1. Introduction
Sugarcane, belonging to the genus Saccharum, is widely cultivated in tropical and subtropical countries. It is the leading driver for the global production of sugar and sweeteners [1,2,3]. By 2022, the total yield of sugarcane in China reached 103.381 million tons [4]. Sugarcane top (ST), a by-product of the sugar industry, represents 15–25% of the aerial part of sugarcane and is used as the main forage material for milk production and fattening of ruminants in different parts of the world [5,6,7]. In most Asian countries, including China, livestock rearing is mainly dependent on nutritionally poor crop by-products. The available feed resources in China cannot fully meet the feed requirements of the large livestock population, both quantitatively and qualitatively. To bridge the gap between availability and requirement, by-products from agricultural crops must be utilized more efficiently. ST is an important and integral animal roughage resource in southern China. It has a high water-soluble carbohydrate (WSC) content and is highly nutritive and palatable with good intake preference for livestock; therefore, it should be further developed and utilized [8]. However, owing to the seasonal and concentrated harvesting of sugarcane, as well as the humid and hot climatic factors in cultivated regions, ST is prone to mold, and the utilization rate of ST feed is low. Furthermore, the physical structure of untreated ST is relatively hard, which can affect the feed intake and damage the digestive tract of livestock. However, with strategic supplementation and the adoption of various processing techniques, these feed resources can be efficiently utilized for production purposes. By exploiting sugarcane by-products to their full potential, animal production and productivity can be increased. Silage is less affected by weather conditions, making it an effective storage method for ST as a feed alternative, preventing subsequent molding [9]. Furthermore, the efficient utilization of ST not only promotes the development of the sugarcane industry but also alleviates the shortage of seasonal ruminant animal forage.
Napier grass (NG) is a high-yield warm season forage commonly cultivated in tropical and subtropical regions because of its high biomass yield and growth, rich nutritional value, freshness, juiciness, and palatability [10,11,12,13]. It is mainly used as a high-quality green feed for ruminants and can also be used as a raw material for preparing silage feed, thereby addressing the problem of insufficient coarse feed during spring and winter [14,15]. However, NG’s low dry matter (DM) and WSC concentrations, along with its high cell wall content, complicate the production of high-quality silage without additives, leading to potential silage spoilage and reduced animal intake [16,17,18].
Ensiling is a method of preserving high-quality forage initiated by a complex microbial community in anaerobic environments. During silage production, lactic acid bacteria (LAB) rapidly proliferate, establishing subsequent bacterial communities, which metabolize WSC into organic acids, allowing long-term storage while maintaining nutritional quality and enhancing feed palatability [19,20]. Previous studies have reported that co-ensiling improves silage quality and enhances stability during the fermentation process compared with silage alone [21,22,23,24,25,26]. Moreover, the feeding effect of NG and ST as a single feed source is not ideal, and they are prone to wastage. Thus, mixing them in specific proportions balances the DM content, compensates for nutritional deficiencies in NG silage, increases WSC content, inhibits poor fermentation, and improves overall silage quality, leading to high-quality silage production [27,28]. Furthermore, a detailed comprehension of the microbiome and metabolome during the ensiling process could enable researchers to identify novel strategies for enhancing silage preservation; additionally, this knowledge may facilitate the development of silages enriched with active metabolites that promote animal health and welfare [29]. However, the evolution of the microbiological profile and dynamic changes in fermentation characteristics during ensiling when silage production using NG and ST at different proportions requires specifically further investigation.
Therefore, the objective of the current study was to evaluate the mixed silage quality of NG and ST at different proportions throughout the storage period of 1, 3, 5, 7, 15, 30, and 60 d, considering the fermentation characteristics, chemical composition, and microbiological profile.
2. Materials and Methods
2.1. Ensiling Materials and Silage Preparation
NG, ‘Guimu-1’ ((Pennisetum americanum × P. purpureum) × P. purpureum cv. Guimu No.1), was harvested at approximately 10 cm above ground level after a three-month regrowth period at the vegetative stage of maturity obtained from the Herbage Base at the Guangxi Zhuang Autonomous Region Buffalo Research Institute. ST, grown for approximately ten months and manually harvested following cane harvest, was sourced from an industrial sugar production region in Nanning, China, in February 2023. The chemical compositions of NG and ST are listed in Table 1. Fresh NG and ST samples were immediately chopped (approximately 2 cm) using a forage cutter. NG was mixed thoroughly without ST (Control, S0) or with 10% (S1), 20% (S2), 30% (S3), 40% (S4), 50% (S5), 60% (S6), 70% (S7), 80% (S8), 90% (S9), and 100% (S10) ST based on fresh matter (FM) to create the silage materials. Approximately 1 kg of the sample from each treatment, with six replicates, was packed into plastic bags (160 mm × 250 mm) and sealed using a vacuum sealer (DZ500; Gzrifu Co., Ltd., Guangzhou, China). Silage samples were preserved in the laboratory at 20–25 °C away from light and sampled for analysis after 1, 3, 5, 7, 15, 30, and 60 d.
2.2. Chemical Analysis
Samples of NG, ST, and their mixed silages were dried in a forced draft oven (LABO–250; STIK Co., Ltd., Shanghai, China) at 65 °C until a constant weight was obtained. Subsequently, they were ground by passing through a 1 mm screen using a sample mill (FS200; Guangzhou Bomin Mechanical & Electrical Equipment Co., Ltd., Guangzhou, China). The DM, crude protein (CP), ether extract (EE), and ash content were analyzed according to methods 934.01, 976.05, 920.39, and 942.05, respectively, of the Association of Official Analytical Chemists (AOAC, 1990) [30]. Neutral detergent fiber (NDF) and acid detergent fiber (ADF) contents were determined according to the methods described by Van Soest et al. (1991) [31]. The WSC was analyzed according to the methods described by Udén [32].
2.3. Fermentation Analysis
The ensiling fermentation products in the silage were determined using cold-water extracts [33]. Briefly, 20 g of fresh silage was homogenized with 180 mL of sterilized distilled water and stored at 4 °C overnight. The pH was measured using a pH meter (HI 8424; HANNA® instruments, Woonsocket, RI, USA). Organic acid contents, including lactic acid (LA), acetic acid (AA), propionic acid, and butyric acid (BA), were measured using high-performance liquid chromatography (1260 Infinity II; Agilent Technologies, Inc., Waldbronn, Germany) according to the method described by Xie et al. (2023) [34]. The analytical conditions employed were as follows: the column utilized was a Shodex RSpak KC–811 (8.0 mm × 300 mm; Showa Denko K.K., Tokyo, Japan); detection was performed using a DAD detector set at 210 nm; the eluent consisted of 3 mmol/L HClO4 with a flow rate of 1.0 mL/min; the temperature was maintained at 50 °C; and the sample injection volume was 5.0 μL. The ammonia-N (NH3-N) content was measured using the method described by Broderick and Kang (1980) [35].
2.4. Microbial Populations and Bacterial Community Analyses
Enumeration of LAB, yeasts, and molds in ensiled forage was performed using the plate count method described by Cao et al. (2011) [36]. Briefly, silage samples (10 g) were homogenized in 90 mL of distilled water, and 10−1–10−5 were serially diluted in sterilized water. The number of LAB was counted on spread plates using De Man–Rogosa–Sharpe agar (Qingdao Hope Bio-Technology Co., Ltd., Qingdao, China) after incubation in an anaerobic incubator at 30 °C for 48 h. Subsequently, yeasts and molds were counted on potato dextrose agar (Qingdao Hope Bio-Technology Co., Ltd., Qingdao, China) after incubation at 30 °C for 48 h. Yeast were distinguished from mold or bacteria by colony appearance and observation of cell morphology. The number of colonies indicated the number of viable microorganisms (log cfu/g FM).
