1. Introduction
Abscisic acid (ABA) is a key plant hormone that plays a crucial role in regulating growth, development, and stress responses. ABA is intricately involved in various stress-related physiological activities, including the regulation of stomatal closure and osmotic adjustment [1]. The accumulation of ABA is directly related to the drought resistance of different plants, and it is often used as one of the indicators for drought resistance identification [2]. Plants can accurately adjust ABA levels in reaction to both internal and external environmental shifts. This regulation enables the control of various downstream transcription factors (TFs) and other ABA-responsive genes through core signal pathways, thereby fulfilling diverse biological functions [3]. The expression of ABA-responsive genes is tightly regulated by specific TFs and cis-acting elements [4]. Studies have demonstrated that ABA is involved in responding to osmotic stress by inducing TFs such as MYB, AP2/ERF and NAC to bind to cis-acting elements on ABA-responsive genes [5,6,7]. Specifically, GmERF75, members of the AP2/ERF family, have been identified that may have positive regulatory functions in Arabidopsis ABA signaling transduction under stressful conditions [7].
The AP2/ERF TF family is one of the largest TF families in plants, characterized by a conserved AP2 DNA binding domain consisting of 57−66 amino acids [8]. A comprehensive analysis of exon, intron and motif structure across the AP2/ERF family has led to its classification into three primary subfamilies: AP2, ERF and RAV. The AP2 subfamily proteins feature two repeated AP2 domains, the ERF subfamily proteins contain a single AP2 domain, and the RAV subfamily proteins encompass both the AP2 and B3 domains [9,10]. Moreover, the amino acid sequence of the AP2 domain indicates that the AP2 subfamily can be further subdivided into euAP2, euAINTEGUMENTA (euANT) and basalANT [11].
The AP2 TFs in Arabidopsis thaliana are the most extensively studied within the AP2 family, with the first discovered AP2 gene (AP2-1) associated with perianth organs [12]. In addition, the AP2 gene subfamily, which is induced by ABA, played a role in plant defense against both biotic and abiotic stresses. In Arabidopsis thaliana, it has been observed that overexpression of RAP2.6 results in increased sensitivity to exogenous ABA and abiotic stresses during seed germination and early seedling growth [13]. Furthermore, ORA47, an AP2 domain transcription factor in Arabidopsis thaliana, is believed to play a role in the production of jasmonic acid (JA) and ABA, as well as in the regulation of various phytohormone genes involved in response to wounding and water stress [14]. Recently, it has been demonstrated that silencing TaAP2-10 decreases wheat’s ability to resist stripe rust fungus. Additionally, the expression of TaAP2-10 is significantly increased by external factors like ABA [15]. Consequently, AP2 subfamily genes exert a positive or negative influence on plant responses to stress by participating in the synthesis of endogenous ABA or being induced by exogenous ABA. Currently, the AP2 gene subfamily has been investigated and analyzed genome-wide in many plants, including Arabidopsis [16], rice [17], wheat [10], Populus [18], pepper [19] and buckwheat [20], and there is a lack of comprehensive information regarding the AP2 family in sugar beet.
Sugar beet (Beta vulgaris L.; 2n = 18) is a biennial herbaceous plant and a primary sugar crop in China [21], serving as an essential raw material for the food, pharmaceutical, and other industries. Notably, the northeast, northwest, and north China regions where sugar beet cultivation is prevalent, are particularly exposed to drought, cold and other environmental stresses [22], which have become significant constraints on sugar beet production in China [23]. Compared with other crops, sugar beet is very sensitive to drought during the seedling stage [24]. It has been demonstrated that drought stress has a significant impact on the physiological and morphological traits of sugar beet roots, as well as on taproot yield [25]. In our previous research involving strand-specific sequencing of the ABA signaling pathway and its regulatory network in sugar beet, we identified a key gene, BVRB_4g074790 (AP2), involved in the regulation of oxidation reduction and cell wall organization [26]. To further explore the role of AP2 genes in stress tolerance in sugar beet, we conducted a genome-wide identification of the AP2 gene subfamily in sugar beet, and an in-depth analysis of their phylogeny, chromosomal localization, and gene structure and expression patterns in roots under ABA treatment in this study. The findings will contribute to a better understanding of the sugar beet AP2 gene family and lay the foundation for future analysis of the function of desirable genes in sugar beet and, ultimately, for the breeding of improved sugar beet varieties.
2. Materials and Methods
2.1. Identification and Phylogenetic Analysis of BvAP2s in Sugar Beet
The whole genome sequence, protein sequence and gene annotation file (gff3) of Beta vulgaris was downloaded from the Ensembl Plants database (
The protein sequences of the selected AP2 subfamily members from sugar beet, Arabidopsis and spinach were subjected to multiple sequence alignment and uploaded to TBtools software (V1.120) to construct a phylogenetic tree using the neighbor joining (NJ) method [27]. The generated phylogenetic evolutionary tree data were uploaded to iTOL (
2.2. Property Analysis and Subcellular Localization Prediction of BvAP2s
The Expasy online tool (
2.3. Conserved Motifs and Gene Structure of BvAP2s
The exon and intron structure for members of the BvAP2 genes was obtained from the GFF3 annotation file of the sugar beet genome. The online website MEME (
2.4. Chromosome Distribution and Cis-Acting Elements of BvAP2s
The chromosome distribution and potential duplicate gene pairs of the BvAP2s were predicted using TBtools. The upstream sequences (2000 bp) of BvAP2s start codons were extracted, and the cis-acting elements were predicted and visualized using TBtools [27].
2.5. Expression Analysis of BvAP2s under ABA Treatment and Transcriptional Target Gene Network Prediction
Transcriptome data of beetroot under ABA treatment [26] were used to analyze the expression patterns of BvAP2s using the ChiPlot website (
2.6. Plant Materials and ABA Treatment
Sugar beet accession KWS9147 was germinated in vermiculite, and the seedlings were subsequently transferred into Hoagland solution (pH 5.8) for cultivation in a controlled environment chamber (light intensity 300 µmol/(m2·s), a 16/8 h photoperiod, temperature of 24 ± 2 °C and relative humidity of 40 ± 5%). After 4 weeks of growth, treatment with 100 mg/L ABA (approximately 0.38 mmol/L) was conducted. Root samples were collected at 1, 6, 12 and 24 h after treatment, with three replicates in both control (normal conditions) and ABA treatment [26]. Subsequently, all samples were promptly frozen in liquid nitrogen and stored at −80 °C for RNA extraction.
