Species Identification of Totoaba (Totoaba macdonaldi) From Swim Bladders by Real-Time Fluorescence-Based Recombinase-Aided Amplification

Abstract

The increased illegal fishing to supply swim bladders is the current threat to the Totoaba macdonaldi, due to the high commercial value of swim bladders. Species identification is the foundation of the endangered animal protection. Limited by the sophisticated thermal cycling, specialized machine, and sequencing costs, DNA barcoding might not better satisfy the needs of on-site inspection to the efficiency, convenience, and low cost, although it has reliable results and has been widely used. It is necessary to establish a convenient, rapid, sensitive, and accurate method for customs to inspect the swim bladders in legal or illegal trade on site. In this study, we introduce real-time fluorescence-based recombinase-aided amplification (RF-RAA) into species identification of swim bladders. Specific primers and probes targeted to Totoaba macdonaldi were designed and the reaction temperature and time were screened. It was applied to the forensic identification of swim bladders confiscated by custom after its sensitivity and specificity were verified. The results showed that (1) the primers of TMcytB F1 and TMcytB R3 targeted to the Cytb had a good amplification at 39°C, 30 cycles (15 min) with good repeatability and stability; (2) the method had good specificity and no cross-reaction with other 22 swim bladder originated species; (3) the lowest detectable limit (LDL) of this method was 3.7 × 10¹ copies/μL; (4) about 1.836 kg of all the swim bladders confiscated by Shenzhen customs on 2022 were identified to be Totoaba macdonaldi by using this method. This study provides an effective species identification alternative for competent authorities to tackle the illegal import and market regulation of totoaba swim bladders.

This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

1. Introduction

Swim bladder, commonly referred to as “maw,” is a dried fishery product, characterized by high protein and low lipid contents and full of mineral elements [1], popularized in Southeast Asia and China [2] where it was believed by some to have medicinal properties and widely used as tonic food to improve brain function, treat insomnia and dizziness, and support postnatal recovery [3, 4]. As one of the four traditional top luxury and high-priced dried seafood in China [5, 6], it also has been used for gifting or for investment and auction, recently as a beauty product for its collagen content [7, 8]. In the Chinese maw market, the top swim bladder originated from the Chinese bahaba (Bahaba taipingensis); however, the totoaba (Totoaba macdonaldi) swim bladder was considered to be a substitute in terms of their similar morphology and scarcity, after the commercial fishing ban on Chinese bahaba. Both the Bahaba taipingensis and Totoaba macdonaldi (Figure 1) have some similar characteristics as follows: (1) belong to croakers (Sciaenidae); (2) the largest fish of its family [3, 9]; (3) have very limited geographic distributions (the area from the Yangtza River southwards to Hong Kong, China [10, 11] and the Gulf of California, Mexico [9], respectively); (4) seasonal migrating and aggregation spawning [12, 13]; (5) classified as endangered or protected species by its own government. In this study, we pay attention to the Totoaba macdonaldi, which was reclassified as vulnerable by the International Union for Conservation of Nature (IUCN) in 2021 [14, 15] and listed in the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES) Appendix I in 1976.

[figure(s) omitted; refer to PDF]

The reasons for the drastic reduction in the catch and stock of this demersal, migratory, and endemic species are complicated. This species sustained an important commercial fishery from 1924 to 1975 with catches exceeding 2100 mt (t) annually in the 1940s. Some intrinsic characteristics of Totoaba macdonaldi, such as long-lived, late-maturing, predictable spawning behavior in a relatively small area, make it particularly susceptible to overfishing. Overfishing (legal) was the most likely cause of the Totoaba macdonaldi collapse until 1958 [16–18]. Loss of spawning and nursery habitat caused by lack/reduced Colorado River flows induced by the construction of the Hoover and Glenn Canyon dams in 1935 and 1963, respectively, have been recurrently proposed as the main factors in the collapse [9, 16]. After the fishing ban was implemented in 1975 to reduce pressure on the totoaba, adult poaching and juvenile by-catch by the shrimp fishery may have contributed to low abundances of the totoaba stock [9]. Recent researches found that the Pacific decadal temperature oscillation was associated with the catch history which suggested the role of climate change in the decline of the totoaba population [19]. The current threat is increased illegal fishing to supply swim bladders that are in high demand in the black Chinese market [20, 21]. The totoaba swim bladders exported to China as a delicacy started in the 1920s. In the early 2010s, the swim bladder trade reemerged, with Chinese traders willing to pay extremely high prices (can achieve US$ 5,000 or more per kilogram, ex-vessel price) for dried totoaba swim bladders [22] due to its large size as well as unique resemblance to that of a China endemic, the critically endangered Bahaba taipingensis [4] which fished to the verge of extinction for the swim bladder market [13]. A secondary threat to the population could be a by-catch of juveniles in the industrial shrimp trawl fishery, and juveniles with lengths of 30–40 cm are most vulnerable [14, 15]. Now, the same situation may appear in some species of croakers and noncroakers [4], for example, at least one species of Boesemania [23], Protonibea diacanthus [24], Sciades parkeri [25], and Pangasianodon hypophthalmus [26]. The state of these illegally overfished species for swim bladders needs to be concerned, and the technology of species identification from swim bladders is very important and worth further development, especially for the endangered fish species.

