert S, Meyer TF. 2006. Type IV secretion systems and their effectors in bacterial pathogenesis. Current Opinion in Microbiology 9:207–217. pmid:16529981
* View Article
* PubMed/NCBI
* Google Scholar
11. 11. Burstein D, Zusman T, Degtyar E, Viner R, Segal G, Pupko T. 2009. Genome-scale identification of Legionella pneumophila effectors using a machine learning approach. PLoS Pathog 5:e1000508. pmid:19593377
* View Article
* PubMed/NCBI
* Google Scholar
12. 12. Ruhe ZC, Low DA, Hayes CS. 2020. Polymorphic Toxins and Their Immunity Proteins: Diversity, Evolution, and Mechanisms of Delivery. Annu Rev Microbiol 74:497–520. pmid:32680451
* View Article
* PubMed/NCBI
* Google Scholar
13. 13. Ham H, Sreelatha A, Orth K. 2011. Manipulation of host membranes by bacterial effectors. Nat Rev Microbiol 9:635–46. pmid:21765451
* View Article
* PubMed/NCBI
* Google Scholar
14. 14. Deslandes L, Rivas S. 2012. Catch me if you can: bacterial effectors and plant targets. Trends Plant Sci 17:644–55. pmid:22796464
* View Article
* PubMed/NCBI
* Google Scholar
15. 15. Anderson DM, Frank DW. 2012. Five mechanisms of manipulation by bacterial effectors: a ubiquitous theme. PLoS Pathog 8:e1002823. pmid:22927812
* View Article
* PubMed/NCBI
* Google Scholar
16. 16. Cui H, Xiang T, Zhou JM. 2009. Plant immunity: a lesson from pathogenic bacterial effector proteins. Cell Microbiol 11:1453–61. pmid:19622098
* View Article
* PubMed/NCBI
* Google Scholar
17. 17. Galan JE. 2009. Common themes in the design and function of bacterial effectors. Cell Host Microbe 5:571–9. pmid:19527884
* View Article
* PubMed/NCBI
* Google Scholar
18. 18. Hicks SW, Galan JE. 2013. Exploitation of eukaryotic subcellular targeting mechanisms by bacterial effectors. Nat Rev Microbiol 11:316–26. pmid:23588250
* View Article
* PubMed/NCBI
* Google Scholar
19. 19. Stavrinides J, McCann HC, Guttman DS. 2008. Host-pathogen interplay and the evolution of bacterial effectors. Cell Microbiol 10:285–92. pmid:18034865
* View Article
* PubMed/NCBI
* Google Scholar
20. 20. Welch MD. 2015. Why should cell biologists study microbial pathogens? Mol Biol Cell 26:4295–301. pmid:26628749
* View Article
* PubMed/NCBI
* Google Scholar
21. 21. de Felipe KS, Pampou S, Jovanovic OS, Pericone CD, Ye SF, Kalachikov S, Shuman HA. 2005. Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer. J Bacteriol 187:7716–26. pmid:16267296
* View Article
* PubMed/NCBI
* Google Scholar
22. 22. Xu S, Zhang C, Miao Y, Gao J, Xu D. 2010. Effector prediction in host-pathogen interaction based on a Markov model of a ubiquitous EPIYA motif. BMC Genomics 11 Suppl 3:S1. pmid:21143776
* View Article
* PubMed/NCBI
* Google Scholar
23. 23. Newton IL, Savytskyy O, Sheehan KB. 2015. Wolbachia utilize host actin for efficient maternal transmission in Drosophila melanogaster. PLoS Pathog 11:e1004798. pmid:25906062
* View Article
* PubMed/NCBI
* Google Scholar
24. 24. Nevalainen LB, Layton EM, Newton ILG. 2023. Wolbachia Promotes Its Own Uptake by Host Cells. Infect Immun :e0055722. pmid:36648231
* View Article
* PubMed/NCBI
* Google Scholar