2.7. RNA Extraction and qRT-PCR
Total RNA was extracted using the TRIzol reagent (Tiangen Biotech, Beijing, China, DP424) and reverse transcribed to cDNA. The qRT-PCR was performed using the SuperReal PreMix Plus (SYBR Green) (Tiangen Biotech, Beijing, China, FP205) Fluorescence Quantification Kit in three independent biological replicates and technical replicates. The primers used are described in Table 1, and the endogenous control gene were BvGADPH (BVRB_5g110740) and Bvactin (BVRB_1g005390). The relative expression was analyzed using the 2−ΔΔCt method [29]. One-way anova was used to identify significant differences at p value ≤ 0.05 using Graphpad Prism 9.5.0 software.
3. Results
3.1. Genomic Identification and Phylogenetic Analysis of BvAP2 Genes
The sugar beet BvAP2s gene family was identified at the whole-genome level using the protein functional domain PF00847, resulting in the screening of 13 AP2 proteins, which were subsequently validated in the NCBI-CDD database. AP2 subfamily genes are characterized by more than two AP2 protein domains. As shown in Table 2, the lengths of BvAP2 protein sequences vary from 307aa (BVRB_8g198510) to 715aa (BVRB_4g074790) amino acids. The molecular weight ranges from 34.11 to 77.87 kDa, with isoelectric points ranging from 5.61 to 8.51. All BvAP2s are unstable and prone to degradation. Subcellular localization prediction indicated that most BvAP2s are located in the cytoplasm and nucleus (Table 2). Previous studies demonstrated that both AP2/ERF family members MdSHINE2 and NtERF172 are localized to the nucleus [30,31].
To elucidate the phylogenetic relationships among BvAP2s, we constructed a phylogenetic tree by introducing 30 members of AP2s from Arabidopsis thaliana and 13 members from Spinacia oleracea. As shown in Figure 1, based on the previous classification of AP2 genes [32], we observed that BvAP2s mainly belong to the euAP2, euANT and basalANT groups. Among them, eight BvAP2 genes with the presence of an additional ten amino acid residue motif within the first AP structural domain were recognized as ANT group members; the baselANT group included two members, while the euANT group had six members lacking the aforementioned motif. No BvAP2s were grouped into the same basal branch, which may suggest their structural and functional diversity. In addition, BVRB_6g141950 and Sp 049430 have five and three AP2 structural domains, respectively, and they have not been classified into the above known groups. It is illustrated that AP2 genes sharing similar structural features were accurately clustered into specific subfamilies, which indicated that the AP2 gene family has high homology across different species. Meanwhile, different BvAP2s may play distinct roles in the biological processes of sugar beet.
3.2. Gene Structures and Conserved Motifs of BvAP2s
MEME was used to analyze protein motifs in the 13 AP2 protein sequences in sugar beet (Figure 2A). A total of six conserved motifs were identified and designated motif 1-6, with lengths ranging from 8 to 60 amino acids. Motifs 1, 2, 3 and 5 were found in almost all the members of the AP2 subfamily, indicating their conservation within the BvAP2 subfamily. The types and distribution of motifs were different in BvAP2 genes, but several combined patterns of motifs, such as motif 2-3-1-5, appear frequently. Members within the same subgroup displayed similar motifs, lengths and structures, which suggests functional similarities within each group. The motif arrangements of BvAP2s exhibit certain similarities, yet there are also notable differences between groups; for example, motif 6 was unique to the euANT subfamily.
In order to gain more insights into gene evolution, the exon–intron organization of BvAP2 genes was investigated (Figure 2B). Notably, BVRB_6g141950 exhibited a distinctive profile compared to other BvAP2 members, as revealed by the gene structure analysis. Among the BvAP2 genes, all other 12 members except BVRB_6g141950 contain introns, and the number of exons is 5-9. Admittedly, there are subtle differences in the genetic structure between the subgroups. Most of the euAP2 and euANT genes had eight and nine introns, respectively.
3.3. Cis-Acting Elements in BvAP2s Promoters
Cis-acting elements in promoter regions are crucial for the regulation of gene transcription and abiotic stress response. To elucidate the response of BvAP2s to environmental signals, we analyzed the cis-regulatory elements in the promoters of the BvAP2s. The results showed that there are six known key cis-acting elements in the upstream 2000 bp sequences of BvAP2s’ promoters (Figure 2C). Predominant elements include the abscisic acid responsive element (ABRE), the MYB binding site involved in drought response (MBS), the low-temperature responsive element (LTR), the MYB binding site for flavonoid biosynthesis regulation, the MeJA-responsive element (CGTCA-element), and the TC-rich repeats involved in defense and stress response. ABREs were found in seven BvAP2 gene promoter sequences, including BVRB_2g045840, BVRB_1g014630 and BVRB_4g072290. And we have identified MBS in the promoter sequences of five BvAP2 genes, including BVRB_2g045840, BVRB_6g141950 and BVRB_013350 (Figure 2C). These findings show the vital function of BvAP2s in counteracting environmental stress, especially drought stress.
3.4. Chromosome Localization and Collinearity among BvAP2 Subfamily Genes
The nine BvAP2 genes are unevenly distributed across five sugar beet chromosomes (Figure 3). The 3 genes on chr 6 constitute the largest cluster, while chr1, chr 4, chr 7 and chr 8 each have 1–2 genes. In addition, BVRB_013350, BVRB_2g045840, BVRB_4g096070 and BVRB_7g179610 are located on the scaffold rather than on chromosomes. It is noteworthy that the majority of BvAP2s are distributed in proximity to the chromosome termini.
Gene duplication plays a significant role in gene repetition and evolution. The collinearity analysis of sugar beet genes (Figure 3) revealed a high structural similarity between duplicated pairs of BvAP2s, such as BVRB_1g014630 and BVRB_6g128480.