Although fishing and international trade in totoaba swim bladders have been illegal for many years under Mexican and Chinese national laws as well as international law (CITES Appendix I), the enforcement efforts have been ineffective. Annual average seizures of illegal totoaba swim bladders have increased by five-fold from just over 500 per year in 2013–2017 to over 2300 per year in 2018–2020 [27]. Nonetheless, almost all these seizures were the result of random inspections, these numbers represent only a portion of the illegal trade, which is inferred to be underestimated. While Mexican enforcement agencies have regularly confiscated large consignments of totoaba swim bladders, there is no evidence that the seizures have led to the dismantling of criminal networks that organize the illegal fishing and trade. At the same time, the enforcement efforts in China have been stepped up, and tackling the illegal import of totoaba swim bladders has become a priority for the China Customs Anti-Smuggling Bureau. A series of seizures and arrests have been made since 2018, and some of the crime syndicates have been dismantled. In December 2018, China Customs arrested 16 suspects and confiscated 444 kg of totoaba swim bladders, valued at RMB182 million, and the first Chinese conviction for totoaba swim bladders trafficking was announced by Shanghai judicial authorities, with two defendants sentenced to jail terms of 8 and 7 years and fined RMB200,000 and RMB100,000, respectively [28]. There is no doubt that the supervision of the international trade in totoaba swim bladders needs the efforts and cooperation from the both sides, one should control the illegal fishing to reduce the supply, and the other must enhance the import inspection and market supervision. As for China Customs, there are some difficulties in cracking down on totoaba swim bladder smuggling. (1) The maw trade (legal and illegal) becomes global for its huge value; (2) Hong Kong as a global hub for dried seafood is facilitated for swim bladders to enter into the mainland China; (3) over 100 countries have supplied swim bladders in recent years, the number and category of swim bladders are very huge and diverse; (4) similarities in morphology among some categories and inconsistent matches between the species and categories [4]. So officials urgently need a real-time identification to the species of swim bladders both in legal or illegal trade on-site, and the detection they used must be convenient, rapid, sensitive, accurate, and specific; then, they can promote the inspection efficiency and reinforce the strike on swim bladder smuggling when the resource were limited.

Recombinase-aided amplification (RAA) is a simple, rapid, sensitive, and specific nucleic acid amplification conducted at the constant temperature (37°C–42°C) rather than sophisticated thermal cycling compared to a polymerase chain reaction (PCR), with no requirement for a relatively expensive, highly specialized machine [29]. This technology has been widely used in diagnosis and medical treatment, the food industry, agriculture, analysis and detection, and other fields through the integration of this technology into real-time monitoring, microfluidic chips, and lateral flow dipsticks [30, 31]. Especially, integrated with portable devices, this technology is more suitable for nucleic acid detection on-site [32]. Real-time fluorescence-based recombinase-aided amplification (RF-RAA) adds a fluorescence-labeled probe into RAA and has a short reaction time and clear results for qualitative and quantitative detection compared with conventional PCR [33].

Although DNA barcoding has been widely used for species identification, it might not better satisfy the practice needs for efficiency, convenience, and lower cost, because of the sophisticated thermal cycling, specialized machine, and sequencing. There was already a report about an on-spot identification method for Deinagkistrodon acutu, using recombinase polymerase amplification (RPA) assay with rapid DNA extraction [34]. Based on those, this study tried to introduce and apply the RAA into species identification of totoaba swim bladders, wishing to contribute to the resolve of endangered animal protection, even food fraud. Specific primers and probes of Totoaba macdonaldi targeted to mitochondrial cytochrome c oxidase Subunit I (COI) and cytochrome b (Cytb) were designed, and the reaction temperature and time were screened. The method established in this study was applied into the forensic identification of swim bladders confiscated by Shenzhen custom after its sensitivity and specificity were verified, which could serve as an effective species identification alternative for competent authorities to tackle illegal import and market regulation of totoaba swim bladders.

2. Materials and Methods

2.1. Material Collection and DNA Extraction

Prior to this study, we have identified 22 originated species in 7 families from 138 swim bladders by DNA boarding from 2020 to 2023, all the swim bladders were dry products (whole or part) and came from the retail market in mainland China or the seizures of the Shenzhen Customs. The tissue sample of Bahaba taipingensis was donated by Dongguan Natural Reserve of Bahaba taipingensis. All the samples were conserved by the Animal & Plant Inspection and Quarantine Technology Center of Shenzhen Customs (Guangdong Peng Hai Forensic Science Institute). In this study, the DNA of 23 samples representing 23 originated species were extracted by the kit (DNeasy Blood &Tissue kit, QIAGEN Co., Ltd., GER), respectively. The DNA of Totoaba macdonaldi (H20220001) was used as a template in the following tests.