25. 25. Olswang-Kutz Y, Gertel Y, Benjamin S, Sela O, Pekar O, Arama E, Steller H, Horowitz M, Segal D. 2009. Drosophila Past1 is involved in endocytosis and is required for germline development and survival of the adult fly. J Cell Sci 122:471–80. pmid:19174465
* View Article
* PubMed/NCBI
* Google Scholar
26. 26. Caplan S, Naslavsky N, Hartnell LM, Lodge R, Polishchuk RS, Donaldson JG, Bonifacino JS. 2002. A tubular EHD1-containing compartment involved in the recycling of major histocompatibility complex class I molecules to the plasma membrane. EMBO J 21:2557–67. pmid:12032069
* View Article
* PubMed/NCBI
* Google Scholar
27. 27. Grant B, Zhang Y, Paupard MC, Lin SX, Hall DH, Hirsh D. 2001. Evidence that RME-1, a conserved C. elegans EH-domain protein, functions in endocytic recycling. Nat Cell Biol 3:573–9. pmid:11389442
* View Article
* PubMed/NCBI
* Google Scholar
28. 28. Guilherme A, Soriano NA, Furcinitti PS, Czech MP. 2004. Role of EHD1 and EHBP1 in perinuclear sorting and insulin-regulated GLUT4 recycling in 3T3-L1 adipocytes. J Biol Chem 279:40062–75. pmid:15247266
* View Article
* PubMed/NCBI
* Google Scholar
29. 29. Jovic M, Naslavsky N, Rapaport D, Horowitz M, Caplan S. 2007. EHD1 regulates beta1 integrin endosomal transport: effects on focal adhesions, cell spreading and migration. J Cell Sci 120:802–14. pmid:17284518
* View Article
* PubMed/NCBI
* Google Scholar
30. 30. Lin SX, Grant B, Hirsh D, Maxfield FR. 2001. Rme-1 regulates the distribution and function of the endocytic recycling compartment in mammalian cells. Nat Cell Biol 3:567–72. pmid:11389441
* View Article
* PubMed/NCBI
* Google Scholar
31. 31. Ferreiro MJ, Perez C, Marchesano M, Ruiz S, Caputi A, Aguilera P, Barrio R, Cantera R. 2017. Drosophila melanogaster White Mutant w(1118) Undergo Retinal Degeneration. Front Neurosci 11:732. pmid:29354028
* View Article
* PubMed/NCBI
* Google Scholar
32. 32. Arimoto E, Kawashima Y, Choi T, Unagami M, Akiyama S, Tomizawa M, Yano H, Suzuki E, Sone M. 2020. Analysis of a cellular structure observed in the compound eyes of; mutants and mutants. Biology Open 9.
* View Article
* Google Scholar
33. 33. Rani L, Sainii S, Shukla N, Tapadia MG, Gautam NK. 2021. Assessing functionality of Drosophila nephrocytes using silver nitrate, p 153–156. In Lakhotia SC (ed), Experiments with Drosophila for Biology Courses. Indian Academy of Sciences, Bengaluru, India.
* View Article
* Google Scholar
34. 34. Kaur R, Shropshire JD, Cross KL, Leigh B, Mansueto AJ, Stewart V, Bordenstein SR, Bordenstein SR. 2021. Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe 29:879–893. pmid:33945798
* View Article
* PubMed/NCBI
* Google Scholar
35. 35. Shropshire JD, On J, Layton EM, Zhou H, Bordenstein SR. 2018. One prophage WO gene rescues cytoplasmic incompatibility in Drosophila melanogaster. Proc Natl Acad Sci U S A 115:4987–4991. pmid:29686091
* View Article
* PubMed/NCBI
* Google Scholar
36. 36. Mills MK, McCabe LG, Rodrigue EM, Lechtreck KF, Starai VJ. 2023. Wbm0076, a candidate effector protein of the Wolbachia endosymbiont of Brugia malayi, disrupts eukaryotic actin dynamics. PLoS Pathog 19:e1010777. pmid:36800397
* View Article
* PubMed/NCBI
* Google Scholar