Silage samples stored for 7, 30, and 60 d were sampled for bacterial community analysis. Microbial DNA was extracted from the silage samples using the Ezup Spin Column Super Plant Genomic DNA Extraction Kit (B518262; Sangon Biotech, Shanghai, China), according to the manufacturer’s instructions. The V3–V4 regions of the 16S rRNA gene were subjected to amplification using the primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT). Biomarker (BMK) Technologies (Beijing, China) conducted the metagenomic sequencing, which included PCR amplification and DNA extraction, followed by Illumina MiSeq sequencing and final sequencing data processing. Data were analyzed using the free online BMK Cloud Platform (
2.5. Statistical Analysis
Data on the chemical composition of silage opened on day 60 were analyzed using one-way ANOVA. Data on microbial populations and fermentation characteristics were analyzed using the generalized linear model procedure of SAS software (Statistical Analysis System, version 9.2), according to the model for a 7 × 11 factorial treatment design:
Yij = µ + αi + βj + (α × β)ij + eij(1)
where µ represents the overall mean, αi represents the ensiling time effect (i = 1, 3, 5, 7, 15, 30, 60 d), βj represents the mixture ration effect (j = S0, S1, S2, S3, S4, S5, S6, S7, S8, S9, S10), (α × β)ij represents the effect of interaction between ensiling time and mixture ration, and eij represents random error. Tukey’s test was used to identify statistically significant differences (p < 0.05) between means. An online platform (3. Results
3.1. Chemical Compositions
As shown in Table 1, NG had higher CP and ash contents but lower DM, EE, NDF, ADF, and WSC contents than ST before ensiling. Increasing the proportion of ST in NG silage led to significant (p < 0.05) increases in DM, EE, NDF, ADF, and WSC contents, and significant (p < 0.05) decreases in CP and ash contents (Table 2).
3.2. Fermentation Quality
Ensiling days (ED), mixture ratio (MR), and their interaction (ED × MR) affected the pH and content of LA, AA, and NH3-N (Table 3). Compared with S0, the addition of ST increased (p < 0.05) LA content and decreased (p < 0.05) the pH and contents of AA, BA, and NH3-N in silage. A comparison of ED showed that the pH of the silage during the later stages of fermentation was lower (p < 0.05) than that during the early stages of fermentation. LA, AA, BA, and NH3-N content in the silages increased (p < 0.05) with storage time.
3.3. Microbial Populations
ED, MR, and their interaction (ED × MR) influenced the number of LAB (Table 4). However, the number of yeasts was only affected by ED. A comparison among all types of silages revealed that the number of LAB was the highest (p < 0.05) in S6, S7, and S8 silages, followed by S9, S4, S5, S3, S10, S2, S1, and S0 silages. The number of yeasts did not differ (p > 0.05) among silage types. A comparison of the ED showed that the silage obtained on days 30 and 60 of fermentation had the highest (p < 0.05) number of LAB, followed by those obtained on days 15, 7, 5, 3, and 1 of fermentation. However, the number of yeasts was the highest (p < 0.05) in silage on day 15 of fermentation, followed by that on days 7, 5, 60, 30, 3, and 1 of fermentation. Molds were not detected in any of the silages on any ED.
3.4. Bacterial Community
The sequencing analysis coverage was above 0.99 (Table 5), ensuring optimal sequencing depth to accurately reflect microbial species and good representativeness in all silages. On day 7, ACE, Chao 1, and Simpson indices were significant in S4 (p < 0.05) (Table 4), though most silages showed no significant differences. The highest Shannon index was in S8 (p < 0.05), exceeding that of most other silages. On day 30, when NG co-ensiling reached 50% ST, the ACE, Chao 1, Simpson, and Shannon indices were higher (p < 0.05) than those of NG silage without ST or with low levels of ST. On day 60, S10 had higher ACE and Chao1 values than the other silages (p < 0.05); S0 and S1 had lower (p < 0.05) Simpson and Shannon indices than the other silages.
The beta diversity of the bacterial community was determined using principal coordinate analysis between various NG and ST mixed silages on days 7, 30, and 60 (Figure 1). The results showed some differences in the composition of silage microorganisms between the samples collected on different ED and various NG and ST MRs, indicating significant differences in bacterial composition among the samples collected on different fermentation days.
The relative abundances of microorganisms in the various silages under different ensiling times at the order and genus levels are shown in Figure 2 and Figure 3, respectively. At the order level, Lactobacillales and Enterobacterales were the most dominant in terms of relative abundance in silages stored for 7 d (Figure 2a), 30 d (Figure 2b), and 60 d (Figure 2c). At the genus level, the top two genera in terms of relative abundance in the silages stored at 7 d (Figure 3a), 30 d (Figure 3b), and 60 d (Figure 3c) were Lactiplantibacillus and Weissella. Furthermore, the relative abundances of Lactobacillales and Lactiplantibacillus in silages stored for 30 d were higher than in those stored for 7 or 60 d.
3.5. Association among Silage Bacteria, Chemical Composition, and Fermentation Parameters
The correlation between the relative abundance of bacterial genera and chemical composition is shown in Figure 4. The CP content was negatively correlated (p < 0.05) with Lentilactobacillus and Levilactobacillus but positively correlated (p < 0.05) with Companilactobacillus, Lactiplantibacillus, and unclassified_Cyanobacteriales. The ash content was negatively correlated (p < 0.05) with Lentilactobacillus, Levilactobacillus, and Weissella but positively correlated (p < 0.05) with Companilactobacillus. The DM content was positively correlated (p < 0.05) with Lentilactobacillus, Levilactobacillus, and Weissella but negatively correlated (p < 0.05) with Companilactobacillus and Lactiplantibacillus. The WSC content was positively correlated (p < 0.05) with Lentilactobacillus and Levilactobacillus but negatively correlated (p < 0.05) with Companilactobacillus, Lactiplantibacillus, and unclassified_Cyanobacteriales. The ADF content was positively correlated (p < 0.05) with Lentilactobacillus and Levilactobacillus but negatively correlated (p < 0.05) with Companilactobacillus. Finally, the EE and NDF contents were positively correlated (p < 0.05) with Lentilactobacillus but negatively correlated (p < 0.05) with Companilactobacillus, Lactiplantibacillus, and unclassified_Cyanobacteriales.
The correlation between the relative abundance of bacterial genera and fermentation parameters is shown in Figure 5. The pH was negatively correlated (p < 0.05) with Lentilactobacillus and Levilactobacillus but positively correlated (p < 0.05) with Companilactobacillus. The AA content was negatively correlated (p < 0.05) with Lentilactobacillus, Weissella, and Levilactobacillus but positively correlated (p < 0.05) with Companilactobacillus and Lactiplantibacillus. The NH3-N content was negatively correlated (p < 0.05) with Lentilactobacillus, Weissella, unclassified_Enterobacterales, and pantoea but positively correlated (p < 0.05) with Companilactobacillus, Lactiplantibacillus, and unclassified_Cyanobacteriales. LA content was positively correlated (p < 0.05) with Lentilactobacillus, Weissella, and Levilactobacillus but negatively correlated (p < 0.05) with Companilactobacillus.