3.5. Responsive Patterns of BvAP2s under Exogenous ABA Treatment
Crop roots are the first to perceive stressors such as drought and osmotic stress, promptly responding to mitigate their effects [33]. To investigate the potential biological roles of AP2s in beetroot, we analyzed their transcript changes in transcriptome data under ABA treatments (Figure 4). The analysis revealed that after exogenous ABA treatment, the expression patterns of BvAP2s in sugar beet roots varied. Specifically, seven BvAP2s (BVRB_1g014630, BVRB_4g072290, BVRB_4g074790, BVRB_6g128480, BVRB_7g170060 BVRB_7g179610 and BVRB_8g198520) were significantly downregulated, while BVRB_8g191760 showed significant upregulation. Additionally, a subset of BvAP2 genes displayed significantly elevated expression at a specific time point. For instance, BVRB_4g074790 and BVRB_4g096070 demonstrated significantly elevated expression at 1 h post-treatment. In conclusion, members of the BvAP2 gene family are differentially regulated by ABA, suggesting their potential involvement in the ABA signal transduction pathway as TF to modulate the expression of key downstream genes.
3.6. Target Genes Regulated by BvAP2 TFs Involved in ABA Response
Due to the limited number of differentially expressed genes in the early stages of exogenous ABA treatment, we screened sugar beet roots for differential gene expression after 12 h and 24 h of treatment. It identified a total of 105 significantly expressed genes (Table S1). The regulatory network of BvAP2s was mapped in conjunction with the prediction of transcription factor binding sites in the promoter region of the differential expressed genes (2000 bp upstream) using the PlantTFDB database (Figure 5). Our analysis revealed that four BvAP2 TFs (BVRB_4g074790, BVRB_6g128480, BVRB_6g133850 and BVRB_7g179610) regulate 60 of these significantly expressed genes (Table S2). Specifically, BVRB_4g074790 was found to regulate 56 significantly expressed genes, while BVRB_6g128480, BVRB_6g133850 and BVRB_7g179610 regulate 6, 6 and 2 significantly expressed genes, respectively. The downstream-regulated target genes were primarily associated with phytohormone signal transduction, glutathione metabolism and peroxide scavenging metabolic pathways. Previous studies have highlighted the important role of exogenous ABA in improving the antioxidant capacity and drought resistance physiology of maize by enhancing antioxidant enzyme activity and stabilizing the AsA and GSH redox state [34]. The above results indicate that these pathways may play a significant role in the stress response, and that sugar beet BvAP2s may interact with genes involved in ABA signaling and the regulation of reactive oxygen species metabolism, potentially contributing to drought and other stress response processes.
3.7. Expression Profiles of BvAP2 Genes under ABA
Combined with the results of these experiments, a total of three BvAP2s (BVRB_4g074790, BVRB_6g128480 and BVRB_7g179610) were screened for both significant ABA-induced expression and the ability to regulate key downstream genes. To better understand the expression patterns of these three BvAP2s under ABA treatment in sugar beet, we performed quantitative real-time PCR (qRT-PCR) analysis. Our results demonstrated that the expression levels of BVRB_4g074790, BVRB_6g128480 and BVRB_7g179610 were found to be down-regulated by exogenous ABA, with the most pronounced downregulation observed at 24 h. This responsive profile was consistent with the transcriptomic changes, also suggesting that our findings were reliable (Figure 6).
4. Discussion
The growth and development of plants under various environmental stresses are regulated by genetic factors. For example, the response of plants to drought stress involves a complex process governed by numerous genes and signaling pathways [2]. Among these genetic factors, the AP2/ERF gene family has garnered considerable attention due to its diverse functions, including roles in abiotic stress resistance, hormone signal transduction, and the regulation of plant metabolites. The significance of the AP2/ERF transcription factor family is widely acknowledged across many plant species [30]. Recent evidence highlights the novel apple MdSHINE2 transcription factor, which activates the expression of wax-related genes to increase cuticular wax load and deposition. This enhances cuticular wax impermeability and alters surface patterns, thereby enhancing plant sensitivity to ABA and drought tolerance [35]. Sugar beet, as one of the most important sugar crops worldwide, is impacted by various abiotic stresses, including drought, which can affect its growth, development, yield and quality. However, the corresponding molecular response mechanisms remain unknown. Among the various regulatory factors, AP2 appears to play a crucial role in sugar beet’s response to ABA, which is an essential phytohormone playing a key role in root architecture and plant stress responses [26]. Thus, in our study, sugar beet AP2s were genomically identified, and the ABA-induced members were further analyzed using transcriptome data and qRT-PCR.
We identified 13 BvAP2 genes and conducted a comprehensive study of their phylogeny (Figure 1), sequence structure, chromosomal localization (Table 2) and expression patterns under ABA treatment (Figure 4). TFs possess motifs and domains involved in various activities, including protein interaction, transcriptional activity, and DNA binding [36]. Motif analysis revealed six conserved motifs in BvAP2 proteins (Figure 2A). Among them, motifs 1 and 5 constitute one AP2 domain, while motifs 2 and 4 were components of the other AP2 domain. This pattern of BvAP2 proteins is consistent with observations from studies in other species, such as wheat [10]. Promoter cis-acting element analysis is a valuable method for predicting gene function [37]. In this study, we found that BvAP2 promoters contain various motifs associated with plant developmental stages, stress responses and hormone regulation (Figure 2B). For instance, the ABREs (abscisic acid-responsive elements) are widely distributed upstream of seven BvAP2 genes, with five genes containing multiple MBS, including BVRB_2g045840 and BVRB_4g072290. The high abundance and widespread presence of ABRE components suggest an important role in ABA response to abiotic stresses, including cold, drought and salt [38]. ABA is a well-known anti-stress plant hormone that regulates many developmental processes [39]. For instance, the ZmEREB160 gene has been implicated in the ABA signaling pathway to improve drought resistance [40]. Additionally, five BvAP2s have drought-inducible MBS elements, including BVRB_2g045840, BVRB_6g141950 and BVRB_013350. This may imply a relationship and interaction of AP2 TFs and the complex ABA regulatory network.