2.2. Primer and Probe Design

Based on the mitochondrial sequences of Totoaba macdonaldi recorded in GenBank (NC_082752.1), we selected the species which have higher similarity (≥88%) for BLAST comparison, then six pairs of primers and two probes targeted to the COI and Cytb were designed, respectively, focusing on the regions with high variability and referring to the principle of RAA primer design. All the primers and probes were synthesized by Sangon Biotech Co., Ltd. (Shanghai China) (Table 1).

Table 1

Primer and probe for RF-RAA.

Primer name	Primer sequences (5${}^{\prime }$-3${}^{\prime }$)
TMcytB P	gtttgtgatgacggtggcccctcagaatga(dT-HEX)a(THF)c(dT-BHQ1)ggccccaggggagga(C3 space)
TMcytB F1	ctcagattcattgaactagggtgttgccgat
TMcytB F2	cattgaactagggtgttgccgatgtagggt
TMcytB F3	agggtgttgccgatgtagggtacggcggac
TMcytB R1	ctcttccttttagtaatgataactgccttc
TMcytB R2	ttagtaatgataactgccttcgttggctat
TMcytB R3	atcggagtcgtcctcttccttttagtaatg
TMCOI P	ccgctcgctgggaacctcgcacacgcagg(dT-Fam)g(THF)c(dT-BHQ1)ccgtcgacttagccatc(C3 space)
TMCOI F1	cgggagccgggacagggtgaacagtttacc
TMCOI F2	agtagaggcgggagccgggacagggtgaac
TMCOI F3	aacctcttcaggagtagaggcgggagccgg
TMCOI R1	attgatgaaacacctgcgagatgcagagaa
TMCOI R2	ctagaattgatgaaacacctgcgagatgca
TMCOI R3	acagctcatacgaataaaggcgtttgatat

Note: F, upstream; R, downstream; P, Raa-Exo probe; TMcytB, primer for Cytb; TMcoI, primer for COI.

2.3. RF-RAA Reaction System

Following the instruction of the kit (Hangzhou ZC Bio-Sci&Tech Co., Ltd., CN), a buffer, 25 μL; primers (10 μM), 2 μL each; probe (10 μM), 0.6 μL; template, 1 μL and purified water 16.9 μL were prepared into the reaction tube after mixing, and 2.5 μL of B buffer was added and then tightly covered and instantaneously centrifuged before reaction. The reaction was implemented for 15 min (30 cycles) at 39°C by using QuantStudio™ 3 Real-Time PCR System (Thermo Co., Ltd., USA). The primers and probes were selected by detecting the fluorescence signals and reaction time through the amplification of the template (H20220001) in this reaction system.

2.4. Optimize the RF-RAA Reaction Conditions

The selected primers were diluted to 5, 10, and 20 μmol and reacted under the aforementioned RF-RAA reaction system. The priority concentration of primers was confirmed through the fluorescence signal and amplification curve. In the following experiments with the optimal concentration of primer, the reaction was carried out at 37, 39, and 42°C about 15 min (30 cycles), respectively. The best reaction temperature was based on the strong fluorescence signals that appeared within the shortest reaction time.

2.5. Specificity Verification of RF-RAA

Using optimized reaction conditions, 23 samples conserved by ourselves were used to verify the specificity of this method, including the positive template (H20220001) (Table 2).

Table 2

Reported source species of swim bladder and species for RF-RAA specificity test.

Reported source species	Classification (family)	Specificity test	Specificity test results
Lates niloticus	Latidae	√	—
Lates calcarifer	Latidae	√	—
Cynoscion acoupa	Sciaenidae	√	—
Cynoscion reticulatus	Sciaenidae	√	—
Cynoscion praedatorius	Sciaenidae	√	—
Cynoscion virescens	Sciaenidae	√	—
Boesemania microlepis	Sciaenidae	√	—
Panna microdon	Sciaenidae	√	—
Macrodon ancylodon	Sciaenidae	/	/
Cynoscion parvipinnis	Sciaenidae	/	/
Pseudotolithus brachygnathus	Sciaenidae	√	—
Otolithoides biauritus	Sciaenidae	√	—
Megalonibea fusca	Sciaenidae	√	—
Nibea coibor	Sciaenidae	√	—
Protonibea diacanthus	Sciaenidae	√	—
Nibea squamosa	Sciaenidae	√	—
Larimichthys crocea	Sciaenidae	/	/
Larimichthys polyactis	Sciaenidae	/	/
Pennahia argentata	Sciaenidae	/	/
Leptomelanosoma indicum	Polynemidae	√	—
Galeoides decadactylus	Polynemidae	/	/
Gadus morhua	Gadidae	√	—
Gadus macrocephalus	Gadidae	√	—
Brotula clarkae	Ophidiidae	√	—
Brotula barbata	Ophidiidae	√	—
Congresox talabonoides	Muraenesocidae	√	—
Conger myriaster	Congridae	/	/
Centropomus viridis	Centropomidae	√	—
Sciades parkeri	Ariidae	/	/
Sciades proops	Ariidae	/	/
Hemiarius dioctes	Ariidae	/	/
Bahaba taipingensis	Sciaenidae	√	—
Totoaba macdonaldi (H20220001)	Sciaenidae	√	+

Note: √, the species chosen for specificity verification; −, negative; +, positive.