4. Discussion
Essential conditions to produce high-quality silage encompass ensuring that the raw materials have an optimal moisture content and soluble sugar concentration sufficient to meet the requirements for effective substrate fermentation [37,38]. Before ensiling, ST was rich in DM, EE, NDF, ADF, and WSC, indicating that it could be utilized as a feed ingredient for cattle and sheep. In contrast, NG had relatively low DM (16.71%) and WSC (3.46% DM), making high-quality silage production difficult when ensiling NG alone compared to ST. Therefore, inoculants such as LAB, acid agents, molasses, or other beneficial raw materials are commonly used to inhibit the growth of harmful microorganisms and to improve the fermentation quality of ensiled NG [39,40,41,42]. ST have high DM and WSC contents (26.11% and 11.66%, respectively), are likely to enhance the dry matter and sugar content, inhibit the proliferation of detrimental microorganisms, and preserve protein integrity in NG silage, ultimately resulting in the production of high-quality silage. We also evaluated the chemical composition of mixed silage and found that DM, EE, NDF, ADF, and WSC contents increased as the proportion of ST in the silage mixture increased, whereas CP and ash contents decreased. This is likely due to the higher DM, EE, NDF, ADF, and WSC and lower CP and ash contents of ST compared to NG, indicating that co-ensiling NG with ST compensates for certain nutritional deficiencies in NG and provides a more balanced diet.
pH is an important parameter for evaluating silage fermentation quality [43]. During the silage process, microorganisms, especially LAB, produce large amounts of organic acids, including LA, from WSC in the substrate. This rapid decrease in pH inhibits poor fermentation and improves silage quality [44]. A steady reduction in pH and stabilization of LA content occurs after storage. Low pH ensures better aerobic stability and prevents forage from further fermentation. In the present study, the pH and NH3-N content decreased, and the LA content increased as the proportion of ST increased in the mixed silage. The addition of ST likely regulated NG’s moisture content and increased sugar and fermentation substrates, resulting in complete fermentation. Therefore, silages with added ST greatly improved LA fermentation. In this study, BA formation was observed in NG silage alone, probably because of AA, ethanol, and CO2 production or clostridial fermentation [45].
LAB play an important role in silage fermentation, and their relative abundance is used to evaluate their effect on silage quality [46,47]. Generally, silage can be well preserved when the LAB count reaches ≥105 cfu/g of FM [48]. In this study, the LAB count reached 105 cfu/g of FM in all silages, except for S0, which was NG ensiled alone. Other factors involved in fermentation quality include not only the physiological properties of epiphytic bacteria but also the chemical composition, especially WSC, of the ensiling forage material [49]. Studies have revealed that WSC levels ≥ 5% relative to DM are crucial for ensuring acceptable fermentation quality [50,51]. In this study, adding ST at a 60% ratio increased the WSC content to over 5% DM (Table 2), indicating that this proportion sufficiently supplements the substrate for microbial fermentation. Ensiling NG with more than 60% ST ensured better fermentation quality and nutrient preservation. ST, with its high WSC content, may also meet the energy demands of LAB during silage fermentation [52]. Yeast was detected in all silages, probably because raw silage material naturally contains many yeast species. Yeast is acid-resistant and can coexist with LAB in silage.
A detailed understanding of the microbial populations during ensiling could help researchers uncover new ways to improve silage preservation. Therefore, it is important to explore the dynamic changes occurring in epiphytic microbiota during ensiling, as understanding the dynamic changes, interactions, and metabolic pathways of the microbial community during ensiling can provide a theoretical basis for effectively regulating silage fermentation [53]. Furthermore, the silage microbiome may play a key role in the detoxification of plant-derived toxic metabolites [54]. However, to our knowledge, this is the first report of a bacterial community in ensiled NG silage combined with ST. The sequencing coverage for each silage was greater than 0.99, reflecting the true microbial species composition with good representativeness [55]. On day 7, ACE, Chao 1, and Simpson indices were found in S4, and the highest Shannon index was found in S8, possibly due to the presence of too many microbial species in the initial aerobic phase of fermentation, resulting in an unpredictable variation pattern of the alpha diversity parameters [56]. By day 30, when NG was co-ensiled with 50% ST, the ACE, Chao 1, Simpson, and Shannon indices were higher compared to NG silage without or with low-level ST. This may be because ST exhibited higher microbial diversity than NG before ensiling. Principal coordinate analysis results showed some differences in the composition of silage microorganisms in various NG and ST mixed silages, indicating significant differences in bacterial composition among silages stored on different fermentation days. The dominant microorganisms in the silages were Lactobacillales and Lactiplantibacillus at the order and genus levels, respectively. The relative abundances of Lactobacillales and Lactiplantibacillus at 30 d were higher than those at 7 or 60 d. From day 7, under natural fermentation conditions, Lactobacillus in Lactobacillales became dominant in all silages, achieving good quality after 30 days of ensiling. This underscores the significance of Lactobacillus in NG and ST mixed silage. Future work could focus on isolating and cultivating Lactobacillus from naturally fermented silage to further improve silage quality [57,58].
Increasing evidence indicates that changes in bacterial communities and their abundance affect fermentation characteristics during ensiling [59]. In the present study, CP, ash, pH, AA, and NH3-N were positively correlated with Lentilactobacillu. However, DM, EE, ADF, NDF, WSC, and LA were positively correlated with Lentilactobacillus. This suggests that chemical composition and fermentation parameters were simultaneously affected by these factors and that enhancing their abundance improved silage quality.
5. Conclusions
Our findings highlight the importance of ST in enhancing the fermentability of NG and the potential of using local by-products as additives for NG silage. Co-ensiling NG with ST increased the diversity and richness of silage microorganisms. Using ST, a local by-product, as an additive in NG silage could be an effective approach to improve the quality and nutritional value of NG silage. This study suggests that good-quality silages can be produced with NG:ST ratios of 40:60 to 20:80 and that these silages offer an opportunity to optimize the nutrient supply for ruminants.
Conceptualization, C.Y. and H.X.; methodology, H.X. and Y.L.; software, H.X., X.L. and J.L.; validation, C.Y., H.X. and Y.G.; formal analysis, F.Z. and Y.P.; investigation, H.X. and Y.G.; resources, Z.L. and L.P.; data curation, X.L. and L.L.; writing—original draft preparation, H.X.; writing—review and editing, H.X., L.L. and C.Y.; supervision, C.Y.; project administration, H.X.; funding acquisition, H.X. and C.Y. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
Dataset available on request from the authors.
The authors declare no conflicts of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Enlarge this image.Figure 1. Principal coordinates analysis of the bacterial community in the silage under different ensiling times. (a) Silage stored at 7 d; (b) silage stored at 30 d; (c) silage stored at 60 d.
Enlarge this image.Figure 2. Bacterial changes at order level of silage under different ensiling times. (a) Silage stored at 7 d; (b) silage stored at 30 d; (c) silage stored at 60 d.
Enlarge this image.Figure 3. Bacterial changes at genus level of silage under different ensiling times. (a) Silage stored at 7 d; (b) silage stored at 30 d; (c) silage stored at 60 d.
![View Image - Figure 4. Correlation of bacterial genera with chemical composition of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.](https://media.proquest.com/media/hms/THUM/8/vRNMa?_a=ChgyMDI1MDYwNDE3MTMwNDM2OToxNjUyODYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDjIxNi43My4yMTYuMTU4KgcyMDU1NDE0MgozMTIwNjMzNzE1OgtJbmxpbmVJbWFnZUIBMFIGT25saW5lWgNJTEliBFRIVU1qCjIwMjQvMDEvMDFyCjIwMjQvMTIvMzF6AIIBIFAtMTAwMDA4NC0yMDEzOTUtU1RBRkYtbnVsbC1udWxskgEGT25saW5lygFnTW96aWxsYS81LjAgQXBwbGVXZWJLaXQvNTM3LjM2IChLSFRNTCwgbGlrZSBHZWNrbzsgY29tcGF0aWJsZTsgQ2xhdWRlQm90LzEuMDsgK2NsYXVkZWJvdEBhbnRocm9waWMuY29tKdIBElNjaG9sYXJseSBKb3VybmFsc5oCB1ByZVBhaWSqAhtPUzpFTVMtRnVsbFRleHQtZ2V0RnVsbFRleHTKAg9BcnRpY2xlfEZlYXR1cmXiAgFO8gIA%2BgIBWYIDA1dlYooDHENJRDoyMDI1MDYwNDE3MTMwNDM2OTozMzIxMTY%3D&_s=J46VY0ByXSjcxl0vy%2Fgd9ZvIWU8%3D "View Image - Figure 4. Correlation of bacterial genera with chemical composition of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.")