37. 37. Mehra A, Zahra A, Thompson V, Sirisaengtaksin N, Wells A, Porto M, Koster S, Penberthy K, Kubota Y, Dricot A, Rogan D, Vidal M, Hill DE, Bean AJ, Philips JA. 2013. Mycobacterium tuberculosis type VII secreted effector EsxH targets host ESCRT to impair trafficking. PLoS Pathog 9:e1003734. pmid:24204276
* View Article
* PubMed/NCBI
* Google Scholar
38. 38. Murata-Kamiya N, Kikuchi K, Hayashi T, Higashi H, Hatakeyama M. 2010. Helicobacter pylori exploits host membrane phosphatidylserine for delivery, localization, and pathophysiological action of the CagA oncoprotein. Cell Host Microbe 7:399–411. pmid:20478541
* View Article
* PubMed/NCBI
* Google Scholar
39. 39. Allgood SC, Romero Duenas BP, Noll RR, Pike C, Lein S, Neunuebel MR. 2017. Legionella Effector AnkX Disrupts Host Cell Endocytic Recycling in a Phosphocholination-Dependent Manner. Front Cell Infect Microbiol 7:397. pmid:28944216
* View Article
* PubMed/NCBI
* Google Scholar
40. 40. Mellouk N, Weiner A, Aulner N, Schmitt C, Elbaum M, Shorte SL, Danckaert A, Enninga J. 2014. Shigella subverts the host recycling compartment to rupture its vacuole. Cell Host Microbe 16:517–30. pmid:25299335
* View Article
* PubMed/NCBI
* Google Scholar
41. 41. Gietz RD, Woods RA. 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Guide to Yeast Genetics and Molecular and Cell Biology, Pt B 350:87–96. pmid:12073338
* View Article
* PubMed/NCBI
* Google Scholar
42. 42. Serbus LR, Landmann F, Bray WM, White PM, Ruybal J, Lokey RS, Debec A, Sullivan W. 2012. A cell-based screen reveals that the albendazole metabolite, albendazole sulfone, targets Wolbachia. PLoS Pathog 8:e1002922. pmid:23028321
* View Article
* PubMed/NCBI
* Google Scholar
43. 43. Rogers SL, Rogers GC, Sharp DJ, Vale RD. 2002. Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J Cell Biol 158:873–84. pmid:12213835
* View Article
* PubMed/NCBI
* Google Scholar
44. 44. Buster DW, Nye J, Klebba JE, Rogers GC. 2010. Preparation of Drosophila S2 cells for light microscopy. J Vis Exp pmid:20543772
* View Article
* PubMed/NCBI
* Google Scholar
45. 45. Verheyen E, Cooley L. 1994. Looking at oogenesis. Methods Cell Biol 44:545–61. pmid:7707970
* View Article
* PubMed/NCBI
* Google Scholar
46. 46. Bassett AR, Tibbit C, Ponting CP, Liu JL. 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep 4:220–8. pmid:23827738
* View Article
* PubMed/NCBI
* Google Scholar
47. 47. Newton IL, Sheehan KB. 2015. Passage of Wolbachia pipientis through mutant drosophila melanogaster induces phenotypic and genomic changes. Appl Environ Microbiol 81:1032–7. pmid:25452279
* View Article
* PubMed/NCBI
* Google Scholar
48. 48. Jenett A, Rubin GM, Ngo TT, Shepherd D, Murphy C, Dionne H, Pfeiffer BD, Cavallaro A, Hall D, Jeter J, Iyer N, Fetter D, Hausenfluck JH, Peng H, Trautman ET, Svirskas RR, Myers EW, Iwinski ZR, Aso Y, DePasquale GM, Enos A, Hulamm P, Lam SC, Li HH, Laverty TR, Long F, Qu L, Murphy SD, Rokicki K, Safford T, Shaw K, Simpson JH, Sowell A, Tae S, Yu Y, Zugates CT. 2012. A GAL4-driver line resource for Drosophila neurobiology. Cell Rep 2:991–1001. pmid:23063364
* View Article
* PubMed/NCBI
* Google Scholar
49. 49. Shiga Y, TanakaMatakatsu M, Hayashi S. 1996. A nuclear GFP beta-galactosidase fusion protein as a marker for morphogenesis in living Drosophila. Development Growth & Differentiation 38:99–106.