The root system is the main organ that responds, senses and maintains crop yield under drought conditions [41]. Furthermore, the root system can act as a sensor for water deficit conditions and send signals to shoots above ground [42]. Signaling cascades transmit chemical signals to the shoot, triggering molecular responses that result in biochemical and morphological changes. These changes help plants protect against water loss and withstand stressful conditions [43]. AP2/ERF TFs are essential for plant roots in response to abiotic and biotic stresses and in signaling pathways. ABA serves as an important long-distance trafficking messenger responsible for the perceptions of environmental stimuli and the activation of signaling transduction [44]. Moreover, the AP2/ERFs are indispensable for ABA-dependent stress responses as well. ANT [45], RAP2.6L [46] and RAP2.6 [13] in Arabidopsis are induced in the ABA signaling pathway, increasing its resistance such as drought and salt tolerance. In our study, all tested BvAP2 genes positively respond to ABA treatment (Figure 4). Exogenous ABA treatment resulted in a significant increase in BvAP2 genes expression at the middle (6 h and 12 h) and late (24 h) stages of treatment, compared to the early stage of treatment (1 h). This suggests that maintaining water homeostasis under prolonged drought stress in sugar beet requires more BvAP2 genes expression [47,48]. Specifically, BVRB_1g014630, BVRB_4g074790, BVRB_6g128480, BVRB_7g170060 and BVRB_7g179610 were significantly down-regulated in beetroot, while gene BVRB_8g191760 was significantly up-regulated (Figure 4). The varying degrees of induction of the BvAP2 genes suggest their potential involvement in ABA-dependent signaling pathways under drought stress. This finding aligns with the results of previous studies in pearl millet [49].
To further investigate the characteristics of the BvAP2 genes by ABA application, this study simultaneously screened the other genes significantly expressed in beetroot after ABA treatment (12 and 24 h) and predicted the regulatory relationship of BvAP2s with them. The results suggest that BVRB_4g074790, BVRB_6g128480, BVRB_6g133850 and BVRB_7g179610 may play key roles in regulating of these significantly expressed genes (Figure 5). Among the key downstream genes regulated by BvAP2s, most are associated with ABA-mediated stress responses. For instance, BVRB_6g149900 encodes GEM-like protein 5, a member of the GRAM domain family involved in the ABA signaling pathway [50]. OsABAR1 is a newly discovered protein in rice that contains a unique GRAM structural domain. It enhances the plant’s ability to tolerate drought and salt stress by activating the ABA-dependent pathway. Additionally, when OsABAR1 is overexpressed, rice plants become more responsive to externally applied ABA [51]. Furthermore, BVRB_3g060300 belongs to the LEA gene family. Overexpression of BnaCPK5 enhances drought stress tolerance in oilseed rape, partly by regulating the expression of LEA-like RD29B through phosphorylation of two core ABA signaling components [52]. Abiotic stress and ABA-inducible LEA Group 4 from Brassica napus also plays a key role in salt and drought tolerance [53]. Additionally, BVRB_5g116810 is part of the U-box gene family. Previous studies have shown that U-box 10 negatively regulates abscisic acid response in Arabidopsis [54], while the U-box E3 ubiquitin ligase PalPUB79 positively regulates ABA-dependent drought tolerance via ubiquitinating PalWRKY77 in populus [55]. The significant expression of BvAP2s in beetroot induced by ABA suggested that BvAP2s may participate in stress response, including drought, by regulating downstream key genes and through ABA-dependent pathways.
Transcriptome changes and quantitative RT-PCR (qRT-PCR) can intuitively illustrate the characteristics of BvAP2 genes in sugar beet suffering from ABA treatments. Three BvAP2 genes (BVRB_4g074790, BVRB_6g128480, and BVRB_7g179610) were selected due to their responsiveness to ABA and their involvement in transcription factor regulatory networks. It was found that the down-regulation of gene expression was positively correlated with the increasing duration of ABA treatment. Prior research has shown that AP2/ERFs interrupt ABA signaling, resulting in reduced sensitivity on root growth inhibition and stomata closure, the inhibition of ABA signaling and drought tolerance by ERF18/ORA47 in Arabidopsis thaliana [14]. It can be deduced that these three BvAP2s may be induced by ABA while exerting a negative regulatory effect on abiotic stresses such as drought and may be involved in the regulation of functional genes for signal transduction, compound metabolism, and other processes in response to drought stress in sugar beet.
5. Conclusions
In this study, 13 members of the AP2 gene subfamily were identified from the whole beet genome of sugar beet. These genes exhibited differential responses to ABA treatment. The majority of BvAP2 member promoters contain cis-acting elements of ABA response motifs and drought-inducible elements, and other stress-related elements. Notably, BVRB_4g0 74790, BVRB_6g128480 and BVRB_7g179610 were strongly induced by ABA, and may constitute a complex regulatory network with their downstream target genes, such as GRAMs, LEAs and U-boxes, involved in ABA-mediated stress regulation in sugar beet. This study provided a solid basis for further research on the function of BvAP2s in sugar beet.
Conceptualization, W.X. and Y.Z. (Yan Zhai); methodology, Y.Z. (Yan Zhai) and Y.N.; software, H.W. and Y.Z. (Yuanhang Zhou); validation, Y.Z. (Yan Zhai); formal analysis, Y.Z. (Yan Zhai); data curation, Y.Z. (Yan Zhai); writing—original draft preparation, Y.Z. (Yan Zhai); writing—review and editing, W.X. and Y.Z. (Yan Zhai); visualization, Y.N.; supervision, W.X.; funding acquisition, W.X. All authors have read and agreed to the published version of the manuscript.
This study did not require ethical approval.
Data are contained within the article.
We appreciate the support from the Tianchi Program and Sugar Beet Breeding Research Project.
The authors declare no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1. Phylogenetic tree of AP2 gene subfamily across Arabidopsis thaliana (At), Spinacia oleracea (Sp) and Beta vulgaris (Bv).
Figure 2. Phylogenetic relationships and conserved motifs (A), cis-acting elements (B), and exon/intron structures (C) of BvAP2s. The exons are represented by green rectangles, the introns by yellow rectangles, and the solid lines indicate the positions of the introns. The scale bar indicates the length of the corresponding gene.
Figure 3. Location and collinearity relationships of BvAP2s. The green line represents the gene pairs replicated in tandem.
Figure 4. Heat map illustrating the expression pattern of the BvAP2 gene subfamily in response to ABA treatments.