Enlarge this image.Figure 4. Correlation of bacterial genera with chemical composition of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.
![View Image - Figure 5. Correlation of bacterial genera with fermentation parameters of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.](https://media.proquest.com/media/hms/THUM/10/vRNMa?_a=ChgyMDI1MDYwNDE3MTMwNDM2OToxNjUyODYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDjIxNi43My4yMTYuMTU4KgcyMDU1NDE0MgozMTIwNjMzNzE1OgtJbmxpbmVJbWFnZUIBMFIGT25saW5lWgNJTEliBFRIVU1qCjIwMjQvMDEvMDFyCjIwMjQvMTIvMzF6AIIBIFAtMTAwMDA4NC0yMDEzOTUtU1RBRkYtbnVsbC1udWxskgEGT25saW5lygFnTW96aWxsYS81LjAgQXBwbGVXZWJLaXQvNTM3LjM2IChLSFRNTCwgbGlrZSBHZWNrbzsgY29tcGF0aWJsZTsgQ2xhdWRlQm90LzEuMDsgK2NsYXVkZWJvdEBhbnRocm9waWMuY29tKdIBElNjaG9sYXJseSBKb3VybmFsc5oCB1ByZVBhaWSqAhtPUzpFTVMtRnVsbFRleHQtZ2V0RnVsbFRleHTKAg9BcnRpY2xlfEZlYXR1cmXiAgFO8gIA%2BgIBWYIDA1dlYooDHENJRDoyMDI1MDYwNDE3MTMwNDM2OTozMzIxMTY%3D&_s=EKx1lyzo8g5jWiDodzNV3wZcDz0%3D "View Image - Figure 5. Correlation of bacterial genera with fermentation parameters of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.")
Enlarge this image.Figure 5. Correlation of bacterial genera with fermentation parameters of silage stored at 60 d. Note: the change in defined color and its depth indicates the nature and strength of the correlation, respectively. * indicates 0.01 [less than] p ≤ 0.05, ** indicates 0.001 [less than] p ≤ 0.01, *** indicates p ≤ 0.001.
Chemical composition of Napier grass and sugarcane top before ensiling.
| Item | DM | CP | EE | Ash | NDF | ADF | WSC |
|---|---|---|---|---|---|---|---|
| (%) | (% DM) | ||||||
| NG | 16.71 | 12.89 | 1.32 | 11.91 | 69.58 | 36.15 | 3.46 |
| ST | 26.11 | 7.33 | 2.59 | 6.79 | 74.15 | 42.98 | 11.66 |
ADF, acid detergent fiber; CP, crude protein; DM, dry matter; EE, ether extract; NDF, neutral detergent fiber; NG, Napier grass; ST, sugarcane top; WSC, water-soluble carbohydrates.
Chemical composition of Napier grass, sugarcane top, and their silage sole or mixed silages after 60 d of storage.
| Item | DM | CP | EE | Ash | NDF | ADF | WSC |
|---|---|---|---|---|---|---|---|
| (%) | (% DM) | ||||||
| S0 † | 11.02 j | 9.45 a | 1.08 g | 10.65 a | 66.81 e | 34.15 g | 1.51 f |
| S1 | 12.42 i | 9.34 a | 1.20 g | 10.30 ab | 67.83 e | 34.81 fg | 2.02 f |
| S2 | 13.21 h | 8.21 b | 1.45 f | 10.21 ab | 69.67 d | 35.42 f | 3.67 e |
| S3 | 14.74 g | 7.86 bc | 1.63 ef | 9.87 b | 70.16 cd | 36.37 e | 4.46 de |
| S4 | 16.54 f | 7.80 bc | 1.71 de | 9.20 c | 70.30 cd | 37.80 d | 4.54 de |
| S5 | 17.34 e | 7.74 bc | 1.79 cde | 8.45 d | 70.78 bcd | 38.02 d | 4.73 cde |
| S6 | 19.53 d | 7.64 bc | 1.88 bcd | 8.37 d | 71.12 abc | 38.39 dc | 5.38 cd |
| S7 | 20.90 c | 7.57 c | 1.94 bcd | 7.38 e | 71.75 ab | 39.06 c | 5.98 bc |
| S8 | 21.85 b | 7.47 cd | 1.99 abc | 6.91 e | 71.86 ab | 40.19 b | 6.71 b |
| S9 | 22.14 b | 6.98 d | 2.09 ab | 6.78 ef | 72.17 a | 40.90 ab | 7.14 b |
| S10 | 23.24 a | 6.27 e | 2.21 a | 6.22 f | 72.31 a | 41.75 a | 8.65 a |
| SEM | 0.2438 | 0.1896 | 0.0771 | 0.2122 | 0.4031 | 0.3064 | 0.4257 |
| p-Value | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 | <0.0001 |
† Napier grass was mixed thoroughly without sugarcane top (Control, S0) or with 10% (S1), 20% (S2), 30% (S3), 40% (S4), 50% (S5), 60% (S6), 70% (S7), 80% (S8), 90% (S9), and 100% (S10) sugarcane top based on fresh weight, respectively. ADF, acid detergent fiber; CP, crude protein; DM, dry matter; EE, ether extract; NDF, neutral detergent fiber; SEM, standard error of the mean; WSC, water-soluble carbohydrates. Values with different small letter superscripts mean significant difference (p < 0.05), while those with the same or no letter superscripts mean no significant difference (p > 0.05).
Changes in fermentation profile of Napier grass, sugarcane top, and their mixed silages ensiled for 1, 3, 5, 7, 15, 30, and 60 days.
| Item | pH | Lactic Acid | Acetic Acid | Propionic Acid | Butyric Acid | NH3-N |
|---|---|---|---|---|---|---|
| (g/kg DM) | ||||||
| Ensiling days mean (ED) | ||||||
| 1 | 6.23 a | 2.73 f | 0.70 f | ND | ND | 0.16 g |
| 3 | 6.01 b | 3.18 f | 0.86 ef | ND | ND | 0.18 f |
| 5 | 5.88 c | 7.59 e | 1.28 e | ND | ND | 0.24 e |
| 7 | 5.15 d | 8.54 d | 3.70 d | ND | ND | 0.35 d |
| 15 | 4.69 e | 12.41 c | 11.50 c | ND | 0.62 b | 0.40 c |
| 30 | 4.30 f | 25.69 b | 15.45 b | ND | 0.83 a | 0.48 b |
| 60 | 4.19 g | 27.54 a | 18.78 a | ND | 0.85 a | 0.53 a |
| Mixture ratios mean (MR) | ||||||
| S0 † | 5.62 a | 7.56 i | 12.25 a | ND | 3.61 a | 0.45 a |
| S1 | 5.56 b | 8.87 h | 11.48 ab | ND | ND | 0.40 b |
| S2 | 5.47 c | 10.08 g | 10.81 b | ND | ND | 0.38 b |
| S3 | 5.38 d | 10.89 fg | 9.41 c | ND | ND | 0.36 c |
| S4 | 5.26 e | 11.35 f | 8.00 d | ND | ND | 0.34 cd |
| S5 | 5.19 f | 12.53 e | 7.04 e | ND | ND | 0.32 de |
| S6 | 5.09 g | 13.78 d | 6.00 f | ND | ND | 0.30 ef |
| S7 | 5.03 h | 14.40 cd | 5.09 g | ND | ND | 0.29 fg |
| S8 | 4.97 i | 15.15 bc | 4.37 gh | ND | ND | 0.28 fg |
| S9 | 4.88 j | 15.95 b | 3.93 h | ND | ND | 0.27 gh |
| S10 | 4.83 k | 17.19 a | 3.73 h | ND | ND | 0.26 h |
| SEM | 0.0277 | 0.5742 | 0.4516 | - | 0.0362 | 0.013 |
| Significance of main effects and interactions | ||||||
| ED | <0.0001 | <0.0001 | <0.0001 | - | <0.0001 | <0.0001 |
| MR | <0.0001 | <0.0001 | <0.0001 | - | <0.0001 | <0.0001 |
| ED × MR | <0.0001 | <0.0001 | <0.0001 | - | <0.0001 | <0.0001 |
† Napier grass was mixed thoroughly without sugarcane top (Control, S0) or with 10% (S1), 20% (S2), 30% (S3), 40% (S4), 50% (S5), 60% (S6), 70% (S7), 80% (S8), 90% (S9), and 100% (S10) sugarcane top based on fresh weight, respectively. ND, not detected; SEM, standard error of the mean. Values with different small letter superscripts mean significant difference (p < 0.05), while those with the same or no letter superscripts mean no significant difference (p > 0.05).