* View Article
* Google Scholar
50. 50. Odenthal J, Brinkkoetter PT. 2019. Drosophila melanogaster and its nephrocytes: A versatile model for glomerular research. Methods Cell Biol 154:217–240. pmid:31493819
* View Article
* PubMed/NCBI
* Google Scholar
51. 51. Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF. 1994. Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. J Comp Physiol A 175:179–91. pmid:8071894
* View Article
* PubMed/NCBI
* Google Scholar
52. 52. Soukup SF, Culi J, Gubb D. 2009. Uptake of the necrotic serpin in Drosophila melanogaster via the lipophorin receptor-1. PLoS Genet 5:e1000532. pmid:19557185
* View Article
* PubMed/NCBI
* Google Scholar
53. 53. Lin YH, Currinn H, Pocha SM, Rothnie A, Wassmer T, Knust E. 2015. AP-2-complex-mediated endocytosis of Drosophila Crumbs regulates polarity by antagonizing Stardust. J Cell Sci 128:4538–49. pmid:26527400
* View Article
* PubMed/NCBI
* Google Scholar
54. 54. Spitz D, Comas M, Gerstner L, Kayser S, Helmstadter M, Walz G, Hermle T. 2022. mTOR-Dependent Autophagy Regulates Slit Diaphragm Density in Podocyte-like Drosophila Nephrocytes. Cells 11. pmid:35805186
* View Article
* PubMed/NCBI
* Google Scholar
55. 55. Weavers H, Prieto-Sanchez S, Grawe F, Garcia-Lopez A, Artero R, Wilsch-Brauninger M, Ruiz-Gomez M, Skaer H, Denholm B. 2009. The insect nephrocyte is a podocyte-like cell with a filtration slit diaphragm. Nature 457:322–6. pmid:18971929
* View Article
* PubMed/NCBI
* Google Scholar
Citation: Martin M, López-Madrigal S, Newton ILG (2024) The Wolbachia WalE1 effector alters Drosophila endocytosis. PLoS Pathog 20(3): e1011245. https://doi.org/10.1371/journal.ppat.1011245
1. Zug R, Hammerstein P. 2012. Still a host of hosts for Wolbachia: analysis of recent data suggests that 40% of terrestrial arthropod species are infected. PLoS One 7:e38544. pmid:22685581
2. LePage D, Bordenstein SR. 2013. Wolbachia: Can we save lives with a great pandemic? Trends Parasitol 29:385–93. pmid:23845310
3. Andersson SG, Kurland CG. 1999. Origins of mitochondria and hydrogenosomes. Curr Opin Microbiol 2:535–41. pmid:10508728
4. Werren JH, Baldo L, Clark ME. 2008. Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol 6:741–51. pmid:18794912
5. Teixeira L, Ferreira A, Ashburner M. 2008. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol 6:e2. pmid:19222304
6. Wu M, Sun LV, Vamathevan J, Riegler M, Deboy R, Brownlie JC, McGraw EA, Martin W, Esser C, Ahmadinejad N, Wiegand C, Madupu R, Beanan MJ, Brinkac LM, Daugherty SC, Durkin AS, Kolonay JF, Nelson WC, Mohamoud Y, Lee P, Berry K, Young MB, Utterback T, Weidman J, Nierman WC, Paulsen IT, Nelson KE, Tettelin H, O’Neill SL, Eisen JA. 2004. Phylogenomics of the reproductive parasite Wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol 2:E69. pmid:15024419
7. Bhattacharya T, Newton ILG. 2017. Mi Casa es Su Casa: how an intracellular symbiont manipulates host biology. Environ Microbiol pmid:29076641
8. Sheehan KB, Martin M, Lesser CF, Isberg RR, Newton IL. 2016. Identification and Characterization of a Candidate Wolbachia pipientis Type IV Effector That Interacts with the Actin Cytoskeleton. mBio 7. pmid:27381293
9. Rances E, Voronin D, Tran-Van V, Mavingui P. 2008. Genetic and functional characterization of the type IV secretion system in Wolbachia. J Bacteriol 190:5020–30. pmid:18502862
10. Backert S, Meyer TF. 2006. Type IV secretion systems and their effectors in bacterial pathogenesis. Current Opinion in Microbiology 9:207–217. pmid:16529981
11. Burstein D, Zusman T, Degtyar E, Viner R, Segal G, Pupko T. 2009. Genome-scale identification of Legionella pneumophila effectors using a machine learning approach. PLoS Pathog 5:e1000508. pmid:19593377