2.6. Construction of Standard Plasmid

The fragment of Cytb we chose in this study was synthesized and ligated to pUC57 plasmid by Sangon Biotech Co., Ltd. (Shanghai China). Plasmid concentration was tested by Qubit™ 4 Fluorometer (Thermo Co., Ltd., SG), and the copy number was calculated following Moore’s law. Plasmid copy $\text{number}\text{copies}/\mu \text{L}=\text{plasmid}\text{concentration}\text{g}/\mu \text{L}\times 6.02\times {10}^{23}/\text{total}\text{fragment}\text{length}\text{bp}\times 660\text{g}/\text{mol}$; $\text{total}\text{fragment}\text{length}=\text{vector}\text{length}\text{bp}+\text{fragment}\text{length}\text{bp}$.

2.7. Sensitivity Verification of RF-RAA

The constructed plasmid was diluted to 10⁰–10⁵ copies/μL and reacted under the optimized reaction conditions; meanwhile, the negative control was set up and observed to have the lowest detectable limit (LDL).

2.8. Repeatability Verification of RF-RAA

The plasmid at different concentrations (10⁶, 10⁴, and 10² copies/μL) were selected to replicate under the optimized reaction conditions, and each concentration was repeated for 3 times. The coefficient of variation (CV) within the group and between groups was calculated to evaluate the repeatability and stability of this method.

2.9. Test and Verify

In practice, we used this method to identify the swim bladders, which were confiscated by customs, market regulatory authority, and other authorized agencies; the results were verified by DNA barcoding at the same time.

3. Result

3.1. Primer and Probe Design

Based on the results, the fluorescence signal had been detected at 6 cycles (3 min) by the primers of TMcytB F1 and TMcytB R3 targeted to the Cytb, and they had a better amplification in the following reaction time compared to others (Figure 2). All the pairs of primers targeted to the COI had detected fluorescence signal, however, with longer reaction time or poor performance of amplification (Figure 3). The primers of TMcytB F1 and TMcytB R3 were chosen in the following RF-RAA. TMcytB F1: ctcagattcattgaactagggtgttgccgat; TMcytB R3: atcggagtcgtcctcttccttttagtaatg.

[figure(s) omitted; refer to PDF]

3.2. Optional Reaction Conditions of RF-RAA

All three dilutions of TMcytB F1 and TMcytB R3 have detected the fluorescence signal at the same time. Although the strongest fluorescence signal was tested when the primers were at 20 μM, the signal went down after 10 min, and the amplification curve is unperfected. The perfected “S” type of amplification curve was obtained when the primers were at 10 μM, with a stronger fluorescence signal and relatively short reaction time. The following temperature test results showed the highest fluorescence signal with the lowest reaction time at 37°C; however, the fastest reaction time with the weakest fluorescence signal at 42°C. Therefore, 39°C was chosen as the best temperature. The final optional conditions are as follows: 10 μM primers, 39°C, and 30 cycles (15 min).

3.3. Specificity of RF-RAA

The results (Figure 4) showed that there were no fluorescence curves in the other 22 samples (Table 2), proving the good specificity of this RF-RAA.

[figure(s) omitted; refer to PDF]

3.4. Sensitivity of RF-RAA

The concentration of the constructed plasmid was $3.7\times {10}^8$ copies/μL, and the LDL was $3.7\times {10}^1$ copies/μL (Figure 5); results indicated that the sensitivity of this RF-RAA had higher sensitivity and been suitable for practice.

[figure(s) omitted; refer to PDF]

3.5. Repeatability of RF-RAA

All the CVs were under 5% for intragroup and intergroup replication (Table 3), showing that the RF-RAA assay had good repeatability and stability.

Table 3

Plasmid repeatability test.

Concentration (copies/uL)	Intragroup average value ± standard deviation	CV%	Intergroup average value ± standard deviation	CV%
$$3.7\times {10}^6$$	$$4.152\pm 0.02$$	0.56	$$4.26\pm 0.11$$	3.87
$$3.7\times {10}^4$$	$$7.49\pm 0.25$$	3.43	$$7.78\pm 0.33$$	4.29
$$3.7\times {10}^2$$	$$14.39\pm 0.25$$	1.74	$$14.73\pm 0.73$$	4.92

3.6. Test and Verify

It had identified swim bladders (total 1.836 kg) that originated from Totoaba macdonaldi, which were smuggled into mainland China from Hong Kong by vehicle via Shenzhen and confiscated by Customs officials on February 22, 2022. All the results were verified by DNA barcoding.