Figure 5. Regulatory network of BvAP2 TFs and their key target genes induced by exogenous ABA. The brown dots represent genes that are significantly expressed in response to ABA, while the green, blue, red, and purple dots represent BvAP2 transcription factors (TFs) that regulate the aforementioned genes. The size of the dots represents the number of BvAP2-regulated genes, while the thickness of the lines indicates the number of BvAP2-regulated sites in the promoter regions of the significantly expressed genes.
Figure 6. Expression profile of BVRB_4g074790, BVRB_6g128480 and BVRB_7g179610 under ABA treatment by qRT-PCR. Statistically significant differences were determined using Tukey’s test at p-value ≤ 0.05. The greater the number of asterisks, the more significant the change in the relative expression of the gene. The asterisks indicate significant differences compared with control (0 h). The “ns” indicates that the observed difference is not statistically significant. Data were normalized by the BvNADPH and Bvactin gene using the 2−ΔΔCt method.
The primers and sequences for qRT-PCR.
| Gene | Forward Primer (5′→3′) | Reverse Primer (5′→3′) |
|---|---|---|
| BVRB_4g074790 | CGCATTCCCACAAGCTCAAC | CGACCCAGAACTATGCTCCA |
| BVRB_6g128480 | CGGTGGAGATCAATCAGGTGT | CCAATGACAGTAGTAGAAGAGGG |
| BVRB_7g179610 | ATTGCCCTCGGAACACCATT | TGCAGTAGAGAAGACGGGGA |
| BVRB_5g110740 (BvGADPH) | GCTTTGAACGACCACTTCGC | ACGCCGAGAGCAACTTGAAC |
| BVRB_1g005390 (BvActin) | TGCTTGACTCTGGTGATGGT | AGCAAGATCCAAACGGAGAATG |
Genomic information and protein characterization of BvAP2 subfamily genes.
| Gene ID | Number of | Molecular | Isoelectric | Instability | Subcellular |
|---|---|---|---|---|---|
| BVRB_1g014630 | 562 | 61,898.82 | 6.58 | 49.18 | Cytoplasm |
| BVRB_2g045840 | 471 | 51,016.85 | 8.51 | 45.41 | Cytoplasm |
| BVRB_4g072290 | 602 | 65,389.26 | 5.98 | 52.27 | Cytoplasm |
| BVRB_4g074790 | 715 | 77,866.42 | 6.08 | 40.33 | Cytoplasm |
| BVRB_4g096070 | 456 | 51,690.36 | 5.86 | 67.11 | Cytoplasm |
| BVRB_6g128480 | 696 | 77,721.18 | 6.54 | 53.62 | Nucleus |
| BVRB_6g133850 | 542 | 59,922.27 | 6.36 | 45.56 | Cytoplasm |
| BVRB_6g141950 | 677 | 76,121.8 | 7.45 | 43.9 | Nucleus |
| BVRB_7g170060 | 515 | 57,210.08 | 6.03 | 55.59 | Cytoplasm |
| BVRB_7g179610 | 431 | 47,779.66 | 6.18 | 43.45 | Nucleus |
| BVRB_8g191760 | 343 | 39,213.45 | 6.61 | 41.28 | Cytoplasm |
| BVRB_8g198510 | 307 | 34,115.59 | 5.61 | 41.97 | Nucleus |
| BVRB_013350 | 578 | 64,804.72 | 6.33 | 66.04 | Nucleus |
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Chen, K.; Li, G.J.; Bressan, R.A.; Song, C.P.; Zhu, J.K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol.; 2020; 62, pp. 25-54. [DOI: https://dx.doi.org/10.1111/jipb.12899] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31850654]
2. Fang, Y.; Xiong, L. General mechanisms of drought response and their application in drought resistance improvement in plants. Cell. Mol. Life Sci.; 2015; 72, pp. 673-689. [DOI: https://dx.doi.org/10.1007/s00018-014-1767-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25336153]
3. Shinozaki, K.; Yamaguchi-Shinozaki, K.; Seki, M. Regulatory network of gene expression in the drought and cold stress responses. Curr. Opin. Plant Biol.; 2003; 6, pp. 410-417. [DOI: https://dx.doi.org/10.1016/S1369-5266(03)00092-X] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12972040]
4. Vishwakarma, K.; Upadhyay, N.; Kumar, N.; Yadav, G.; Singh, J.; Mishra, R.K.; Kumar, V.; Verma, R.; Upadhyay, R.G.; Pandey, M. et al. Abscisic acid signaling and abiotic stress tolerance in plants: A review on current knowledge and future prospects. Front. Recent Dev. Plant Sci.; 2017; 8, 161. [DOI: https://dx.doi.org/10.3389/fpls.2017.00161] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28265276]
5. Fujita, M.; Fujita, Y.; Maruyama, K.; Seki, M.; Hiratsu, K.; Ohme-Takagi, M.; Tran, L.S.P.; Yamaguchi-Shinozaki, K.; Shinozaki, K. A dehydration-induced NAC protein, RD26, is involved in a novel ABA-dependent stress-signaling pathway. Plant J.; 2004; 39, pp. 863-867. [DOI: https://dx.doi.org/10.1111/j.1365-313X.2004.02171.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15341629]
6. Abe, H.; Urao, T.; Ito, T.; Seki, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. Plant Cell.; 2003; 15, pp. 63-78. [DOI: https://dx.doi.org/10.1105/tpc.006130]
7. Zhao, M.J.; Yin, L.J.; Liu, Y.; Ma, J.; Zheng, J.C.; Lan, J.H.; Fu, J.D.; Chen, M.; Xu, Z.S.; Ma, Y.Z. The ABA-induced soybean ERF transcription factor gene GmERF75 plays a role in enhancing osmotic stress tolerance in Arabidopsis and soybean. BMC Plant Biol.; 2019; 19, 506. [DOI: https://dx.doi.org/10.1186/s12870-019-2066-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31747904]
8. Okamuro, J.K.; Caster, B.; Villarroel, R.; Van Montagu, M.; Jofuku, K.D. The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis. Proc. Natl. Acad. Sci. USA; 1997; 94, pp. 7076-7081. [DOI: https://dx.doi.org/10.1073/pnas.94.13.7076]
9. Fu, W. Genome-Wide Identification and Characterization of the AP2/ERF Gene Family in Quinoa (Chenopodium quinoa) and Their Expression Profiling During Abiotic Stress Conditions. J. Plant Growth Regul.; 2024; 43, pp. 1118-1136. [DOI: https://dx.doi.org/10.1007/s00344-023-11170-1]
10. Zhao, Y.; Ma, R.; Xu, D.; Bi, H.; Xia, Z.; Peng, H. Genome-wide identification and analysis of the AP2 transcription factor gene family in wheat (Triticum aestivum L.). Front. Recent Dev. Plant Sci.; 2019; 10, 1286. [DOI: https://dx.doi.org/10.3389/fpls.2019.01286]