12. Ruhe ZC, Low DA, Hayes CS. 2020. Polymorphic Toxins and Their Immunity Proteins: Diversity, Evolution, and Mechanisms of Delivery. Annu Rev Microbiol 74:497–520. pmid:32680451
13. Ham H, Sreelatha A, Orth K. 2011. Manipulation of host membranes by bacterial effectors. Nat Rev Microbiol 9:635–46. pmid:21765451
14. Deslandes L, Rivas S. 2012. Catch me if you can: bacterial effectors and plant targets. Trends Plant Sci 17:644–55. pmid:22796464
15. Anderson DM, Frank DW. 2012. Five mechanisms of manipulation by bacterial effectors: a ubiquitous theme. PLoS Pathog 8:e1002823. pmid:22927812
16. Cui H, Xiang T, Zhou JM. 2009. Plant immunity: a lesson from pathogenic bacterial effector proteins. Cell Microbiol 11:1453–61. pmid:19622098
17. Galan JE. 2009. Common themes in the design and function of bacterial effectors. Cell Host Microbe 5:571–9. pmid:19527884
18. Hicks SW, Galan JE. 2013. Exploitation of eukaryotic subcellular targeting mechanisms by bacterial effectors. Nat Rev Microbiol 11:316–26. pmid:23588250
19. Stavrinides J, McCann HC, Guttman DS. 2008. Host-pathogen interplay and the evolution of bacterial effectors. Cell Microbiol 10:285–92. pmid:18034865
20. Welch MD. 2015. Why should cell biologists study microbial pathogens? Mol Biol Cell 26:4295–301. pmid:26628749
21. de Felipe KS, Pampou S, Jovanovic OS, Pericone CD, Ye SF, Kalachikov S, Shuman HA. 2005. Evidence for acquisition of Legionella type IV secretion substrates via interdomain horizontal gene transfer. J Bacteriol 187:7716–26. pmid:16267296
22. Xu S, Zhang C, Miao Y, Gao J, Xu D. 2010. Effector prediction in host-pathogen interaction based on a Markov model of a ubiquitous EPIYA motif. BMC Genomics 11 Suppl 3:S1. pmid:21143776
23. Newton IL, Savytskyy O, Sheehan KB. 2015. Wolbachia utilize host actin for efficient maternal transmission in Drosophila melanogaster. PLoS Pathog 11:e1004798. pmid:25906062
24. Nevalainen LB, Layton EM, Newton ILG. 2023. Wolbachia Promotes Its Own Uptake by Host Cells. Infect Immun :e0055722. pmid:36648231
25. Olswang-Kutz Y, Gertel Y, Benjamin S, Sela O, Pekar O, Arama E, Steller H, Horowitz M, Segal D. 2009. Drosophila Past1 is involved in endocytosis and is required for germline development and survival of the adult fly. J Cell Sci 122:471–80. pmid:19174465
26. Caplan S, Naslavsky N, Hartnell LM, Lodge R, Polishchuk RS, Donaldson JG, Bonifacino JS. 2002. A tubular EHD1-containing compartment involved in the recycling of major histocompatibility complex class I molecules to the plasma membrane. EMBO J 21:2557–67. pmid:12032069
27. Grant B, Zhang Y, Paupard MC, Lin SX, Hall DH, Hirsh D. 2001. Evidence that RME-1, a conserved C. elegans EH-domain protein, functions in endocytic recycling. Nat Cell Biol 3:573–9. pmid:11389442
28. Guilherme A, Soriano NA, Furcinitti PS, Czech MP. 2004. Role of EHD1 and EHBP1 in perinuclear sorting and insulin-regulated GLUT4 recycling in 3T3-L1 adipocytes. J Biol Chem 279:40062–75. pmid:15247266
29. Jovic M, Naslavsky N, Rapaport D, Horowitz M, Caplan S. 2007. EHD1 regulates beta1 integrin endosomal transport: effects on focal adhesions, cell spreading and migration. J Cell Sci 120:802–14. pmid:17284518
30. Lin SX, Grant B, Hirsh D, Maxfield FR. 2001. Rme-1 regulates the distribution and function of the endocytic recycling compartment in mammalian cells. Nat Cell Biol 3:567–72. pmid:11389441
31. Ferreiro MJ, Perez C, Marchesano M, Ruiz S, Caputi A, Aguilera P, Barrio R, Cantera R. 2017. Drosophila melanogaster White Mutant w(1118) Undergo Retinal Degeneration. Front Neurosci 11:732. pmid:29354028
32. Arimoto E, Kawashima Y, Choi T, Unagami M, Akiyama S, Tomizawa M, Yano H, Suzuki E, Sone M. 2020. Analysis of a cellular structure observed in the compound eyes of; mutants and mutants. Biology Open 9.