4. Discussion

Although DNA barcoding has been widely used to identify a variety of marine products in the world [35, 36] and has become the preferred method for species identification of marine fish and their products [37]; some other methods can also be used to distinguish species, such as LAMP, RFLP, SSCP, multiplex PCR, Taqman Assay, and Melt–Curve qPCR [38]. All of them have their own advantages and disadvantages. If based on PCR, it is inseparable from thermocycler and sequencing will cause relatively high cost and long test and analysis time, but the result is reliable. RAA is an in vitro amplification method for rapidly amplifying nucleic acids within 30 min at a constant temperature (37°C–42°C) using a recombinant enzyme from E.coli, significantly reducing the requirements for experimental and hardware conditions; therefore, it is believed to potentially serve as an alternative detection technique to PCR. At present, the sequences selected for species identification of swim bladders by DNA barcoding are focused on COI, 16S rRNA, and 12S rRNA [39]. Researches show that using COI can achieve identification and classification on the species level for over 95% of animal species [40], and it also has certain effectiveness in fish [41–43], such as when 30 pieces of Sciaenidae were be distinguished by COI [44]. However, in this study, the curves amplified by primers targeted to COI show an unperfected “S” shape (Figure 3) and only 10³ copies/uL in sensitivity (Figure A1). It is speculated that the designed primers may be unsuitable for the reaction system, have lower amplifications for the targeted fragments, or that the fragments used for primer design were fewer when considering their specificity. 12S rRNA and 16S rRNA are highly conservative and have sufficient variation, although they have been reported on fish species identification; but given to the limited data in Genbank and other databases, they are not conducive to the sequence alignment and analysis in early primer design. Cytb is the most reliable mitochondrial DNA for studying phylogenetic problems [45], and there are relatively more sequences in databases, so we chose the fragment of Cytb as the targeted sequence for the primer finally. In this study, we selected 23 species that have higher similarity (≥88%) to Totoaba macdonaldi mitochondrial Cytb sequences for the BLAST comparison and design of primers and probe (Figure A2).

Most swim bladders in China originated from Sciaenidae traditionally, the source species expanded to other marine and freshwater fish in America, Oceania, and Africa in recent years, as the demanding and purchasing power, the investment in deep-sea fishing, and the depth of global trade have continued increasing [46]. More than 830 swim bladders retailed in the mainland and Hong Kong were identified by using DNA barcoding targeted to COI [46–49], 16S rRNA [50–52], and 12S rRNA [39]; 31 species had been distinguished totally, except for Bahaba taipingensis and Totoaba macdonaldi (Table 2). The identified species belong to both croakers, including several species of Cynoscion in America, Protonibea diacanthus in Asia, and Boesemania spp. and Atrobucca in Indonesia, and noncroakers, containing several species of eel, catfish (Sciades parkeri and Pangasianodon hypophthalmus), pufferfish, which have a long history in the trade, and the Nile perch (Lates niloticus), relatively new to the trade. In this study, in order to test the specificity of the RF-RAA, we chose 13 species of Sciaenidae (including Bahaba taipingensis), 2 species of Latidae, Gadidae, and Ophidiidae, respectively, and 1 species of Polynemidae, Muraenesocidae, and Centropomidae, respectively; a total 22 species of 7 families were used as controls. There were no fluorescence signals detected except for Totoaba macdonaldi, although we do not cover all the 31 species retailed on the market, limited by our material collection. The result shows that the established RF-RAA had good specificity for Totoaba macdonaldi and had no cross-reaction with the species mentioned.

The aim to develop this RF-RAA for the species identification of Totoaba macdonaldi from swim bladders is to improve the efficiency of identification. Two days can be saved for no sequencing and analysis, with no special requirements of the specialized environment, compared to the DNA boarding. With the proper equipment and short detection time, it can be applied to the on-site inspection by authority officials, especially Customs officials. Take the example of Shenzhen, the city near Hong Kong, both of the two cities were the high consumer market for maw. The common illegal ways for swim bladders entering into the mainland via the Shenzhen port from Hong Kong are personal carrying, mail express, and vehicle concealment. However, there are about 400,000 people and 10,000 vehicles that commute between the two cities a day, and nearly 35,000 Mail Express entered into Shenzhen per day, according to the Office of Port of Entry and Exit of Shenzhen Municipal People’s Government and Shenzhen Municipal Postal Administration, respectively. Even if the lowest proportion of those are subjected to inspection, the quantities are very huge. Furthermore, if the swim bladders were found by customs on inspection, they need to identify the species swiftly, and then determine whether the species are endangered, so they can have a strong evidence to finish the penalty and confiscation and accusation. With the expanding of species and the originated countries, the loose naming system, and shifts in names and species, “mislabelled commodities” is a universal phenomenon in the swim bladders market, which could affect both the exporters and importers, and the former overexploited the fish for pursuing high value, and the later unknown what species they are paying for, so better understanding the species in the swim bladders trade could benefit to improve the consciousness of endangered wildlife protection and biological diversity. Without doubt, it is necessary to develop effective species identification methods on swim bladders persistently, and our study is a meaningful attempt.

Funding

This work was supported by the Key-Area Research and Development Program of Guangdong Province (grant number 2022B1111030001) and the Shenzhen Sustainable Development Technology Special Project (grant number KCXFZ20211020165547010).

Acknowledgments

We are sincerely grateful to Dongguan Natural Reserve for providing the sample of Bahaba taipingensis.

Appendix

Appendices

In this study, we chose the fragment of Cytb as the targeted sequence for the primer finally, because the curves amplified by primers targeted to COI show only 10³ copies/uL in sensitivity (Figure A1). We selected 23 species that have higher similarity (≥88%) to Totoaba macdonaldi mitochondrial Cytb sequence (NC_082752.1) for the design of primers and probe, and the multiple sequence alignments of Cytb were presented in Figure A2.