11. Shigyo, M.; Hasebe, M.; Ito, M. Molecular evolution of the AP2 subfamily. Gene; 2006; 366, pp. 256-265. [DOI: https://dx.doi.org/10.1016/j.gene.2005.08.009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16388920]
12. Elliott, R.C.; Betzner, A.S.; Huttner, E.; Oakes, M.P.; Tucker, W.Q.; Gerentes, D.; Perez, P.; Smyth, D.R. AINTEGUMENTA, an APETALA2-like gene of Arabidopsis with pleiotropic roles in ovule development and floral organ growth. Plant Cell.; 1996; 8, pp. 155-168. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/8742707]
13. Zhu, Q.; Zhang, J.; Gao, X.; Tong, J.; Xiao, L.; Li, W.; Zhang, H. The Arabidopsis AP2/ERF transcription factor RAP2. 6 participates in ABA, salt and osmotic stress responses. Gene; 2010; 457, pp. 1-12. [DOI: https://dx.doi.org/10.1016/j.gene.2010.02.011] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20193749]
14. Chen, H.Y.; Hsieh, E.J.; Cheng, M.C.; Chen, C.Y.; Hwang, S.Y.; Lin, T.P. ORA47 (octadecanoid-responsive AP2/ERF-domain transcription factor 47) regulates jasmonic acid and abscisic acid biosynthesis and signaling through binding to a novel cis-element. New Phytol.; 2016; 211, pp. 599-613. [DOI: https://dx.doi.org/10.1111/nph.13914] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26974851]
15. Hu, Z.; Wang, X.; Wei, L.; Wansee, S.; Chen, L.; Kang, Z.; Wang, J. TaAP2-10, an AP2/ERF transcription factor, contributes to wheat resistance against stripe rust. J. Plant Physiol.; 2023; 288, 154078. [DOI: https://dx.doi.org/10.1016/j.jplph.2023.154078] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37657304]
16. Sakuma, Y.; Liu, Q.; Dubouzet, J.G.; Abe, H.; Shinozaki, K.; Yamaguchi-Shinozaki, K. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration-and cold-inducible gene expression. Biochem. Biophys. Res. Commun.; 2002; 290, pp. 998-1009. [DOI: https://dx.doi.org/10.1006/bbrc.2001.6299] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11798174]
17. Rashid, M.; Guangyuan, H.; Guangxiao, Y.; Hussain, J.; Xu, Y. AP2/ERF transcription factor in rice: Genome-wide canvas and syntenic relationships between monocots and eudicots. Evol Bioinform.; 2012; 8, EBO-S9369. [DOI: https://dx.doi.org/10.4137/EBO.S9369] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22807623]
18. Zhuang, J.; Cai, B.; Peng, R.H.; Zhu, B.; Jin, X.F.; Xue, Y.; Gao, F.; Fu, X.Y.; Tian, Y.S.; Zhao, W. et al. Genome-wide analysis of the AP2/ERF gene family in Populus trichocarpa. Biochem. Biophys. Res. Commun.; 2008; 371, pp. 468-474. [DOI: https://dx.doi.org/10.1016/j.bbrc.2008.04.087] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/18442469]
19. Jin, J.H.; Wang, M.; Zhang, H.X.; Khan, A.; Wei, A.M.; Luo, D.X.; Gong, Z.H. Genome-wide identification of the AP2/ERF transcription factor family in pepper (Capsicum annuum L.). Genome; 2008; 61, pp. 663-674. [DOI: https://dx.doi.org/10.1139/gen-2018-0036]
20. Liu, M.; Sun, W.; Ma, Z.; Zheng, T.; Huang, L.; Wu, Q.; Tang, Z.Z.; Bu, T.L.; Li, C.L.; Chen, H. Genome-wide investigation of the AP2/ERF gene family in tartary buckwheat (Fagopyum Tataricum). BMC Plant Biol.; 2019; 19, 84. [DOI: https://dx.doi.org/10.1186/s12870-019-1951-3]
21. Liu, H.; Wang, Q.; Yu, M.; Zhang, Y.; Wu, Y.; Zhang, H. Transgenic salt-tolerant sugar beet (Beta vulgaris L.) constitutively expressing an Arabidopsis thaliana vacuolar Na+/H+ antiporter gene, AtNHX3, accumulates more soluble sugar but less salt in storage roots. Plant Cell Environ.; 2008; 31, pp. 1325-1334. [DOI: https://dx.doi.org/10.1111/j.1365-3040.2008.01838.x]
22. Chen, Y.; Li, Z.; Fan, Y.; Wang, H.; Deng, H. Progress and prospects of climate change impacts on hydrology in the arid region of northwest China. Environ. Res.; 2015; 139, pp. 11-19. [DOI: https://dx.doi.org/10.1016/j.envres.2014.12.029] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25682220]
23. Wu, G.Q.; Liang, N.; Feng, R.J.; Zhang, J.J. Evaluation of salinity tolerance in seedlings of sugar beet (Beta vulgaris L.) cultivars using proline, soluble sugars and cation accumulation criteria. Acta Physiol. Plant.; 2013; 35, pp. 2665-2674. [DOI: https://dx.doi.org/10.1007/s11738-013-1298-6]
24. Wu, G.Q.; Wang, C.M.; Su, Y.Y.; Zhang, J.J.; Feng, R.J.; Liang, N. Assessment of drought tolerance in seedlings of sugar beet (Beta vulgaris L.) cultivars using inorganic and organic solutes accumulation criteria. Soil Sci. Plant Nutr.; 2014; 60, pp. 565-576. [DOI: https://dx.doi.org/10.1080/00380768.2014.921579]
25. Moosavi, S.G.R.; Ramazani, S.H.R.; Hemayati, S.S.; Gholizade, H. Effect of drought stress on root yield and some morpho-physiological traits in different genotypes of sugar beet (Beta vulgaris L.). J. Crop Sci. Biotechnol.; 2017; 20, pp. 167-174. [DOI: https://dx.doi.org/10.1007/s12892-017-0009-0]
26. Xing, W.; Pi, Z.; Liu, J.; Li, X.C.; Zou, Y.; Wang, M.Q.; Liu, D.L.; Wang, Q.H.; Wu, Z.D. Comparative transcriptome analysis reveals an ABA-responsive regulation network associated with cell wall organization and oxidation reduction in sugar beet. Plant Growth Regul.; 2020; 91, pp. 127-141. [DOI: https://dx.doi.org/10.1007/s10725-020-00592-6]
27. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant.; 2020; 13, pp. 1194-1202. [DOI: https://dx.doi.org/10.1016/j.molp.2020.06.009] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32585190]
28. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Analysis Tools on the ExPASy Server 571 571 from: The Proteomics Protocols Handbook Protein Identification and Analysis Tools on the ExPASy Server 2005. Available online: http://www.expasy.org/tools/ (accessed on 22 September 2023).
29. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods; 2001; 25, pp. 402-408. [DOI: https://dx.doi.org/10.1006/meth.2001.1262]
30. Guo, Z.; He, L.; Sun, X.; Li, C.; Su, J.; Zhou, H.; Liu, X. Genome-Wide analysis of the Rhododendron AP2/ERF gene family: Identification and expression profiles in response to cold, salt and drought stress. Plants; 2023; 12, 994. [DOI: https://dx.doi.org/10.3390/plants12050994]
31. Zhao, Q.; Hu, R.S.; Liu, D.; Liu, X.; Wang, J.; Xiang, X.H.; Li, Y.Y. The AP2 transcription factor NtERF172 confers drought resistance by modifying NtCAT. Plant Biotechnol. J.; 2020; 18, pp. 2444-2455. [DOI: https://dx.doi.org/10.1111/pbi.13419]
32. Yang, Z.; Jin, H.; Chen, J.; Li, C.; Wang, J.; Luo, J.; Wang, Z. Identification and Analysis of the AP2 Subfamily Transcription Factors in the Pecan (Carya illinoinensis). Int. J. Mol. Sci.; 2021; 22, 13568. [DOI: https://dx.doi.org/10.3390/ijms222413568] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34948359]
33. Kang, J.; Peng, Y.; Xu, W. Crop root responses to drought stress: Molecular mechanisms, nutrient regulations, and interactions with microorganisms in the rhizosphere. Int. J. Mol. Sci.; 2022; 23, 9310. [DOI: https://dx.doi.org/10.3390/ijms23169310] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36012575]
34. Jiang, Z.; Zhu, H.; Zhu, H.; Tao, Y.; Liu, C.; Liu, J.; Yang, F.; Li, M. Exogenous ABA enhances the antioxidant defense system of maize by regulating the AsA-GSH cycle under drought stress. Sustainability; 2022; 14, 3071. [DOI: https://dx.doi.org/10.3390/su14053071]
35. Zhang, Y.L.; Zhang, C.L.; Wang, G.L.; Wang, Y.X.; Qi, C.H.; You, C.X.; Zhang, Y.Y.; Hao, Y.J. Apple AP2/EREBP transcription factor MdSHINE2 confers drought resistance by regulating wax biosynthesis. Planta; 2019; 249, pp. 1627-1643. [DOI: https://dx.doi.org/10.1007/s00425-019-03115-4] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30826884]
36. Liu, L.; White, M.J.; MacRae, T.H. Transcription factors and their genes in higher plants: Functional domains, evolution and regulation. Eur. J. Biochem.; 1999; 262, pp. 247-257. [DOI: https://dx.doi.org/10.1046/j.1432-1327.1999.00349.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/10336605]
37. Ma, J.Q.; Jian, H.J.; Yang, B.; Lu, K.; Zhang, A.X.; Liu, P.; Li, J.N. Genome-wide analysis and expression profiling of the GRF gene family in oilseed rape (Brassica napus L.). Gene; 2017; 620, pp. 36-45. [DOI: https://dx.doi.org/10.1016/j.gene.2017.03.030]
38. Narusaka, Y.; Nakashima, K.; Shinwari, Z.K.; Sakuma, Y.; Furihata, T.; Abe, H.; Narusaka, M.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Interaction between two cis-acting elements, ABRE and DRE, in ABA-dependent expression of Arabidopsis rd29A gene in response to dehydration and high-salinity stresses. Plant J.; 2003; 34, pp. 137-148. [DOI: https://dx.doi.org/10.1046/j.1365-313X.2003.01708.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12694590]
39. Prakash, V.; Singh, V.P.; Tripathi, D.K.; Sharma, S.; Corpas, F.J. Crosstalk between nitric oxide (NO) and abscisic acid (ABA) signalling molecules in higher plants. Environ. Exp. Bot.; 2019; 161, pp. 41-49. [DOI: https://dx.doi.org/10.1016/j.envexpbot.2018.10.033]
40. Liu, W.P.; Zhao, B.G.; Chao, Q.; Wang, B.C.; Zhang, Q.; Zhang, C.X.; Li, S.F.; Jin, F.X.; Yang, D.G.; Li, X. The maize AP2/EREBP transcription factor ZmEREB160 enhances drought tolerance in Arabidopsis. Trop. Plant Biol.; 2020; 13, pp. 251-261. [DOI: https://dx.doi.org/10.1007/s12042-020-09259-y]