33. Rani L, Sainii S, Shukla N, Tapadia MG, Gautam NK. 2021. Assessing functionality of Drosophila nephrocytes using silver nitrate, p 153–156. In Lakhotia SC (ed), Experiments with Drosophila for Biology Courses. Indian Academy of Sciences, Bengaluru, India.
34. Kaur R, Shropshire JD, Cross KL, Leigh B, Mansueto AJ, Stewart V, Bordenstein SR, Bordenstein SR. 2021. Living in the endosymbiotic world of Wolbachia: A centennial review. Cell Host Microbe 29:879–893. pmid:33945798
35. Shropshire JD, On J, Layton EM, Zhou H, Bordenstein SR. 2018. One prophage WO gene rescues cytoplasmic incompatibility in Drosophila melanogaster. Proc Natl Acad Sci U S A 115:4987–4991. pmid:29686091
36. Mills MK, McCabe LG, Rodrigue EM, Lechtreck KF, Starai VJ. 2023. Wbm0076, a candidate effector protein of the Wolbachia endosymbiont of Brugia malayi, disrupts eukaryotic actin dynamics. PLoS Pathog 19:e1010777. pmid:36800397
37. Mehra A, Zahra A, Thompson V, Sirisaengtaksin N, Wells A, Porto M, Koster S, Penberthy K, Kubota Y, Dricot A, Rogan D, Vidal M, Hill DE, Bean AJ, Philips JA. 2013. Mycobacterium tuberculosis type VII secreted effector EsxH targets host ESCRT to impair trafficking. PLoS Pathog 9:e1003734. pmid:24204276
38. Murata-Kamiya N, Kikuchi K, Hayashi T, Higashi H, Hatakeyama M. 2010. Helicobacter pylori exploits host membrane phosphatidylserine for delivery, localization, and pathophysiological action of the CagA oncoprotein. Cell Host Microbe 7:399–411. pmid:20478541
39. Allgood SC, Romero Duenas BP, Noll RR, Pike C, Lein S, Neunuebel MR. 2017. Legionella Effector AnkX Disrupts Host Cell Endocytic Recycling in a Phosphocholination-Dependent Manner. Front Cell Infect Microbiol 7:397. pmid:28944216
40. Mellouk N, Weiner A, Aulner N, Schmitt C, Elbaum M, Shorte SL, Danckaert A, Enninga J. 2014. Shigella subverts the host recycling compartment to rupture its vacuole. Cell Host Microbe 16:517–30. pmid:25299335
41. Gietz RD, Woods RA. 2002. Transformation of yeast by lithium acetate/single-stranded carrier DNA/polyethylene glycol method. Guide to Yeast Genetics and Molecular and Cell Biology, Pt B 350:87–96. pmid:12073338
42. Serbus LR, Landmann F, Bray WM, White PM, Ruybal J, Lokey RS, Debec A, Sullivan W. 2012. A cell-based screen reveals that the albendazole metabolite, albendazole sulfone, targets Wolbachia. PLoS Pathog 8:e1002922. pmid:23028321
43. Rogers SL, Rogers GC, Sharp DJ, Vale RD. 2002. Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J Cell Biol 158:873–84. pmid:12213835
44. Buster DW, Nye J, Klebba JE, Rogers GC. 2010. Preparation of Drosophila S2 cells for light microscopy. J Vis Exp pmid:20543772
45. Verheyen E, Cooley L. 1994. Looking at oogenesis. Methods Cell Biol 44:545–61. pmid:7707970
46. Bassett AR, Tibbit C, Ponting CP, Liu JL. 2013. Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system. Cell Rep 4:220–8. pmid:23827738
47. Newton IL, Sheehan KB. 2015. Passage of Wolbachia pipientis through mutant drosophila melanogaster induces phenotypic and genomic changes. Appl Environ Microbiol 81:1032–7. pmid:25452279
48. Jenett A, Rubin GM, Ngo TT, Shepherd D, Murphy C, Dionne H, Pfeiffer BD, Cavallaro A, Hall D, Jeter J, Iyer N, Fetter D, Hausenfluck JH, Peng H, Trautman ET, Svirskas RR, Myers EW, Iwinski ZR, Aso Y, DePasquale GM, Enos A, Hulamm P, Lam SC, Li HH, Laverty TR, Long F, Qu L, Murphy SD, Rokicki K, Safford T, Shaw K, Simpson JH, Sowell A, Tae S, Yu Y, Zugates CT. 2012. A GAL4-driver line resource for Drosophila neurobiology. Cell Rep 2:991–1001. pmid:23063364
49. Shiga Y, TanakaMatakatsu M, Hayashi S. 1996. A nuclear GFP beta-galactosidase fusion protein as a marker for morphogenesis in living Drosophila. Development Growth & Differentiation 38:99–106.