Changes in counts of viable microorganisms of Napier grass, sugarcane top, and their mixed silages during fermentation.
| Item | Lactic Acid Bacteria | Yeasts | Molds |
|---|---|---|---|
| log cfu/g FM | |||
| Ensiling days mean (ED) | |||
| 1 | 4.41 e | 4.35 e | ND |
| 3 | 4.47 d | 4.38 e | ND |
| 5 | 4.49 d | 4.56 c | ND |
| 7 | 4.61 c | 4.60 b | ND |
| 15 | 4.99 b | 4.87 a | ND |
| 30 | 6.51 a | 4.43 d | ND |
| 60 | 6.52 a | 4.45 d | ND |
| Mixture ratios mean (MR) | |||
| S0 † | 4.95 e | 4.52 | ND |
| S1 | 5.08 d | 4.52 | ND |
| S2 | 5.09 d | 4.52 | ND |
| S3 | 5.13 bcd | 4.54 | ND |
| S4 | 5.18 abc | 4.52 | ND |
| S5 | 5.15 abcd | 4.54 | ND |
| S6 | 5.22 a | 4.5 | ND |
| S7 | 5.23 a | 4.5 | ND |
| S8 | 5.22 a | 4.51 | ND |
| S9 | 5.21 ab | 4.52 | ND |
| S10 | 5.12 cd | 4.51 | ND |
| SEM | 0.0741 | 0.0391 | - |
| Significance of main effects and interactions | |||
| ED | <0.0001 | <0.0001 | - |
| MR | <0.0001 | 0.6832 | - |
| ED × MR | <0.0001 | 0.2111 | - |
† Napier grass was mixed thoroughly without sugarcane top (Control, S0) or with 10% (S1), 20% (S2), 30% (S3), 40% (S4), 50% (S5), 60% (S6), 70% (S7), 80% (S8), 90% (S9), and 100% (S10) sugarcane top based on fresh weight, respectively. FM, fresh matter; ND, not detected; SEM, standard error of the mean. Values with different small letter superscripts mean significant difference (p < 0.05), while those with the same or no letter superscripts mean no significant difference (p > 0.05).
Changes in bacterial alpha diversity parameters of Napier grass, sugarcane top, and their mixed silages stored at 7, 30, and 60 d.
| Ensiling Days | Mixture Rations | ACE | Chao1 | Simpson | Shannon | Coverage |
|---|---|---|---|---|---|---|
| 7 | S0 † | 193.89 ab | 204.58 a | 0.78 abc | 2.95 d | 0.9998 |
| S1 | 195.23 ab | 202.68 a | 0.78 abc | 3.30 cd | 0.9998 | |
| S2 | 205.91 a | 219.40 a | 0.75 bcd | 3.34 bcd | 0.9998 | |
| S3 | 154.62 ab | 163.00 ab | 0.75 bcd | 3.25 d | 0.9999 | |
| S4 | 133.30 b | 137.25 b | 0.68 d | 3.09 d | 0.9999 | |
| S5 | 197.71 ab | 203.94 a | 0.73 cd | 3.38 bcd | 0.9999 | |
| S6 | 171.89 ab | 175.29 ab | 0.72 cd | 3.34 bcd | 0.9998 | |
| S7 | 188.47 ab | 190.35 ab | 0.80 abc | 3.77 ab | 0.9999 | |
| S8 | 169.81 ab | 177.46 ab | 0.84 a | 3.86 a | 0.9998 | |
| S9 | 152.70 ab | 156.42 ab | 0.84 a | 3.75 ab | 0.9999 | |
| S10 | 187.04 ab | 200.50 a | 0.83 ab | 3.73 abc | 0.9998 | |
| p-Value | 0.2424 | 0.1208 | 0.0034 | 0.0009 | 0.1526 | |
| 30 | S0 | 126.04 c | 133.30 d | 0.67 c | 2.54 d | 0.9998 |
| S1 | 129.69 c | 133.56 d | 0.63 c | 2.55 d | 0.9999 | |
| S2 | 154.05 bc | 158.66 bcd | 0.60 c | 2.67 d | 0.9998 | |
| S3 | 151.74 bc | 153.76 cd | 0.62 c | 2.76 cd | 0.9999 | |
| S4 | 171.84 ab | 176.57 abcd | 0.69 bc | 3.23 bc | 0.9998 | |
| S5 | 191.17 ab | 195.10 abc | 0.77 ab | 3.67 ab | 0.9998 | |
| S6 | 187.60 ab | 195.98 abc | 0.78 ab | 3.69 ab | 0.9998 | |
| S7 | 197.78 a | 202.49 ab | 0.85 a | 4.12 a | 0.9997 | |
| S8 | 205.04 a | 216.09 a | 0.85 a | 4.07 a | 0.9998 | |
| S9 | 179.04 ab | 189.14 abc | 0.85 a | 4.03 a | 0.9998 | |
| S10 | 154.35 bc | 157.39 bcd | 0.69 bc | 2.81 cd | 0.9998 | |
| p-Value | 0.0018 | 0.0021 | <0.0001 | <0.0001 | 0.1633 | |
| 60 | S0 | 178.94 b | 184.60 b | 0.78 c | 3.32 c | 0.9998 |
| S1 | 186.81 b | 196.33 b | 0.75 c | 3.42 c | 0.9998 | |
| S2 | 204.11 b | 207.90 b | 0.91 ab | 4.73 b | 0.9999 | |
| S3 | 211.96 b | 215.75 b | 0.93 ab | 4.89 ab | 0.9998 | |
| S4 | 234.16 b | 234.45 b | 0.95 a | 5.37 a | 0.9999 | |
| S5 | 178.18 b | 182.56 b | 0.94 a | 5.05 ab | 0.9999 | |
| S6 | 202.07 b | 202.96 b | 0.93 ab | 5.03 ab | 0.9999 | |
| S7 | 190.13 b | 194.28 b | 0.93 ab | 4.98 ab | 0.9999 | |
| S8 | 209.27 b | 212.53 b | 0.94 a | 5.18 ab | 0.9999 | |
| S9 | 318.48 b | 322.32 b | 0.91 ab | 4.92 ab | 0.9999 | |
| S10 | 667.09 a | 677.17 a | 0.89 b | 4.91 ab | 0.9999 | |
| p-Value | <0.0001 | <0.0001 | <0.0001 | <0.0001 | 0.3009 | |
† Napier grass was mixed thoroughly without sugarcane top (Control, S0) or with 10% (S1), 20% (S2), 30% (S3), 40% (S4), 50% (S5), 60% (S6), 70% (S7), 80% (S8), 90% (S9), and 100% (S10) sugarcane top based on fresh weight, respectively. Values with different small letter superscripts mean significant difference (p < 0.05), while those with the same or no letter superscripts mean no significant difference (p > 0.05).