[figure(s) omitted; refer to PDF]

References

[1] M. H. Zhao, P. Li, Y. Y. Zhang, J. Xi, Y. H. Ye, B. Tu, J. X. Tian, B. L. Zhong, "Comparative analysis of nutritional components of fish maws from different sources," Food Research and Development, vol. 41 no. 24, pp. 12-17, 2020.

[2] S. Sinthusamran, S. Benjakul, "Effect of drying and frying conditions on physical and chemical characteristics of fish maw from swim bladder of seabass ( Lates calcarifer )," Journal of the Science of Food and Agriculture, vol. 95 no. 15, pp. 3195-3203, DOI: 10.1002/jsfa.7059, 2015.

[3] S. Y. Lin, "Fish air-bladders of commercial value in China," The Hong Kong Naturalist, vol. 9, pp. 108-118, 1939.

[4] Y. Sadovy de Mitcheson, A. W. L. To, N. W. Wong, H. Y. Kwan, W. S. Bud, "Emerging from the murk: threats, challenges and opportunities for the global swim bladder trade," Reviews in Fish Biology and Fisheries, vol. 29 no. 4, pp. 809-835, DOI: 10.1007/s11160-019-09585-9, 2019.

[5] S. Clarke, "Trade in Asian dried seafood: characterization, estimation and implications for conservation," WCS Working Paper No. 22, December 2002, 2002.

[6] A. W. L. To, S. K. H. Shea, "Patterns and dynamics of beche-de-mer trade in Hong Kong and mainland China: implications for monitoring and management," Traffic Bull, vol. 24, pp. 65-76, 2012.

[7] Y. T. Kwong, A Guide to Dried Seafood in Hong Kong (香港海味採買圖鑑), 2013.

[8] J. Wen, L. Zeng, Z. Chen, Y. Xu, "Comparison of nutritional quality in fish maw product of croaker Protonibea diacanthus and perch Lates niloticus," Journal of Ocean University of China, vol. 15 no. 4, pp. 726-730, DOI: 10.1007/s11802-016-2870-7, 2016.

[9] M. A. Cisneros-Mata, G. Montemayor-Lopez, M. J. Roman-Rodriguez, "Life history and conservation ofTotoaba macdonaldi," Conservation Biology, vol. 9 no. 4, pp. 806-814, DOI: 10.1046/j.1523-1739.1995.09040806.x, 1995.

[10] Y. T. Chu, Y. L. Lo, H. L. Wu, A study on the classification of the sciaenoid fishes of China, with descriptions of new genera and species, 1963.

[11] E. Trewavas, "The sciaenid fishes (croakers or drums) of the Indo‐West‐Pacific," Transactions of the Zoological Society of London, vol. 33 no. 4,DOI: 10.1111/j.1096-3642.1977.tb00052.x, 1977.

[12] M. A. Cisneros-Mata, L. W. Botsford, J. F. Quinn, "Projecting viability ofTotoaba macdonaldi,a population with unknown age-dependent variability," Ecological Applications, vol. 7 no. 3, pp. 968-980, DOI: 10.1890/1051-0761(1997)007[0968:PVOTMA]2.0.CO;2, 1997.

[13] Y. Sadovy de Mitcheson, W. L. Cheung, "Near extinction of a highly fecund fish: the one that nearly got away," Fish and Fisheries, vol. 4 no. 1, pp. 86-99, DOI: 10.1046/j.1467-2979.2003.00104.x, 2003.

[14] M. A. Cisneros-Mata, J. A. Delgado, D. Rodríguez-Félix, "Viability of the vaquita, Phocoena sinus (Cetacea: Phocoenidae) population, threatened by poaching of Totoaba macdonaldi (Perciformes: Sciaenidae)," Revista de Biología Tropical, vol. 69 no. 2, pp. 588-600, DOI: 10.15517/rbt.v69i2.45475, 2021.

[15] M. A. Cisneros-Mata, C. True, L. M. Enriquez-Paredes, Y. Savody, M. Liu, "Totoaba macdonaldi the IUCN red list threatened species 2021: e.T22003A2780880," 2021. https://www.iucnredlist.org/species/22003/2780880

[16] C. A. Flanagan, J. R. Hendrickson, "Observations on the commercial fishery and reproductive biology of Totoaba, Cynoscion macdonaldi , in the northern Gulf of California," Fishery Bulletin, vol. 74, pp. 531-544, 1976.

[17] J. F. Márquez-Farías, F. J. Rosales-Juárez, "Intrinsic rebound potential of the endangered ( Totoaba macdonaldi ) population, endemic to the Gulf of California, México," Fisheries Research, vol. 147, pp. 150-153, DOI: 10.1016/j.fishres.2013.05.009, 2013.

[18] F. Valenzuela-Quiñonez, J. A. De-Anda-Montañez, E. Gilbert-Horvath, J. C. Garza, F. J. García-De León, "Panmixia in a critically endangered fish: the Totoaba ( Totoaba macdonaldi ) in the Gulf of California," Journal of Heredity, vol. 107 no. 6, pp. 496-503, DOI: 10.1093/jhered/esw046, 2016.