41. Boyer, J.S. Advances in drought tolerance in plants. Adv. Agron.; 1996; 56, pp. 187-218.
42. Janiak, A.; Kwaśniewski, M.; Szarejko, I. Gene expression regulation in roots under drought. J. Exp. Bot.; 2016; 67, pp. 1003-1014. [DOI: https://dx.doi.org/10.1093/jxb/erv512] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26663562]
43. Hamanishi, E.T.; Campbell, M.M. Genome-wide responses to drought in forest trees. Forestry; 2011; 84, pp. 273-283. [DOI: https://dx.doi.org/10.1093/forestry/cpr012]
44. Waadt, R.; Seller, C.A.; Hsu, P.K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol.; 2022; 23, pp. 680-694. [DOI: https://dx.doi.org/10.1038/s41580-022-00479-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35513717]
45. Meng, L.S.; Wang, Z.B.; Yao, S.Q.; Liu, A. The ARF2–ANT–COR15A gene cascade regulates ABA-signaling-mediated resistance of large seeds to drought in Arabidopsis. J. Cell Sci.; 2015; 128, pp. 3922-3932. [DOI: https://dx.doi.org/10.1242/jcs.171207]
46. Liu, P.; Sun, F.; Gao, R.; Dong, H. RAP2. 6L overexpression delays waterlogging induced premature senescence by increasing stomatal closure more than antioxidant enzyme activity. Plant Mol. Biol.; 2012; 79, pp. 609-622. [DOI: https://dx.doi.org/10.1007/s11103-012-9936-8]
47. Yang, S.D.; Guo, D.; Pei, M.; Liu, H.; Wei, T.; Yu, Y.H. Identification of grapevine AQP family and prediction for transcriptional regulatory network under drought stress. J. Fruit Sci.; 2021; 38, pp. 1638-1652.
48. Yu, J.; Sun, H.; Zhang, J.; Hou, Y.; Zhang, T.; Kang, J.; Wang, Z.; Yang, Q.C.; Long, R. Analysis of aldo–keto reductase gene family and their responses to salt, drought, and abscisic acid stresses in Medicago truncatula. Int. J. Mol. Sci.; 2020; 21, 754. [DOI: https://dx.doi.org/10.3390/ijms21030754]
49. Xu, L.; Lan, Y.; Lin, M.; Zhou, H.; Ying, S.; Chen, M. Genome-Wide Identification and Transcriptional Analysis of AP2/ERF Gene Family in Pearl Millet (Pennisetum glaucum). Int. J. Mol. Sci.; 2024; 25, 2470. [DOI: https://dx.doi.org/10.3390/ijms25052470] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38473718]
50. Mauri, N.; Fernández-Marcos, M.; Costas, C.; Desvoyes, B.; Pichel, A.; Caro, E.; Gutierrez, C. GEM, a member of the GRAM domain family of proteins, is part of the ABA signaling pathway. Sci. Rep.; 2016; 6, 22660. [DOI: https://dx.doi.org/10.1038/srep22660]
51. Zheng, C.; Zhou, J.; Zhang, F.; Yin, J.; Zhou, G.; Li, Y.; Chen, F.; Xie, X. OsABAR1, a novel GRAM domain-containing protein, confers drought and salt tolerance via an ABA-dependent pathway in rice. Plant Physiol. Biochem.; 2020; 152, pp. 138-146.
52. Cheng, H.; Pan, G.; Zhou, N.; Zhai, Z.; Yang, L.; Zhu, H.; Cui, X.; Zhao, P.; Zhang, H.; Li, S. et al. Calcium-dependent Protein Kinase 5 (CPK5) positively modulates drought tolerance through phosphorylating ABA-Responsive Element Binding Factors in oilseed rape (Brassica napus L.). Plant Sci.; 2022; 315, 111125. [DOI: https://dx.doi.org/10.1016/j.plantsci.2021.111125] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35067297]
53. Dalal, M.; Tayal, D.; Chinnusamy, V.; Bansal, K.C. Abiotic stress and ABA-inducible Group 4 LEA from Brassica napus plays a key role in salt and drought tolerance. J. Biotechnol.; 2009; 139, pp. 137-145. [DOI: https://dx.doi.org/10.1016/j.jbiotec.2008.09.014] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19014980]
54. Seo, J.S.; Zhao, P.; Jung, C.; Chua, N.H. PLANT U-BOX PROTEIN 10 negatively regulates abscisic acid response in Arabidopsis. Appl. Biol. Chem.; 2019; 62, 39. [DOI: https://dx.doi.org/10.1186/s13765-019-0446-0]
55. Tong, S.; Chen, N.; Wang, D.; Ai, F.; Liu, B.; Ren, L.; Chen, Y.; Zhang, J.; Lou, S.; Liu, H. et al. The U-box E3 ubiquitin ligase PalPUB79 positively regulates ABA-dependent drought tolerance via ubiquitination of PalWRKY77 in Populus. Plant Biotechnol. J.; 2021; 19, pp. 2561-2575. [DOI: https://dx.doi.org/10.1111/pbi.13681] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34382303]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
APETALA2 (AP2) belongs to transcription factor (TF) families, with crucial roles in regulating plant growth, development, and stress responses. In order to explore the characteristics of sugar beet (Beta vulgaris L.) AP2s (BvAP2s) in response to drought stress hormone abscisic acid (ABA), genome-wide identification, and the phylogeny, gene structure and promoter precursor analysis of the BvAP2s were employed to predict their potential functions. It is shown that there are a total of 13 BvAP2 genes in the Beta vulgaris. Based on the primary amino acid sequence, the BvAP2s can be further subdivided into euAP2, euANT and basalANT. In addition, cis-acting element analysis showed that BvAP2s contained several abiotic stress-related elements, including those associated with ABA and drought stress. Roots are the first to perceive stress signals, and ABA-treated beetroot transcriptome and downstream gene prediction of BvAP2s revealed that BVRB_4g074790, BVRB_6g128480 and BVRB_7g179610 may play an important role involved in ABA signaling pathways during the stress response by regulating downstream GRAM genes, LEAs and U-boxes. Additionally, quantitative real-time polymerase chain reaction (qRT-PCR) further confirmed the downregulation of these three BvAP2s in response to ABA induction in sugar beet roots. These findings provide a basis for future utilization of BvAP2s in developing drought-tolerant Beta vulgaris varieties.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 National Beet Medium-Term Gene Bank, Heilongjiang University, Harbin 150080, China;
2 Manas Agricultural Experimental Station, Xinjiang Academy of Agricultural Sciences, Changji 832200, China;