References
1. Thorat, B.S.; Pawar, G.R.; Sushir, K.V.; Talekar, S.D.; Repale, J.M.; Kadlag, A.D. Sugarcane: A Climate Resilient Devine Crop. Int. J. Environ. Clim. Chang.; 2024; 14, pp. 555-577. [DOI: https://dx.doi.org/10.9734/ijecc/2024/v14i34065]
2. Guo, X.; Xu, D.; Li, F.; Bai, J.; Su, R. Current approaches on the roles of lactic acid bacteria in crop silage. Microb. Biotechnol.; 2022; 16, pp. 67-87. [DOI: https://dx.doi.org/10.1111/1751-7915.14184]
3. Daniel, J.L.P.; Jacovaci, F.A.; Junges, D.; Santos, M.C.; Lima, J.R.; Anjos, I.A.; Landell, M.G.A.; Huhtanen, P.; Nussio, L.G. Fibre digestibility and its relationships with chemical and morphological traits in thirty-two sugarcane varieties. Grass Forage Sci.; 2016; 72, pp. 545-555. [DOI: https://dx.doi.org/10.1111/gfs.12254]
4. National Bureau of Statistics of China. NBS: China Statistical Yearbook, 12th, ed.; China Statistics Press: Beijing, China, 2023.
5. Li, M.; Zi, X.; Yang, H.; Ji, F.; Tang, J.; Lv, R.; Zhou, H. Effects of king grass and sugarcane top in the absence or presence of exogenous enzymes on the growth performance and rumen microbiota diversity of goats. Trop. Anim. Health Prod.; 2021; 53, 106. [DOI: https://dx.doi.org/10.1007/s11250-020-02544-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33417104]
6. Santos, F.; Eichler, P.; Machado, G.; De Mattia, J.; De Souza, G. By-Products of the Sugarcane Industry. Sugarcane Biorefinery, Technology and Perspectives; Elsevier: Amsterdam, The Netherlands, 2020; pp. 21-48.
7. Salinas-Chavira, J.; Almaguer, L.J.; Aguilera-Aceves, C.E.; Zinn, R.A.; Mellado, M.; Ruiz-Barrera, O. Effect of substitution of sorghum stover with sugarcane top silage on ruminal dry matter degradability of diets and growth performance of feedlot hair lambs. Small Rumin. Res.; 2013; 112, pp. 73-77. [DOI: https://dx.doi.org/10.1016/j.smallrumres.2012.10.002]
8. Xie, H.; Peng, L.; Li, M.; Guo, Y.; Liang, X.; Peng, K.; Yang, C. Effects of mixed sugarcane tops and napiergrass silages on fermentative quality, nutritional value, and milk yield in water buffaloes. Anim. Sci. J.; 2023; 94, e13824. [DOI: https://dx.doi.org/10.1111/asj.13824]
9. Muraro, G.B.; de Almeida Carvalho-Estrada, P.; de Oliveira Pasetti, M.H.; Santos, M.C.; Nussio, L.G. Bacterial dynamics of sugarcane silage in the tropics. Environ. Microbiol.; 2021; 23, pp. 5979-5991. [DOI: https://dx.doi.org/10.1111/1462-2920.15428]
10. Islam, M.R.; Garcia, S.C.; Islam, M.A.; Bashar, M.K.; Roy, A.; Roy, B.K.; Sarker, N.R.; Clark, C.E.F. Ruminant Production from Napier Grass (Pennisetum purpureum Schum): A Review. Animals; 2024; 14, 467. [DOI: https://dx.doi.org/10.3390/ani14030467]
11. Nazar, M.; Wang, S.; Zhao, J.; Dong, Z.; Li, J.; Ali Kaka, N.; Shao, T. Effects of various epiphytic microbiota inoculation on the fermentation quality and microbial community dynamics during the ensiling of sterile Napier grass. J. Appl. Microbiol.; 2021; 130, pp. 1466-1480. [DOI: https://dx.doi.org/10.1111/jam.14896]
12. Zhao, G.; Wu, H.; Li, L.; He, J.; Hu, Z.; Yang, X.; Xie, X. Effects of applying cellulase and starch on the fermentation characteristics and microbial communities of Napier grass (Pennisetum purpureum Schum.) silage. J. Anim. Sci. Technol.; 2021; 63, pp. 1301-1313. [DOI: https://dx.doi.org/10.5187/jast.2021.e107]
13. Li, J.; Tang, X.; Zhao, J.; Chen, S.; Wang, S.; Shao, T. Improvement of fermentation quality and cellulose convertibility of Napier grass silage by inoculation of cellulolytic bacteria from Tibetan yak (Bos grunniens). J. Appl. Microbiol.; 2021; 130, pp. 1857-1867. [DOI: https://dx.doi.org/10.1111/jam.14917] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33128833]
14. Gonçalves, T.R.; da Silva Filho, J.R.V.; Pereira, G.A.; Meira, T.M.; de Sá, M.K.N.; Gois, G.C.; de Souza Silva, C.; Campos, F.S.; Yamamoto, S.M.; de Araújo, G.G.L. Potential use of vitiviniculture waste in mixed cactus pear silages with elephant grass in lamb diet. Anim. Feed. Sci. Technol.; 2024; 307, 115824. [DOI: https://dx.doi.org/10.1016/j.anifeedsci.2023.115824]
15. Chen, D.; Zheng, M.; Zhou, Y.; Gao, L.; Zhou, W.; Wang, M.; Zhu, Y.; Xu, W. Improving the quality of Napier grass silage with pyroligneous acid: Fermentation, aerobic stability, and microbial communities. Front. Microbiol.; 2022; 13, 1034198. [DOI: https://dx.doi.org/10.3389/fmicb.2022.1034198]
16. Sánchez-Guerra, N.A.; Gonzalez-Ronquillo, M.; Anderson, R.C.; Hume, M.E.; Ruiz-Albarrán, M.; Bautista-Martínez, Y.; Zúñiga-Serrano, A.; Nájera-Pedraza, O.G.; Salinas-Chavira, J. Improvements in fermentation and nutritive quality of elephant grass [Cenchrus purpureus (Schumach.) Morrone] silages: A review. Trop. Anim. Health Prod.; 2024; 56, pp. 1-16. [DOI: https://dx.doi.org/10.1007/s11250-024-04027-6]
17. Li, H.; Ran, Q.; Jia, Z.; Shuai, Y.; Zhou, Q.; Guan, H. Effect of different dry matter content on fermentation characteristics and nutritional quality of Napier grass silage with novel lactic acid bacteria strains. Lett. Appl. Microbiol.; 2023; 76, ovad018. [DOI: https://dx.doi.org/10.1093/lambio/ovad018] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36722167]
18. Jaipolsaen, N.; Sangsritavong, S.; Uengwetwanit, T.; Angthong, P.; Plengvidhya, V.; Rungrassamee, W.; Yammuenart, S. Comparison of the Effects of Microbial Inoculants on Fermentation Quality and Microbiota in Napier Grass (Pennisetum purpureum) and Corn (Zea mays L.) Silage. Front. Microbiol.; 2022; 12, 784535. [DOI: https://dx.doi.org/10.3389/fmicb.2021.784535]
19. Mitiku, A.A.; Andeta, A.F.; Borremans, A.; Lievens, B.; Bossaert, S.; Crauwels, S.; Aernouts, B.; Kechero, Y.; Van Campenhout, L. Silage making of maize stover and banana pseudostem under South Ethiopian conditions: Evolution of pH, dry matter and microbiological profile. Microb. Biotechnol.; 2020; 13, pp. 1477-1488. [DOI: https://dx.doi.org/10.1111/1751-7915.13626]
20. Bai, J.; Ding, Z.; Ke, W.; Xu, D.; Wang, M.; Huang, W.; Zhang, Y.; Liu, F.; Guo, X. Different lactic acid bacteria and their combinations regulated the fermentation process of ensiled alfalfa: Ensiling characteristics, dynamics of bacterial community and their functional shifts. Microb. Biotechnol.; 2021; 14, pp. 1171-1182. [DOI: https://dx.doi.org/10.1111/1751-7915.13785]
21. Zhang, S.J.; Chaudhry, A.S.; Osman, A.; Shi, C.Q.; Edwards, G.R.; Dewhurst, R.J.; Cheng, L. Associative effects of ensiling mixtures of sweet sorghum and alfalfa on nutritive value, fermentation and methane characteristics. Anim. Feed Sci. Technol.; 2015; 206, pp. 29-38. [DOI: https://dx.doi.org/10.1016/j.anifeedsci.2015.05.006]
22. Ren, H.; Feng, Y.; Liu, T.; Li, J.; Wang, Z.; Fu, S.; Zheng, Y.; Peng, Z. Effects of different simulated seasonal temperatures on the fermentation characteristics and microbial community diversities of the maize straw and cabbage waste co-ensiling system. Sci. Total Environ.; 2020; 708, 135113. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2019.135113]
23. Lee, Y.H.; Ahmadi, F.; Kim, Y.I.; Oh, Y.K.; Kwak, W.S. Co-ensiling garlic stalk with citrus pulp improves the fermentation quality and feed-nutritional value. Asian-Australas. J. Anim. Sci.; 2020; 33, pp. 436-445. [DOI: https://dx.doi.org/10.5713/ajas.19.0464] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31480136]
24. Larsen, S.U.; Hjort-Gregersen, K.; Vazifehkhoran, A.H.; Triolo, J.M. Co-ensiling of straw with sugar beet leaves increases the methane yield from straw. Bioresour. Technol.; 2017; 245, pp. 106-115. [DOI: https://dx.doi.org/10.1016/j.biortech.2017.08.117] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28892679]
25. Hillion, M.L.; Moscoviz, R.; Trably, E.; Leblanc, Y.; Bernet, N.; Torrijos, M.; Escudié, R. Co-ensiling as a new technique for long-term storage of agro-industrial waste with low sugar content prior to anaerobic digestion. Waste Manag.; 2018; 71, pp. 147-155. [DOI: https://dx.doi.org/10.1016/j.wasman.2017.10.024] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29102356]
26. Du, G.; Zhang, G.; Shi, J.; Zhang, J.; Ma, Z.; Liu, X.; Yuan, C.; Li, X.; Zhang, B. Keystone Taxa lactiplantibacillus and Lacticaseibacillus Directly Improve the Ensiling Performance and Microflora Profile in Co-Ensiling Cabbage Byproduct and Rice Straw. Microorganisms; 2021; 9, 1099. [DOI: https://dx.doi.org/10.3390/microorganisms9051099]
27. Cheng, Q.; Li, P.; Xiao, B.; Yang, F.; Li, D.; Ge, G.; Jia, Y.; Bai, S. Effects of LAB inoculant and cellulase on the fermentation quality and chemical composition of forage soybean silage prepared with corn stover. Grassl. Sci.; 2021; 67, pp. 83-90. [DOI: https://dx.doi.org/10.1111/grs.12289]
28. Li, P.; Zhang, Y.; Gou, W.; Cheng, Q.; Bai, S.; Cai, Y. Silage fermentation and bacterial community of bur clover, annual ryegrass and their mixtures prepared with microbial inoculant and chemical additive. Anim. Feed Sci. Technol.; 2019; 247, pp. 285-293. [DOI: https://dx.doi.org/10.1016/j.anifeedsci.2018.11.009]
29. Xu, D.; Wang, N.; Rinne, M.; Ke, W.; Weinberg, Z.G.; Da, M.; Bai, J.; Zhang, Y.; Li, F.; Guo, X. The bacterial community and metabolome dynamics and their interactions modulate fermentation process of whole crop corn silage prepared with or without inoculants. Microb. Biotechnol.; 2020; 14, pp. 561-576. [DOI: https://dx.doi.org/10.1111/1751-7915.13623]
30. AOAC: Official Methods of Analysis. Association of Official Analytical Chemists; 15th ed. AOAC: Arlington, VA, USA, 1990.
31. Van Soest, P.J.; Robertson, J.B.; Lewis, B.A. Methods for Dietary Fiber, Neutral Detergent Fiber, and Nonstarch Polysaccharides in Relation to Animal Nutrition. J. Dairy Sci.; 1991; 74, pp. 3583-3597. [DOI: https://dx.doi.org/10.3168/jds.S0022-0302(91)78551-2]
32. Udén, P. In vitro studies on microbial efficiency from two cuts of ryegrass (Lolium perenne, cv. Aberdart) with different proportions of sugars and protein. Anim. Feed. Sci. Technol.; 2006; 126, pp. 145-156. [DOI: https://dx.doi.org/10.1016/j.anifeedsci.2005.06.008]
33. Cai, Y. Analysis Method for Silage. Japanese Society of Grassland Science; Field and Laboratory Methods for Grassland Science. Tosho Printing Co., Ltd.: Tokyo, Japan, 2004; pp. 279-282.
34. Xie, H.; Xie, F.; Guo, Y.; Liang, X.; Peng, L.; Li, M.; Tang, Z.; Peng, K.; Yang, C. Fermentation quality, nutritive value and in vitro ruminal digestion of Napier grass, sugarcane top and their mixed silages prepared using lactic acid bacteria and formic acid. Grassl. Sci.; 2023; 69, pp. 23-32. [DOI: https://dx.doi.org/10.1111/grs.12382]
35. Broderick, G.A.; Kang, J.H. Automated Simultaneous Determination of Ammonia and Total Amino Acids in Ruminal Fluid and In Vitro Media. J. Dairy Sci.; 1980; 63, pp. 64-75. [DOI: https://dx.doi.org/10.3168/jds.S0022-0302(80)82888-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/7372898]
36. Cao, Y.; Cai, Y.; Hirakubo, T.; Fukui, H.; Matsuyama, H. Fermentation characteristics and microorganism composition of total mixed ration silage with local food by-products in different seasons. Anim. Sci. J.; 2011; 82, pp. 259-266. [DOI: https://dx.doi.org/10.1111/j.1740-0929.2010.00840.x]
37. Borreani, G.I.O.R.G.I.O.; Tabacco, E.R.N.E.S.T.O.; Schmidt, R.J.; Holmes, B.J.; Muck, R.A. Factors affecting dry matter and quality losses in silages. J. Dairy Sci.; 2018; 101, pp. 3952-3979. [DOI: https://dx.doi.org/10.3168/jds.2017-13837]
38. Zhang, L.; Li, X.; Wang, S.; Zhao, J.; Dong, Z.; Zhao, Q.; Xu, Y.; Pan, X.; Shao, T. Effect of Sorbic Acid, Ethanol, Molasses, Previously Fermented Juice and Combined Additives on Ensiling Characteristics and Nutritive Value of Napiergrass (Pennisetum purpureum) Silage. Fermentation; 2022; 8, 528. [DOI: https://dx.doi.org/10.3390/fermentation8100528]
39. Tao, X.; Chen, S.; Zhao, J.; Wang, S.; Li, J.; Sun, F.; Shao, T. Fermentation and aerobic stability of Napier grass silage treated with different levels of citric acid residue. Grassl. Sci.; 2021; 67, pp. 139-147. [DOI: https://dx.doi.org/10.1111/grs.12298]
40. Cai, Y.; Du, Z.; Yamasaki, S.; Nguluve, D.; Tinga, B.; Macome, F.; Oya, T. Influence of microbial additive on microbial populations, ensiling characteristics, and spoilage loss of delayed sealing silage of Napier grass. Asian-Australas J Anim Sci.; 2020; 33, pp. 1103-1112. [DOI: https://dx.doi.org/10.5713/ajas.19.0471]
41. Mugabe, W.; Shao, T.; Li, J.; Dong, Z.; Yuan, X. Effect of hexanoic acid, Lactobacillus plantarum and their combination on the aerobic stability of napier grass silage. J. Appl. Microbiol.; 2020; 129, pp. 823-831. [DOI: https://dx.doi.org/10.1111/jam.14650]
42. Bureenok, S.; Yuangklang, C.; Vasupen, K.; Schonewille, J.T.; Kawamoto, Y. The effects of additives in napier grass silages on chemical composition, feed intake, nutrient digestibility and rumen fermentation. Asian-Australas. J. Anim. Sci.; 2012; 25, pp. 1248-1254. [DOI: https://dx.doi.org/10.5713/ajas.2012.12081]
43. Wang, C.; He, L.; Xing, Y.; Zhou, W.; Yang, F.; Chen, X.; Zhang, Q. Effects of mixing Neolamarckia cadamba leaves on fermentation quality, microbial community of high moisture alfalfa and stylo silage. Microb. Biotechnol.; 2019; 12, pp. 869-878. [DOI: https://dx.doi.org/10.1111/1751-7915.13429]
44. Zhang, J.; Liu, Y.; Wang, Z.; Bao, J.; Zhao, M.; Si, Q.; Sun, P.; Ge, G.; Jia, Y. Effects of Different Types of LAB on Dynamic Fermentation Quality and Microbial Community of Native Grass Silage during Anaerobic Fermentation and Aerobic Exposure. Microorganisms; 2023; 11, 513. [DOI: https://dx.doi.org/10.3390/microorganisms11020513]
45. Tatlı Seven, P.; Yıldırım, E.N.; Seven, İ.; Kaya, C.A.; İflazoğlu Mutlu, S. An evaluation of the effectiveness of sumac and molasses as additives for alfalfa silage: Influence on nutrient composition, in vitro degradability and fermentation quality. J. Anim. Physiol. Anim. Nutr.; 2024; 108, pp. 1096-1106. [DOI: https://dx.doi.org/10.1111/jpn.13955] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38563274]
46. Kim, D.H.; Lee, K.D.; Choi, K.C. Role of LAB in silage fermentation: Effect on nutritional quality and organic acid production—An overview. AIMS Agric. Food; 2021; 6, pp. 216-234. [DOI: https://dx.doi.org/10.3934/agrfood.2021014]
47. Broberg, A.; Jacobsson, K.; Ström, K.; Schnürer, J. Metabolite profiles of lactic acid bacteria in grass silage. Appl. Environ. Microbiol.; 2007; 73, pp. 5547-5552. [DOI: https://dx.doi.org/10.1128/AEM.02939-06]
48. Wang, L.; Guan, L.; Fang, J.; Cai, Y.; Cao, Y. Fermentation characteristics and in vitro ruminal digestion of yacon residue silage with lactic acid bacteria inoculant or beet pulp. Rev. Bras. Zootec.; 2019; 48, e20180152. [DOI: https://dx.doi.org/10.1590/rbz4820180152]
49. Cao, Y.; Cai, Y.; Takahashi, T.; Yoshida, N.; Tohno, M.; Uegaki, R.; Nonaka, K.; Terada, F. Effect of lactic acid bacteria inoculant and beet pulp addition on fermentation characteristics and in vitro ruminal digestion of vegetable residue silage. J. Dairy Sci.; 2011; 94, pp. 3902-3912. [DOI: https://dx.doi.org/10.3168/jds.2010-3623]
50. Ni, K.; Zhao, J.; Zhu, B.; Su, R.; Pan, Y.; Ma, J.; Zhou, G.; Tao, Y.; Liu, X.; Zhong, J. Assessing the fermentation quality and microbial community of the mixed silage of forage soybean with crop corn or sorghum. Bioresour. Technol.; 2018; 265, pp. 563-567. [DOI: https://dx.doi.org/10.1016/j.biortech.2018.05.097]
51. Wu, P.; Li, L.; Jiang, J.; Sun, Y.; Yuan, Z.; Feng, X.; Guo, Y. Effects of fermentative and non-fermentative additives on silage quality and anaerobic digestion performance of Pennisetum purpureum. Bioresour. Technol.; 2020; 297, 122425. [DOI: https://dx.doi.org/10.1016/j.biortech.2019.122425]
52. de Moura Zanine, A.; de Sene, O.A.; de Jesus Ferreira, D.; Parente, H.N.; de Oliveira Maia Parente, M.; Pinho, R.M.A.; Santos, E.M.; Nascimento, T.V.C.; de Oliveira Lima, A.G.V.; Perazzo, A.F. et al. Fermentative profile, losses and chemical composition of silage soybean genotypes amended with sugarcane levels. Sci. Rep.; 2020; 10, 21064. [DOI: https://dx.doi.org/10.1038/s41598-020-78217-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33273674]
53. Tang, X.; Liao, C.; Huang, X.; Chen, C.; Xu, D.; Chen, C. Epiphytic microbiota source stimulates the fermentation profile and bacterial community of alfalfa-corn mixed silage. Front. Microbiol.; 2024; 14, 1247254. [DOI: https://dx.doi.org/10.3389/fmicb.2023.1247254]
54. Gharechahi, J.; Kharazian, Z.A.; Sarikhan, S.; Jouzani, G.S.; Aghdasi, M.; Hosseini Salekdeh, G. The dynamics of the bacterial communities developed in maize silage. Microb. Biotechnol.; 2017; 10, pp. 1663-1676. [DOI: https://dx.doi.org/10.1111/1751-7915.12751]
55. Keshri, J.; Chen, Y.; Pinto, R.; Kroupitski, Y.; Weinberg, Z.G.; Sela Saldinger, S. Bacterial Dynamics of Wheat Silage. Front. Microbiol.; 2019; 10, 1532. [DOI: https://dx.doi.org/10.3389/fmicb.2019.01532] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/31354651]
56. Mpanza, T.D.E.; Mani, S. Effects of Vachellia mearnsii Tannin Extract as an Additive on Fermentation Quality, Aerobic Stability, and Microbial Modulation of Maize Silage. Microorganisms; 2023; 11, 2767. [DOI: https://dx.doi.org/10.3390/microorganisms11112767]
57. Margalho, L.P.; Jorge, G.P.; Noleto, D.A.; Silva, C.E.; Abreu, J.S.; Piran, M.V.; Brocchi, M.; Sant’Ana, A.S. Biopreservation and probiotic potential of a large set of lactic acid bacteria isolated from Brazilian artisanal cheeses: From screening to in product approach. Microbiol. Res.; 2021; 242, 126622. [DOI: https://dx.doi.org/10.1016/j.micres.2020.126622] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33099234]
58. Gonda, H.; Nikodinoska, I.; Le Cocq, K.; Moran, C.A. Efficacy of six lactic acid bacteria strains as silage inoculants in forages with different dry matter and water-soluble carbohydrate content. Grass Forage Sci.; 2023; 78, pp. 636-647. [DOI: https://dx.doi.org/10.1111/gfs.12622]
59. Li, D.; Xie, H.; Zeng, F.; Luo, X.; Peng, L.; Sun, X.; Wang, X.; Yang, C. An Assessment on the Fermentation Quality and Bacterial Community of Corn Straw Silagewith Pineapple Residue. Fermentation; 2024; 10, 242. [DOI: https://dx.doi.org/10.3390/fermentation10050242]
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Zeng, Fanquan; Luo, Xianqing; Li, Zhipei; Pan, Yuhong; Guo, Yanxia; Peng, Lijuan; Li, Liang; Li, Jingzhen; Liang, Yuchen; Yang, Chengjian