[19] D. Lercari, E. A. Chávez, "Possible causes related to historic stock depletion of the totoaba, Totoaba macdonaldi (Perciformes: Sciaenidae), endemic to the Gulf of California," Fisheries Research, vol. 86 no. 2-3, pp. 136-142, DOI: 10.1016/j.fishres.2007.05.010, 2007.

[20] V. Morell, "World’s most endangered marine mammal down to 30," Science, vol. 355 no. 6325, pp. 558-559, DOI: 10.1126/science.355.6325.558, 2017.

[21] F. Valenzuela-Quiñonez, F. Arreguín-Sánchez, S. Salas-Márquez, F. García-De León, J. Garza, M. Román-Rodríguez, J. A. De-Anda-Montañez, "ritically endangered totoaba Totoaba macdonaldi : signs of recovery and potential threats after a population collapse," Endangered Species Research, vol. 29 no. 1,DOI: 10.3354/esr00693, 2015.

[22] EIA, Collateral damage: How illegal trade in totoaba swim bladders is driving the vaquita to extinction, 2016. https://eia-international.org/wp-content/uploads/EIA-Collateral-Damage-FINAL-mr.pdf

[23] I. Baird, "Boesemania microlepis. The IUCN red list of threatened species 2011: e.T181232A7664209," 2011. https://www.iucnredlist.org/species/181232/7664209

[24] M. J. Phelan, N. A. Gribble, R. N. Garrett, "Fishery biology and management of Protonibea diacanthus (Sciaenidae) aggregations in far Northern Cape York Peninsula waters," Continental Shelf Research, vol. 28 no. 16, pp. 2143-2151, DOI: 10.1016/j.csr.2008.03.022, 2008.

[25] R. Betancur, A. P. Marceniuk, T. Giarrizzo, F. L. Fredou, "Sciades parkeri. The IUCN red list of threatened species 2015: e.T155018A722547," 2015. https://www.iucnredlist.org/species/155018/722547

[26] C. Vidthayanon, Z. Hogan, "Pangasianodon hypophthalmus. The IUCN red list of threatened species 2011: e.T180689A7649971," 2011. https://www.iucnredlist.org/species/180689/7649971

[27] EIA, Seizure information from a database maintained by the Environmental Investigation Agency and provided as a pers. comm. in December 2020, 2020. https://eia-international.org/wildlife/wildlife-trade-maps/illegal-trade-seizures-totoaba

[28] EIA, CITES’s Last Chance Stop the Illegal Totoaba Trade to Save the Vaquita, 2019. https://eia-international.org/wp-content/uploads/EIA-report-citess-last-chance-spreads.pdf

[29] L. Yan, J. Zhou, Y. Zheng, A. S. Gamson, B. T. Roembke, S. Nakayama, H. O. Sintim, "Isothermal amplified detection of DNA and RNA," Molecular BioSystems, vol. 10 no. 5, pp. 970-1003, DOI: 10.1039/c3mb70304e, 2014.

[30] X. H. Sun, L. W. Hou, D. R. Li, Y. Zhao, X. X. Huang, Y. P. He, W. Q. Lan, "Research progress on the application of isothermal recombinase amplification in analytical detection," Food and Fermentation Industries, vol. 46 no. 24, pp. 265-270, 2020.

[31] J. Zhang, Y. Qi, J. J. Yan, J. J. Yang, Z. Y. Se, C. Q. Zhou, "Application of recombinase-aid amplification technology in biosafety detection," China Brewing, vol. 41 no. 11, pp. 14-19, 2022.

[32] Y. Zhao, F. Chen, Q. Li, L. Wang, C. Fan, "Isothermal amplification of nucleic acids," Chemical Reviews, vol. 115 no. 22, pp. 12491-12545, DOI: 10.1021/acs.chemrev.5b00428, 2015.

[33] O. Piepenburg, C. H. Williams, D. L. Stemple, N. A. Armes, "DNA detection using recombination proteins," PLOSBiol, vol. 4 no. 7, pp. 1115-1121, DOI: 10.1371/journal.pbio.0040204, 2006.

[34] Y. Liang, H. Ye, X. Cai, E. Tian, F. Li, C. Li, G. Huang, Z. Chao, "Recombinase polymerase amplification combined with fast DNA extraction for on–spot identification of Deinagkistrodon acutus , a threatened species," Animal Biodiversity and Conservation, vol. 45 no. 1, pp. 69-78, 2022.

[35] T. C. Chin, A. B. Adibah, Z. A. D. Hariz, M. N. S. Azizah, "Detection of mislabelled seafood products in Malaysia by DNA barcoding: improving transparency in food market," Food Control, vol. 64, pp. 247-256, DOI: 10.1016/j.foodcont.2015.11.042, 2016.

[36] A. M. Pappalardo, V. Ferrito, "DNA barcoding species identification unveils mislabeling of processed flatfish products in southern Italy markets," Fisheries Research, vol. 164, pp. 153-158, DOI: 10.1016/j.fishres.2014.11.004, 2015.

[37] C. H. Chang, H. Y. Lin, Q. Ren, Y. S. Lin, K. T. Shao, "DNA barcode identification of fish products in Taiwan: government-commissioned authentication cases," Food Control, vol. 66, pp. 38-43, DOI: 10.1016/j.foodcont.2016.01.034, 2016.

[38] I. A. Giantsis, M. Tokamani, G. Triantaphyllidis, S. Tzatzani, E. Chatzinikolaou, A. Toros, A. Bouchorikou, E. Chatzoglou, H. Miliou, J. Sarantopoulou, G. A. Gkafas, A. Exadactylos, R. Sandaltzopoulos, A. Apostolidis, "Development of multiplex PCR and melt–curve analysis for the molecular identification of four species of the Mullidae family, available in the market," Genes, vol. 14 no. 5,DOI: 10.3390/genes14050960, 2023.

[39] T. Yan, N. Li, J. M. Jia, G. S. Hu, "Identification of swimming bladder of Pseudosciaena crocea and seudosciaena polyactis and their adulterants by highly specific PCR," China Pharma, vol. 26 no. 4, pp. 491-493, 2015.

[40] S. H. Chen, Y. J. Qu, J. E. Li, "Mitochondrial DNA and its progresses in fish," Biotechnology Bulletin, vol. 27 no. 3, pp. 13-20, 2011.

[41] R. D. Ward, F. O. Costa, B. H. Holmes, D. Steinke, "DNA barcoding of shared fish species from the North Atlantic and Australasia: minimal divergence for most taxa, but Zeus faber and Lepidopus caudatus each probably constitute two species," Aquatic Biology, vol. 3, pp. 71-78, DOI: 10.3354/ab00068, 2008.

[42] R. D. Ward, T. S. Zemlak, B. H. Innes, P. D. N. Hebert, "DNA barcoding Australia's fish species," Philosophical Transactions of the Royal Society B, vol. 360 no. 1462, pp. 1847-1857, DOI: 10.1098/rstb.2005.1716, 2005.

[43] T. S. Zemlak, R. D. Ward, A. D. Connell, B. H. Holmes, P. D. N. Hebert, "DNA barcoding reveals overlooked marine fishes," Molecular Ecology Resources, vol. 9 no. s1, pp. 237-242, DOI: 10.1111/j.1755-0998.2009.02649.x, 2009.

[44] S. F. Liu, L. L. Chen, F. Q. Dai, Z. M. Zuang, "Application of DNA barcoding gene CO I for classifing family Sciaenidae," Oceanology and Limnology, vol. 41 no. 2, pp. 223-232, 2010.

[45] R. Zardova, A. Meyer, "Phylogenetic performance of mitochondrial protein-coding genes in resolving relationships among vertebrates," Molecular Biology and Evolution, vol. 13 no. 7, pp. 933-942, DOI: 10.1093/oxfordjournals.molbev.a025661, 1996.

[46] X. C. Zheng, S. Q. Zhu, H. Xu, Y. Liu, B. Z. Luo, C. H. Zhang, H. Liu, "Identification and analysis on original species of isinglass for sale in Shenzhen through DNA barcoding," Food Quality and Safety, vol. 13 no. 3, pp. 963-971, 2022.

[47] X. Cai, W. Qiu, E. W. Tian, H. W. Zhang, H. T. Ye, Z. Chao, "Identification of original species of fish maw by DNA barcoding," Zhong yao cai= Zhongyaocai= Journal of Chinese Medicinal Materials, vol. 39 no. 9, pp. 1956-1959, 2016.

[48] J. F. Peng, X. J. Lin, J. H. Zheng, W. Li, X. Y. Wang, Z. M. Chen, Y. C. Chen, "Study of the molecular identification for isinglass on DNA barcodes," Shantou University Medical College, vol. 31 no. 4, pp. 201-205, 2018.

[49] H. M. Zhu, Y. Y. Lian, Z. D. Wang, Y. S. Guo, C. W. Liu, "DNA molecular identification of fish maw based on mitochondrial cox1 sequences," Guangdong Ocean University, vol. 34 no. 6, 2014.

[50] H. Cao, X. L. Tian, X. Liu, "Molecular identification of swim bladder and pharmacological study on its hemostatic effect," Journal of Chinese Institute of Food Science and Technology, vol. 9 no. 4, pp. 170-176, 2009.

[51] C. D. Tuuli, Y. Sadovy de Mitcheson, W. C. Ng, "Molecular identification of croaker dried swim bladders (maw) on sale in Hong Kong using 16S rRNA nucleotide sequences and implications for conservation," Fisheries Research, vol. 174, pp. 260-269, DOI: 10.1016/j.fishres.2015.10.018, 2016.

[52] J. Wen, L. Zeng, Y. L. Sun, D. H. Chen, Y. H. Xu, P. Luo, Z. Zhao, Z. Yu, S. G. Fan, "Authentication and traceability of fish maw products from the market using DNA sequencing," Food Control, vol. 55, pp. 185-189, DOI: 10.1016/j.foodcont.2015.02.033, 2015.