50. Odenthal J, Brinkkoetter PT. 2019. Drosophila melanogaster and its nephrocytes: A versatile model for glomerular research. Methods Cell Biol 154:217–240. pmid:31493819
51. Stewart BA, Atwood HL, Renger JJ, Wang J, Wu CF. 1994. Improved stability of Drosophila larval neuromuscular preparations in haemolymph-like physiological solutions. J Comp Physiol A 175:179–91. pmid:8071894
52. Soukup SF, Culi J, Gubb D. 2009. Uptake of the necrotic serpin in Drosophila melanogaster via the lipophorin receptor-1. PLoS Genet 5:e1000532. pmid:19557185
53. Lin YH, Currinn H, Pocha SM, Rothnie A, Wassmer T, Knust E. 2015. AP-2-complex-mediated endocytosis of Drosophila Crumbs regulates polarity by antagonizing Stardust. J Cell Sci 128:4538–49. pmid:26527400
54. Spitz D, Comas M, Gerstner L, Kayser S, Helmstadter M, Walz G, Hermle T. 2022. mTOR-Dependent Autophagy Regulates Slit Diaphragm Density in Podocyte-like Drosophila Nephrocytes. Cells 11. pmid:35805186
55. Weavers H, Prieto-Sanchez S, Grawe F, Garcia-Lopez A, Artero R, Wilsch-Brauninger M, Ruiz-Gomez M, Skaer H, Denholm B. 2009. The insect nephrocyte is a podocyte-like cell with a filtration slit diaphragm. Nature 457:322–6. pmid:18971929
About the Authors:
MaryAnn Martin
Roles: Formal analysis, Investigation, Methodology, Visualization, Writing – original draft, Writing – review & editing
Affiliation: Department of Biology, Indiana University, Bloomington, Indiana United States of America
Sergio López-Madrigal
Roles: Methodology, Writing – review & editing
Affiliation: Department of Biology, Indiana University, Bloomington, Indiana United States of America
Irene L. G. Newton
Roles: Data curation, Formal analysis, Funding acquisition, Project administration, Resources, Supervision, Visualization, Writing – original draft, Writing – review & editing
* E-mail: [email protected]
Affiliation: Department of Biology, Indiana University, Bloomington, Indiana United States of America
https://orcid.org/0000-0002-7118-0374
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2024 Martin et al. This is an open access article distributed under the terms of the Creative Commons Attribution License: http://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
The most common intracellular bacterial infection is Wolbachia pipientis, a microbe that manipulates host reproduction and is used in control of insect vectors. Phenotypes induced by Wolbachia have been studied for decades and range from sperm-egg incompatibility to male killing. How Wolbachia alters host biology is less well understood. Previously, we characterized the first Wolbachia effector–WalE1, which encodes an alpha-synuclein domain at the N terminus. Purified WalE1 sediments with and bundles actin and when heterologously expressed in flies, increases Wolbachia titer in the developing oocyte. In this work, we first identify the native expression of WalE1 by Wolbachia infecting both fly cells and whole animals. WalE1 appears as aggregates in the host cell cytosol. We next show that WalE1 co-immunoprecipitates with the host protein Past1, although might not directly interact with it, and that WalE1 manipulates host endocytosis. Yeast expressing WalE1 show deficiency in uptake of FM4-64 dye, and flies harboring mutations in Past1 or overexpressing WalE1 are sensitive to AgNO3, a hallmark of endocytosis defects. We also show that flies expressing WalE1 suffer from endocytosis defects in larval nephrocytes. Finally, we also show that Past1 null flies harbor more Wolbachia overall and in late egg chambers. Our results identify interactions between Wolbachia and a host protein involved in endocytosis and point to yet another important host cell process impinged upon by Wolbachia’s WalE1 effector.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer