Generation of isogenic models of Angelman syndrome and Prader-Willi syndrome in CRISPR/Cas9-engineered human embryonic stem cells

Abstract

Angelman syndrome (AS) and Prader-Willi syndrome (PWS), two distinct neurodevelopmental disorders, result from loss of expression from imprinted genes in the chromosome 15q11-13 locus most commonly caused by a megabase-scale deletion on either the maternal or paternal allele, respectively. Each occurs at an approximate incidence of 1/15,000 to 1/30,000 live births and has a range of debilitating phenotypes. Patient-derived induced pluripotent stem cells (iPSCs) have been valuable tools to understand human-relevant gene regulation at this locus and have contributed to the development of therapeutic approaches for AS. Nonetheless, gaps remain in our understanding of how these deletions contribute to dysregulation and phenotypes of AS and PWS. Variability across cell lines due to donor differences, reprogramming methods, and genetic background make it challenging to fill these gaps in knowledge without substantially increasing the number of cell lines used in the analyses. Isogenic cell lines that differ only by the genetic mutation causing the disease can ease this burden without requiring such a large number of cell lines. Here, we describe the development of isogenic human embryonic stem cell (hESC) lines modeling the most common genetic subtypes of AS and PWS. These lines allow for a facile interrogation of allele-specific gene regulation at the chromosome 15q11-q13 locus. Additionally, these lines are an important resource to identify and test targeted therapeutic approaches for patients with AS and PWS.

Introduction

Deletions of the maternal or paternal alleles of chromosome 15q11-q13, respectively, cause Angelman syndrome (AS [OMIM #105830]) and Prader-Willi syndrome (PWS [OMIM #176270]). Each occur at an approximate incidence of 1/15,000 to 1/30,000 live births [1–3]. Clinical features of AS include seizures, intellectual disability, absent speech, ataxia, and characteristic happy demeanor [4]. Other common features include microcephaly, abnormal EEG, sleep disturbances, strabismus, and, in cases where OCA2 is deleted, hypopigmentation [5]. AS can be attributed to loss of function of UBE3A [6, 7]. Clinical features of PWS include neonatal hypotonia and failure-to-thrive during infancy, followed by hyperphagia and obesity; small stature, hands and feet; mild to moderate cognitive deficit and behavioral problems similar to obsessive–compulsive disorder [8–10]. While PWS is generally thought to be a contiguous gene disorder, recently described microdeletion cases encompassing just the SNORD116 cluster highlight its crucial role in PWS pathophysiology [11]. Another rare neurodevelopmental disorder which shares some phenotypes with PWS is Schaaf-Yang syndrome (SYS), which is caused by mutations in MAGEL2, a protein-coding gene within the 15q11-q13 locus [12]. AS and PWS can be caused by a few different molecular mechanisms, but the most common is a large deletion, affecting ~70% of patients [13, 14]. The chromosome 15q11-q13 locus harbors intrachromosomal segmental duplications that can misalign during meiosis to generate these “common” large deletions within this chromosomal region [15].

Many of the genes in this region are governed by genomic imprinting, a phenomenon in which genes are expressed exclusively from one parental allele, rendering them functionally haploid. Deletion of single copies of the expressed alleles of these imprinted genes cause their full loss of function. Genomic imprinting at chromosome 15q11-q13 is established in the germline via differential methylation at the Prader-Willi Syndrome Imprinting Center (PWS-IC) [16–18]. The PWS-IC is methylated on the maternal allele and unmethylated on the paternal allele. This region on the unmethylated paternal allele serves as the canonical promoter for SNRPN transcript which is exclusively expressed from the paternally inherited allele. The SNRPN transcript is bi-cistronic, encoding for SNURF and SNRPN [19], and also codes a long non-coding RNA (lncRNA), SNHG14 (reviewed by Ariyanfar & Good, 2022 [20]). SNHG14 can be divided into two units, proximal and distal, based on its expression pattern. The proximal unit is broadly expressed across multiple tissue types and includes SNURF-SNRPN, SNORD107, SNORD64, SNORD108, IPW, SNORD109A, and SNORD116. The distal unit is exclusively expressed in neural cell types and includes SNORD115, SNORD109B, and UBE3A-ATS [21, 22]. The UBE3A-ATS portion of the transcript is responsible for silencing the paternal copy of UBE3A [23], thus expression of UBE3A occurs exclusively from the maternal allele in neurons. Many of the encoded RNAs are of the small nucleolar RNA (snoRNA) class, which are generally thought to be processed by exonucleolytic trimming from the introns of a host gene [24]. SNORD116 and SNORD115 are two clusters of snoRNAs, with 30 individual snoRNA copies and 48 individual snoRNA copies respectively. SNORD116 can be further subdivided into three subgroups: Group I (SNOG1, SNORD116-1 to SNORD116-9), Group II (SNOG2, SNORD116-10 to SNORD116-24), and Group III (SNOG3, SNORD116-25 to SNORD116-30) [21, 25]. Protein-coding genes MKRN3, MAGEL2, and NDN, are positioned upstream of the PWS-IC and are exclusively expressed from the paternally inherited allele.

The generation of patient-derived induced pluripotent stem cells (iPSCs) has led to increased understanding of human gene regulation at the chromosome 15q11-q13 locus [26–29]. However, variability in the genetic background and epigenetic reprogramming between different iPSC lines make it difficult to study the functional consequences of 15q imprinting disorders in neural cells. Here, we report the generation and characterization of isogenic chromosome 15q11-q13 megabase-scale deletions to model the most common genetic subtypes of AS and PWS. These models were built in the well-characterized and user-friendly H9 human embryonic stem cell (hESC) line to make use of the extensive publicly available data [30, 31] and robust neuronal differentiation [32, 33]. The use of isogenic cell lines provides a more rigorous approach to investigate cellular deficits in disease models. These cell lines are well-suited for identifying quantitative molecular and physiological phenotypes, increasing confidence that observed differences between disease and control cells are due to the genetic disorders.

Materials and methods

hESC culture for editing and neuronal differentiation

hESC were maintained on mitotically inactivated mouse embryonic fibroblasts (MEFs) in feeding media which consists of sterile-filtered DMEM/F12 media (Gibco, #11330032) supplemented with 20% Knock Out Serum Replacement (Gibco, #10828028), 1X MEM Non-essential amino acids (Gibco, #11140050), 1mM L-glutamine (Gibco, #25030081) with 0.14% β-mercaptoethanol, and 8ng/mL bFGF (Gibco, #PHG0023). A humidified incubator with 5% CO₂ was used to maintain the cells at 37°C. Stem cells were manually passaged by cutting and pasting colonies every 6 or 7 days using a 28-gauge needle. Stem cell media was replaced daily.

hESC culture for hESC sample collection

To transition cells from feeder conditions to feeder-free conditions, cells were manually passaged by cutting and pasting colonies once confluent. After 5–7 days, any differentiation was manually removed before first passage. hESCs were maintained in mTeSR™ Plus media (STEMCELL Technologies, Catalog #100–0276) on Matrigel™ hESC-Qualified Matrix (Corning™, Catalog #354277) coated 6-well plates in a humidified atmosphere with 5% CO₂ at 37°C. Feeding media was changed daily. Cells were passaged once 80–100% confluency was reached, approximately every 4–5 days. Briefly, media was removed from well(s), well(s) were gently rinsed with sterile PBS, sterile filtered 0.5 mM EDTA in PBS was added to well(s), and the plate was placed back into the incubator undisturbed for 2–5 minutes. After incubation, EDTA solution was gently aspirated from well(s), being careful to not disturb cells. Using a 2-mL serological pipette, 1 mL of media was added to well(s) while gently scraping bottom of well(s) to dislodge cells. 75–125 μL of cell suspension was added to a new well containing 2 mL of culture media supplemented with 10 μM ROCK inhibitor, Y-27632 2HCl (Tocris, #1254).

Genome editing of hESCs

H9 ESCs were obtained from WiCell (WA09) and subsequently engineered with a megabase-scale deletion on either the paternal or maternal chromosome 15q allele. A similar editing and screening strategy has been previously described [34].

Preparation.

A guide RNA targeting GOLGA8 was designed using available guide RNA design tools (GOLGA8 gRNA: CTGGGTGTGAGGGCACGTGG). The guide was cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, #62988) via restriction digestion and ligation. Two days prior to planned genome editing, a 100mm dish of mitotically inactivated DR4 MEFs was prepared. A ~60–75% confluent well of hESCs was treated 24 hours prior to planned genome editing with 10μM ROCK inhibitor, Y-27632 2HCl (Tocris #1254).

Nucleofection. The day of editing, one ~75% confluent well of a 6-well plate of hESCs was treated with Accutase (Millipore Sigma, #SCR005) to release the cells from the plate. The cell suspension was singularized by pipetting and then pelleted. The media was removed from the cell pellet, and cells were resuspended according to the protocol provided for the P3 Primary Cell 4D-Nucleofector Kit (Lonza, V4XP-3024). Briefly, a mixture of 82μL nucleofector solution, 18μL nucleofection supplement, and ~5 μg of CRISPR plasmid was added to the pellet. The pellet was resuspended in the solution by pipetting gently three times using a P200 pipet. The cell suspension was transferred to the nucleofection cuvette and nucleofection was performed on the 4D-Nucleofector (Lonza) on the program for hESC, P3 primary cell protocol. After nucleofection, hESC suspension was immediately transferred to the 100mm dish plated with DR4 MEFs containing hESC feeding media supplemented with 10μM ROCK inhibitor using the transfer pipet included in the kit.

Selection.

Feeding media was changed 24 hours following transfection (Day 1 post-transfection) and supplemented with 0.5–1 ng/μL puromycin and 10μM ROCK inhibitor. As the Cas9 cassette was not stably integrated into these cell lines, selection was continued for 48 hours total to select cells transiently expressing the vector containing the gRNA, Cas9 protein, and puromycin resistance. On Day 2, the media was changed and supplemented with fresh 0.5–1 ng/μL puromycin and 10μM ROCK inhibitor. On Day 3, the media was changed and supplemented with fresh 10μM ROCK inhibitor. Subsequent media changes occurred every other day, supplemented with fresh 10μM ROCK inhibitor. Once small colonies became visible, media changes occurred daily with fresh media alone. After ~2 weeks, each colony was manually passaged into its own well of a 24-well plate coated with MEFs via cutting and pasting. Feeding media in the 24-well plate was supplemented with 10μM ROCK inhibitor to encourage cell attachment. 48 hours after passaging cells, the feeding media was changed. Approximately 4 days after passaging to a 24-well plate, a few colonies from each well were isolated into PCR tube strips and pelleted for screening.

Screening.

The TaqMan® Gene Expression Cells-to-CT™ Kit (Invitrogen™, #4399002) was used to screen clones following manufacturer’s protocol. Briefly, media was removed from cell pellets in PCR tube strips and diluted DNase I lysis solution was added. A reverse transcription (RT) reaction was performed. Finally, a real-time PCR was run utilizing TaqMan™ Assays to measure expression of UBE3A (Hs00166580_m1) (ThermoFisher, #4331182) versus GAPDH (ThermoFisher, #4352934E) in technical duplicates or triplicates at a total reaction volume of 20μL. Clones that were found to have ~50% reduction in UBE3A compared to wild type controls were further expanded and subjected to confirmatory testing. A previously described iPSC line derived from an AS patient (ASdel1-0) [26] was included in the assay as a control line for half UBE3A expression.

Confirmatory testing.

After manually passing clones for expansion and verifying attachment of colonies in new wells, the remainder of cell colonies were scraped from old wells and pelleted in microcentrifuge tubes. Genomic DNA (gDNA) was extracted from clones using a homemade lysis buffer containing 1% sodium dodecyl sulfate (SDS), 75mM NaCl, 25mM EDTA, and 200μg/mL Proteinase K in UltraPure™ DNase/RNase-Free Distilled Water (ThermoFisher, #10977015). Briefly, media was removed from each cell pellet and 250uL of the lysis buffer was added. Tubes were incubated at 60°C overnight. The following day, 85μL of warm 6M (supersaturated) NaCl was added, followed by the addition of 335μL of chloroform. The tubes were capped and then inverted for approximately one minute. Tubes were centrifuged at 9,000 rcf for 10 minutes at room temperature. The top aqueous layer (~335μL) was removed and transferred to a new tube to which an equal amount of 100% isopropanol was added. The tubes were capped and mixed thoroughly by inversion. Tubes were incubated at -20°C for ~10 minutes. Next, the tubes were centrifuged at max speed (~18,000 rcf) for 20 minutes at 4°C. The supernatant was removed, and the pellet was washed with ~600μL of 70% ethanol. Ethanol was removed carefully from the pellet and the tubes were left open so the remainder of the ethanol could evaporate before the pellets were resuspended in 30μL of 10mM Tris (pH 8). TaqMan™ Copy Number Assays comparing UBE3A (Hs01665678_cn)(ThermoFisher, #4400291) to the TaqMan Copy Number Reference Assay for human RNase P (ThermoFisher, #4403326) was performed following manufacturer’s protocol (Applied Biosystems™, Publication Number #4397425) to confirm which clones had lost a copy of UBE3A. The wild type H9 line was used as the calibrator sample with two copies of UBE3A. The same AS1-0 iPSC line used as a control in our screening assay was also included as a control in this assay as it only has one copy of UBE3A. Analysis was conducted using the CopyCaller (v2.1) software (Applied Biosystems®). Further confirmation of which allele was deleted in clones with only one UBE3A copy was performed by utilizing the EpiTect Methyl II DNA Restriction Kit (QIAGEN, #335452) to measure methylation at the PWS-IC (SNRPN) following manufacturer’s protocols. The approximate size of the deletions was determined by CytoSNP array (Illumina, CytoSNP-850K v1.2) through the University of Connecticut Chromosome Core. Clones were further screened for integration of the targeting plasmids via PCR. Three amplicons were designed to test for insertion of the guide RNA sequence, the CMV promoter, and the Cas9 gene. Primers used for each amplicon are listed in S1 Table. Clones with confirmed deletions were expanded, banked down, and subsequently characterized via gene expression arrays in stem cells and neurons.

Neuronal differentiation and maintenance

Neuronal differentiation was performed according to established monolayer differentiation protocols with minor modifications [35–38]. Approximately 1–3 days after passaging hESCs, neuronal differentiation was started (Day 0) by switching feeding media to N2B27 neural induction media supplemented with 500 ng/μL noggin (R&D Systems, #3344-NG). N2B27 neural induction media consisted of Neurobasal™ Medium (Gibco, #21103049), 1X serum free B-27™ Supplement (Gibco, #17504044), 1% N2 supplement, 1% insulin-transferrin-selenium (Gibco, #51300044), 2mM L-glutamine (Gibco, #25030081), and 1% penicillin-streptomycin (Gibco, #15140122). The media was changed every other day for 10 days and supplemented with fresh 500 ng/μL noggin on Days 2, 4, 6, and 8. Between Days 14–17, neuronal rosettes were passaged as small clusters in either a 1:1 or 1:2 ratio using the StemPro™ EZPassage™ Disposable Stem Cell Passaging Tool (Gibco, #23181010) or via hand-picking. Rosettes were plated on poly-D-lysine- (PDL-)(Millipore Sigma, #P0899) and laminin-coated (Gibco, # 23017015) 6-well plates. Fifty percent media replacement was carried out every other day until neural progenitor cells (NPCs) were dense enough for replating. At ~3 weeks, Accutase was used to release the cells from the plate. The cell suspension was singularized by pipetting and then pelleted. The media was removed from the cell pellet, NPCs were resuspended, and replated at a high density onto poly-D-lysine/laminin-coated 6-well plates into N2B27 media containing 10μM ROCK inhibitor. Fifty percent media replacement was carried out every other day. After approximately five weeks of neural differentiation NPCs were dissociated again using Accutase, counted using a hemocytometer, and plated on PDL/laminin-coated 6-well plates with at a density of 150,000–300,000 cells/well in neural differentiation medium (NDM). NDM consisted of Neurobasal™ Medium, 1X serum free B-27™ Supplement, 1X MEM Non-essential amino acids, 2mM L-glutamine, 10ng/mL brain-derived neurotrophic factor (BDNF)(Peprotech, #450–02), and 10ng/mL glial-derived neurotrophic factor (GDNF)(Peprotech, #450–10), 200μM ascorbic acid (Millipore Sigma, #A4544), and 1μM adenosine 3’,5’-cyclic monophosphate (cAMP)(Millipore Sigma, #A9501). To aid in cell attachment, 10μM ROCK inhibitor was added to the NDM during initial plating. Cells were maintained with no antibiotics on NDM, and 50% media replacement was carried out twice per week. Gene expression assays were conducted on neuronal cultures that were at least 10 weeks old.

Gene expression arrays

RNA extraction.

Confluent hESCs or mature hESC-derived neurons were collected and gently pelleted at 4°C. Supernatant media was removed from pellet. Pellet was flash frozen in liquid nitrogen and stored at -80°C until all samples were collected. RNA was harvested using the miRNeasy® Mini Kit (QIAGEN, #1038703) following manufacturer’s protocol with minor modifications. The work surface, pipettes, and centrifuge rotors were treated with RNAse Away (Life Technologies, #10328011) prior to beginning extraction. Pellets were transferred from storage at -80°C to ice. Samples were homogenized in 700 μL QIAzol by pipetting and brief vortexing. Cell lysate was applied to QIAshredder columns (QIAGEN, #1011711). Samples were incubated at room temperature for 5 minutes. Following incubation, 140 μL of chloroform was added to the homogenate and shaken vigorously for 15 seconds. Samples were incubated at room temperature for 2–3 minutes and then centrifuged for 15 minutes at 12,000xg at 4°C. Approximately 400 μL of the aqueous phase was transferred to a new 1.5-mL microcentrifuge tube. A second chloroform extraction was performed by adding an equal volume of chloroform to the aqueous phase and shaking vigorously for 15 seconds. The samples were centrifuged for another 15 minutes at 12,000xg at 4°C, and the aqueous phase (~350 μL) was transferred to a new 1.5-mL microcentrifuge tube to which 1.5 volumes of 100% ethanol was added. The contents of the tube were mixed by pipetting and applied to the RNeasy spin column, following manufacturer’s instructions for on-column DNase treatment using RNase-Free DNase Set (QIAGEN, #79254) and the addition of a second wash with Buffer RPE. RNA was eluted in RNase-Free water and stored at -80°C until RT-qPCR processing. All samples were performed in biological triplicate, one passage apart for hESCs and separate differentiations for neurons.

RT-qPCR.

The High-capacity cDNA Reverse Transcription Kit (Applied Biosystems™, #4368814) was used to generate cDNA from DNase-treated RNA following manufacturer’s protocol. Custom TaqMan Gene Expression Assay Plates (Thermo Fisher Scientific, #4391528) were used with TaqMan™ Gene Expression Master Mix (Applied Biosystems™, #4369016) to measure gene expression following manufacturer’s protocol for a total reaction volume of 20 μL. All samples were performed in technical duplicate or triplicate for each gene measured. The list of TaqMan probe RT-qPCR assays used in the study are provided in S1 Table.

Data analysis

For analysis of qPCR data, first the Ct values for technical replicates were tested for outliers using the Grubbs test (S2 Table). Ct values that fell beyond 99% of the range of the characterized distribution were considered outliers and removes, as has been previously described [39]. The mean Ct value of technical replicates for each gene were normalized to the Ct value for housekeeping gene GAPDH. Relative expression was quantified as 2^-ΔΔCt relative to the wild type H9 sample. Data are presented as the mean relative expression, plus or minus the relative min/max as calculated by error propagation defined by Ahmed and Kim [40]. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a one-way ANOVA followed by Dunnett’s test. **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05. Calculations were performed in Excel and can be found in S2 Table. Bar graph generation was performed using R (v4.2.1) with ggplot2 (v3.4.0) and tidyverse (v1.3.2). Code for plotting can be found at https://github.com/rachelgilmore/qPCRanalysis.

Immunocytochemistry

hESCs were plated on Matrigel-coated acid-treated coverslips. hESC-derived neurons were differentiated as above and plated for terminal differentiation on PDL and laminin-coated acid-treated coverslips. Once hESCs reached ~50% confluency or neurons reached 10 weeks of maturity, wells were rinsed twice with PBS. Cells were fixed at room temperature with 4% paraformaldehyde for 10 min and then permeabilized using PBS plus 0.5% Triton X 100 (PBS-T) for 5 min at room temperature. Following permeabilization, samples were blocked in 0.1% PBS-T containing 2% bovine serum albumin and 5% normal goat serum. Samples were incubated in blocking buffer containing primary antibodies overnight at 4°C in a humidity chamber. The next day the coverslips were washed with three times with 0.1% Triton in PBS for 10 minutes each. Samples were then incubated in blocking buffer containing secondary antibodies for 1 hour at room temperature in the dark. All remaining steps occurred in the dark. The coverslips were washed three times with 0.1% Triton in PBS for 10 minutes each. Coverslips were mounted with ProLong™ Gold Antifade Mountant with DNA Stain DAPI (Invitrogen, Cat# P36941) and allowed to set for 24 hours at room temperature prior to imaging. The following primary antibodies were used: mouse anti-Oct4 (1:200; Abcam ab184665), rat anti-NeuN (1:1000; Abcam ab279279), and rabbit anti-MAP2 (1:800, Abcam ab32454). The following secondary antibodies were used: goat anti-rabbit Alexa Fluor 488 (1:400; Invitrogen A11008), goat anti-rat Alexa Fluor 594 (1:400; Invitrogen A11007), and goat anti-mouse Alexa Fluor 647 (1:400, Invitrogen A21235). Images were acquired using a 20X or 63X objective on a Zeiss Axio Observer Z1 microscope. Representative images were chosen, and image adjustment was performed in ImageJ. In all photos, only the color balance was adjusted. Images were assembled using Adobe Illustrator.

Results

To generate isogenic models of AS and PWS, we sought to recapitulate deletions frequently present in AS or PWS patients. Examination of deletions deposited in ClinVar and DECIPHER [41, 42] revealed breakpoint hotspots that coincide with repeats of GOLGA8 (Fig 1). This repeated sequence described as contributing significantly to substantial instability at this locus [43, 44]. Therefore we pursued targeting these segmental duplications, similar to the approach used to eliminate the Y-chromosome or trisomic chromosome 21 [45, 46]. We previously used a similar CRISPR/Cas9 strategy, with guide RNAs (gRNAs) targeting GOLGA8 and other repetitive sequences in chromosome 15, to evict an extra chromosome and generate an isogenic model for Duplication 15q Syndrome (Dup15q, [OMIM #608636]) [34]. Others have created 15q13.3 microdeletions leveraging this approach [47].

[Figure omitted. See PDF.]

Chromosome ideogram with orange box around region displayed below. First track displays GOLGA8 CRISPR gRNA binding sites. Second track displays GENCODEv19 gene annotations; genes in dark blue are protein coding, genes in green are non-coding, arrows indicate direction of gene transcription. Some gene isoforms have been removed for clarity. GOLGA genes are shown in bold. Third track displays ClinVar copy number variants (CNVs); only deletions with pathogenic or likely pathogenic annotations are shown. Fourth track shows DECIPHER CNVs, only deletions with pathogenic or likely pathogenic annotations are shown.

Building on the concepts utilized in these previous studies, we began by nucleofecting H9 hESCs with a plasmid encoding CRISPR/Cas9 and a single gRNA targeting GOLGA8 repeats on chromosome 15q (Fig 1) (Methods). This gRNA is predicted to target multiple sites within chromosome 15q but is not predicted to target elsewhere in the genome. We screened clones surviving transient puromycin selection, which eliminated cells that did not receive the Cas9/gRNA plasmid, for expression of UBE3A with a TaqMan-based assay (Methods). As stem cells bi-allelically express UBE3A, cell lines harboring AS and PWS related deletions should therefore express approximately half as much UBE3A as the parent H9 line (Fig 2A). This screening method provided us with a high-throughput way to screen 126 clones from 4 separate transfections (S1 Fig and S3 Table). Three clones with reduced UBE3A expression comparable to an Angelman iPSC line (ASdel1-0) were expanded and subject to confirmatory testing. While our initial screen utilized cDNA and relative expression of UBE3A, we confirmed deletions by determining the copy number of UBE3A in genomic DNA (gDNA) extracted from our edited clones. We compared edited clones to wild type H9 samples harboring two UBE3A copies and the ASdel1-0 sample harboring only one UBE3A copy. All three clones were predicted to contain a single UBE3A copy (Methods)(Fig 2B and S4 Table). To determine the parent-of-origin of the deletions in our three cell lines, we subjected gDNA isolated from them to methylation analysis at the Prader-Willi Syndrome Imprinting Center (PWS-IC, SNRPN)(Methods). A wild type cell line will show ~50% methylation at SNRPN, as the paternal allele is unmethylated and the maternal allele is methylated. Previous analysis of patient-derived AS and PWS lines showed that, as expected, PWS deletion lines only have a methylated maternal allele and are ~100% methylated, and AS deletion lines only have an unmethylated paternal allele lacking methylation at this CpG island [26]. The methylation analysis indicated that two of the three clones with reduced UBE3A expression and copy number exhibited a primarily unmethylated PWS-IC resembling AS (H9Δmat15q_1 and H9Δmat15q_2) and one clone exhibited a primarily methylated PWS-IC resembling PWS (H9Δpat15q) (Fig 2C and S5 Table). To determine if the plasmid used to target the deletions might have stably integrated into the genome we screen each clone with three different amplicons. We found no evidence of guide RNA or functional Cas9 gene integration into the genomes of any of the chosen clones (S2 Fig). To determine the approximate size of the deletion, clones were further characterized by a CytoSNP analysis. This analysis revealed an ~5.8Mb deletion in the H9Δmat15q_1 line, an ~8Mb deletion in the H9Δmat15q_2 line, and two deletions totaling ~7Mb in the H9Δpat15q line (S3 Fig). The coordinates of the deletions returned from CytoSNP analysis were displayed as bedtracks in the UCSC genome browser to visually display the size of the deletions and which genes may be impacted (Fig 2D). These deletions coincided well with those observed in patients (S4 Fig), further supporting GOLGA8-driven instability as genetic mechanism leading to AS and PWS.

[Figure omitted. See PDF.]

A) Bar plot of relative UBE3A expression of edited clones compared to wild type (H9) ESCs and Angelman syndrome (ASdel1-0) iPSCs. B) Bar plot of calculated UBE3A copy number of edited clones. Wild type (H9) was used as the calibrator sample and set to 2 copies. Error bars represent calculated copy number range. Copy number and calculated copy number was determined by CopyCaller v2.1 software. C) Stacked bar plot representing methylation status at the PWS-IC/SNRPN locus. Light gray bar represents unmethylated DNA, dark gray bar represents methylated DNA. D) UCSC Genome Browser shot of the chromosome 15q locus. First track displays GOLGA8 CRISPR gRNA binding sites. Second, third, and fourth tracks show deletion contained within each cell line, as determined by CytoSNP. Fifth track displays GENCODEv19 gene annotations; genes in dark blue are protein coding, genes in green are non-coding, arrows indicate direction of gene transcription. Some gene isoforms have been removed for clarity. GOLGA genes are shown in bold.

We next sought to determine the pluripotent potential of these lines and to characterize their gene expression profile in the chromosome 15q locus as ESCs (Methods)(S2 Table). There were very few significant differences in pluripotency genes of the edited cell lines compared to the parental H9 line (Fig 3A). Additionally, we performed immunocytochemistry for Oct4 protein, which was robustly expressed in the line analyzed (S5 Fig). In lines with maternal deletions, imprinted 15q genes showed similar expression to the parental H9 line as expected (Fig 3B). In the paternal deletion line, imprinted 15q genes that are expressed exclusively from the paternal allele showed very little expression compared to the parental H9 line (Fig 3B). This is expected, as these imprinted genes are silenced on the intact maternal allele. This data supported our characterization of which allele was deleted in each cell line. Most bi-allelically expressed 15q genes within the deletion breakpoints showed approximately half of the expression of the parental H9 line (Fig 3C) excluding GABRG3 which was inconclusive (S5 Fig).

[Figure omitted. See PDF.]

qPCR analysis of A) pluripotency markers, B) imprinted genes, and C) bi-allelically expressed genes in the 15q locus in edited clones as ESCs (n = 3 biological replicates). RNA expression is presented relative to the parental H9 ESC line. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a one-way ANOVA followed by Dunnett’s test. Significance is reported as result of Dunnett’s test. **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05.

As differentiation into the neuronal lineage is important for studying these disorders and is crucial for verifying the imprinting status of UBE3A in neurons, we performed neuronal differentiation of all lines (Methods). All lines successfully differentiated into neurons (Fig 4A and S6 Fig). As expected, expression of neuronal genes was comparable to the wild type H9 parental line (Fig 4B and S6 Fig). Along with similar gross morphology and comparable gene expression across samples, immunocytochemistry revealed expression of neuronal proteins MAP2 and NeuN (S6 Fig). Very little expression from imprinted 15q genes was observed for the paternal deletion line (Fig 4C). For maternal deletion lines, most paternally imprinted genes are expressed comparable to that of the parental H9 line as expected, except UBE3A, which was significantly reduced (Fig 4C and S6 Fig). We considered this proof-of-concept that these isogenic AS-like cell line models are capable of imprinting UBE3A following neuronal differentiation. Bi-allelic 15q gene expression maintained a similar expression profile to that observed in ESCs, with most genes contained within the deletion showing approximately half expression compared to the parental H9 line (Fig 4D and S6 Fig). Five of the seven pluripotency genes measured show decreased expression in neurons compared to wild type ESCs, while neuronal genes show robustly increased expression compared to wild type ESCs (S7 Fig). Given that these cell lines readily differentiate into neurons, we anticipate they will provide great utility for understanding the specific role these deletions play in neurodevelopmental phenotypes of AS and PWS.

[Figure omitted. See PDF.]

A) Representative brightfield images of neurons at 20X magnification. Scale bar equals 50 μm. B-D) qPCR analysis of B) neuronal genes C) imprinted genes in the 15q locus and D) bi-allelically expressed genes in the 15q locus in edited clones as mature 10-week neurons (n = 3 biological replicates). RNA expression is presented relative to the parental H9 line. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a one-way ANOVA followed by Dunnett’s test. **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05.

Discussion

While the genetic perturbations contributing to AS and PWS have been known for many years, the effect those anomalies have on the chromosome 15q locus and the genome as a whole remains unclear. Mouse models have provided key understandings about the facets of gene regulation conserved between the two species, but disease features such as the neuron-specific regulation of UBE3A imprinted expression and protein targets of UBE3A appear to be unique to humans [22, 48–50]. Available iPSC models have been powerful tools to study these disorders as well. However, comparison of quantitative molecular phenotypes via multiomics approaches and functional studies of iPSC-derived neurons have been hampered by the variability between iPSC lines. While a prior study engineered a type I deletion modeling PWS into iPSCs through use of multiple CRISPR gRNAs [51], here we have described the first isogenic cell line pairs modeling the most common genetic subtypes of both AS and PWS utilizing a single CRISPR gRNA in a well-characterized H9 ESC line. We reasoned that we may be able to mimic megabase-scale deletions found in patients by targeting chromosome 15q-specific GOLGA8 repeats. We took advantage of the bi-allelic expression of UBE3A, a gene included in the deleted region, in hESCs to rapidly screen for edited clones with reduced expression (Fig 2A and S1 Fig). Our rationale was that if either the maternal or paternal chromosome 15q allele was deleted in this region, we would observe approximately half the UBE3A expression compared to a wild type control. We subjected the clones with reduced UBE3A expression to a more rigorous confirmatory testing utilizing a copy number assay to determine the number of UBE3A copies present in gDNA extracted from each clone (Fig 2B).

As the parent-of-origin of the deletion matters, we utilized differential methylation at the PWS-IC/SNRPN to determine which allele was deleted. The differential methylation at this site has been characterized previously in patient-derived iPSCs [26]. We hypothesized our isogenic models would have comparable methylation signatures to iPSC models if they harbored similar deletions, which was what we observed (Fig 2C). Confident we created deletions on either the paternal or maternal allele, we employed a CytoSNP array to determine the approximate size of the deletion. This assay leveraged microarray technology to detect copy-neutral loss of heterozygosity (LOH), absence of heterozygosity (AOH), and copy number variation (CNV) via gains or losses. While off-target editing is sometimes a concern with CRIPSR/Cas9 editing, CytoSNP analysis did not detect any copy number changes or structural rearrangements aside from the deletions on chromosome 15. Any copy number changes outside of chromosome 15 in the edited hESCs were also present in the parental H9 cell line previously characterized by the lab, supporting the isogenic nature of these cell lines (S3 Fig).

Having determined the parent-of-origin and approximate size of the deletions, we wanted to ensure these edited cell lines were still pluripotent. While the expression profile of the pluripotency markers in edited cell lines did not match exactly to the wild type controls (Fig 3A), this could be caused by differences in the quality of the cultures at the time of collection. The pluripotent potential of the edited cell lines was supported by their ability to differentiate successfully into a neuronal lineage (Fig 4A). We also wanted to examine gene expression within the chromosome 15q locus. We would expect the imprinted gene expression in maternal deletion lines to be consistent with the parental wild type line, as the imprinted and unexpressed copy of each gene was deleted. We observe no significant differences in imprinted 15q gene expression in maternal deletion ESC lines, however we do notice some significant differences in imprinted genes in the H9Δmat15q_2 line in 10-week neurons (Fig 4C). We believe these differences are driven by one sample which was analyzed via qPCR at a lower concentration. We decided to include this sample in the analysis so there were three biological replicates, though further replication should be performed in future studies to determine if this variation is truly biological in nature. In contrast, we would anticipate little to no expression of the paternally expressed imprinted genes in the paternal deletion line, as the expressed copy of each gene was deleted, which was exactly what we observed (Figs 3B and 4C).

The bi-allelically expressed genes included within the deleted region generally showed approximately half of the expression of the parental H9 line as expected, though the analysis of H9Δmat15q_2 neurons was again complicated by the lower concentration sample. While GABRG3 was included in the deletion generated for all lines, its expression was not reliably measured within our system. Whether this is biological or technical is inconclusive. While UBE3A is bi-allelically expressed in ESCs, the paternal UBE3A copy undergoes silencing in neurons [21–23, 26]. We showed that both maternal deletion demonstrated evidence of UBE3A imprinting (Fig 4C and S6 Fig). Successful neuron differentiation for all lines was shown through typical neuron morphology (Fig 4A and S6 Fig), increase in neuronal gene expression (S7 Fig), neuronal protein expression (S6 Fig), and decrease in expression of pluripotency genes (S7 Fig). SOX2 and KLF4, two genes canonically referred to as pluripotency factors, did not decrease in expression. This could be due to their role in neural stem cell maintenance [52] and neurogenesis [53]. Further functional studies of these hESC-derived neurons could determine if they display similar deficits to those found in iPSC-derived neurons [54].

These isogenic cell lines provide a powerful resource to carefully discern cellular and molecular phenotypes between disease and wild type states for these large chromosomal deletions. We posit that the use of these isogenic pairs will lead to more robust and reproducible results, especially when combined with additional isogenic pairs and/or patient-derived iPSC lines. Additionally, these resources may open the door for the discovery of novel, more specific therapeutic approaches for AS and PWS patients. Lastly, this work adds to the current literature supporting the utility of CRISPR/Cas9 editing to eliminate large regions of the genome and its application to model disorders with large copy number variants.

Supporting information

S1 Fig. Compilation of screening data from UBE3A expression from all clones from all transfections.

Expression of UBE3A is set to a relative value of 1 for the wild type parental H9 line. As later determined through confirmatory testing, H9Δmat15q_1 is designated as Tfx1_Clone13, H9Δmat15q_2 is designated as Tfx4_Clone22, H9Δpat15q is designated as Tfx4_Clone2.

https://doi.org/10.1371/journal.pone.0311565.s001

S2 Fig. Screen for integration of PX459 GOLGA8 guide RNA plasmid.

Plasmid map of PX459 containing guide RNA targeting GOLGA8 repeat sequences. Primers for individual amplicons are indicated on the map. The plasmid was used as a positive control for PCR reactions 1 through 3. An additional amplicon for the TBX5 promoter was used as a positive control for genomic DNA for each PCR reaction (number 4). For each of the lines, including the parental H9 line, the TBX5 amplicon amplified. The PX459 amplicons were detected from purified plasmid DNA but failed to amplify from any genomic DNA sample from edited clones.

https://doi.org/10.1371/journal.pone.0311565.s002

S3 Fig. Reports from CytoSNP array.

H9Δmat15q_1 is designated as H9 AS #13, H9Δmat15q_2 is designated as H9 AS #22, and H9Δpat15q is designated as H9 PWS #2.

https://doi.org/10.1371/journal.pone.0311565.s003

S4 Fig. UCSC genome browser shot of the chromosome 15q locus.

First track displays GOLGA8 CRISPR gRNA binding sites. Second, third, and fourth tracks show deletion contained within each cell line, as determined by CytoSNP. Fifth track displays GENCODEv19 gene annotations; genes in dark blue are protein coding, genes in green are non-coding, arrows indicate direction of gene transcription. Sixth track displays short (<50 bp) variants found in the ClinVar database as a density plot. Seventh track displays ClinVar copy number variants (CNVs); for clarity, only deletions with pathogenic or likely pathogenic annotations are shown. Eighth track shows DECIPHER CNVs, only deletions with pathogenic or likely pathogenic annotations are shown. Ninth track shows conservation scores. Tenth track shows alignment of sequences to other vertebrates.

https://doi.org/10.1371/journal.pone.0311565.s004

S5 Fig. Further characterization of hESCs.

A) Immunocytochemistry for Oct4 with nuclear marker DAPI. Images taken at 20X and 63X. Scale bars equal 50 μm and 25 μm, respectively. B) qPCR analysis of GABRG3 in hESCs (n = 3 biological replicates). RNA expression is presented relative to the parental H9 line. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a one-way ANOVA followed by Dunnett’s test. Significance is reported as the results of Dunnett’s test. * = p < 0.05.

https://doi.org/10.1371/journal.pone.0311565.s005

S6 Fig. Characterization of H9Δmat15q_2 neurons.

A) Representative brightfield images of neurons at 20X magnification. Scale bar equals 50 μm. B) qPCR analysis of neuronal genes. C) Immunocytochemistry for neuronal proteins MAP2 and NeuN. Images taken at 20X and 63X. Scale bars equal 50 μm and 25 μm, respectively. D-E) qPCR analysis of D) imprinted genes and E) bi-allelically expressed genes in the 15q locus. For all qPCR data presented, n = 3 biological replicates. RNA expression is presented relative to the parental H9 line. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a t-Test for two samples assuming equal variances. Significance is reported as the results of the two-tailed test. ** = p<0.01, * = p < 0.05.

https://doi.org/10.1371/journal.pone.0311565.s006

S7 Fig. Comparative analysis of neurons and ESCs.

qPCR analysis of A) pluripotency genes and B) neuronal genes in mature 10-week neurons (n = 3 biological replicates). RNA expression is presented relative to the parental H9 line as ESCs. Error bars represent relative min/max calculated with error propagation. Statistical analysis was performed using a one-way ANOVA followed by Dunnett’s test. Significance is reported as the results of Dunnett’s test. **** p<0.0001, *** p<0.001, ** p<0.01, * p<0.05.

https://doi.org/10.1371/journal.pone.0311565.s007

S1 Table. TaqMan probes used in qPCR and primers used for integration screening.

Gene and probe name for each ThermoFisher TaqMan assay used. Primer names and sequence of each primer used for PCR performed in S2 Fig.

https://doi.org/10.1371/journal.pone.0311565.s008

(XLSX)

S2 Table. qPCR data and analysis.

H9Δmat15q_1 is designated as AS-13, H9Δmat15q_2 is designated as AS-22, and H9Δpat15q is designated as PWS-2. Sheet titled “RT Set Up” details the experimental set up for the reverse transcriptase reaction to convert RNA samples to cDNA. Sheet titled “qPCR Set Up” details the calculations for performing qPCR experiments. Sheet titled “qPCR Data” contains all raw data from qPCR instrument. Sheet titled “Grubbs Test” contains calculations for outlier testing using Grubbs test. Sheet titled “StDev Calc” contains standard deviation calculations between technical replicates and across biological replicates for all samples; TechRep is short for technical replicate, BR is short for biological replicate. Sheet titled “Error Calculation” contains propagated error calculations, which includes technical and biological error. Sheet titled “qPCR Analysis (Cell Type)” contains relative expression calculations for all samples; in this case, ESC samples are compared to WT H9 ESCs which are set to a relative value of 1 and neuron samples are compared to WT H9 neurons which are set to a relative value of 1. Sheet titled “Statistics (Cell Type)” contains all statistics calculations per gene based on calculations performed in “qPCR Analysis (Cell Type).” Sheet titled “For R (Cell Type)” is to be saved as a.csv file and input into R for plotting; this was used to generate Figs 2 and 3B–3D. Sheet titled “qPCR Analysis (to WT ESCs)” contains relative expression calculations for all samples; in this case, all samples are compared to WT H9 ESCs which are set to a relative value of 1. Sheet titled “Statistics (to WT ESCs)” contains all statistics calculations per gene based on calculations performed in “qPCR Analysis (to WT ESCs).” Sheet titled “For R (to WT ESCs)” is to be saved as a.csv file and input into R for plotting; this was used to generate S7 Fig.

https://doi.org/10.1371/journal.pone.0311565.s009

(XLSX)

S3 Table. Raw data from RT-qPCR screening clones for UBE3A expression.

Tfx1-4 stands for transfections 1 through 4. AG1-0 is the ASdel1-0 patient-derived iPSC line. H9 is wild type hESCs.

https://doi.org/10.1371/journal.pone.0311565.s010

(XLSX)

S4 Table. Data from copy number assay for UBE3A.

This data was generated by CopyCaller(v2.1) software.

https://doi.org/10.1371/journal.pone.0311565.s011

(XLSX)

S5 Table. Methylation assay data and analysis.

Sheet titled “Instructions” contains instructions for analyzing custom EpiTect Methyl II PCR Array results. Sheet titled “Gene Table” contains the PCR array name (SNRPN) and the well positions of the cell lines analyzed. Sheet titled “Raw Data” contains the inputted CT values obtained for each digestion for all cell lines. Sheet titled “QC Data Report” contains the auto-calculated failure rate to be used for quality control measures. Sheet titled “Results” contains the auto-calculated percent methylation for each cell line; UM is unmethylated, M is methylated. Sheet titled “Calculations” contains the formulas for the calculations performed. Sheet titled “Summary Raw Data” summarizes the CT values for all digestions for all cell lines.

https://doi.org/10.1371/journal.pone.0311565.s012

(XLSX)

Acknowledgments

This study makes use of data generated by the DECIPHER community. A full list of centres who contributed to the generation of the data is available from https://deciphergenomics.org/about/stats and via email from [email protected]. DECIPHER is hosted by EMBL-EBI and funding for the DECIPHER project was provided by the Wellcome Trust [grant number WT223718/Z/21/Z]. Those who carried out the original analysis and collection of DECIPHER data bear no responsibility for the further analysis or interpretation of the data. We thank Yaling Liu from the University of Connecticut Cell and Genome Engineering Core for her help with expansion and storage of stem cell lines used in this study. We thank Dr. Judy Brown and Lisa LaBelle from the Center for Genome Innovation at the University of Connecticut Institute for Systems Genomics for their help in performing CytoSNP analysis.

References

1. 1. Clayton-Smith J, Pembrey ME. Angelman syndrome. J Med Genet [Internet]. 1992 Jun 1 [cited 2023 Aug 14];29(6):412–5. Available from: https://jmg.bmj.com/content/29/6/412 pmid:1619637

* View Article

* PubMed/NCBI

* Google Scholar

2. 2. Burd L, Vesely B, Martsolf J, Kerbeshian J. Prevalence study of Prader-Willi syndrome in North Dakota. Am J Med Genet [Internet]. 1990 [cited 2023 Aug 14];37(1):97–9. Available from: https://pubmed.ncbi.nlm.nih.gov/2240051/ pmid:2240051

* View Article

* PubMed/NCBI

* Google Scholar

3. 3. Whittington JE, Holland AJ, Webb T, Butler J, Clarke D, Boer H. Population prevalence and estimated birth incidence and mortality rate for people with Prader-Willi syndrome in one UK Health Region. J Med Genet [Internet]. 2001 Nov 1 [cited 2023 Aug 14];38(11):792–8. Available from: https://jmg.bmj.com/content/38/11/792 pmid:11732491

* View Article

* PubMed/NCBI

* Google Scholar

4. 4. Angelman H. ‘Puppet’ Children A Report on Three Cases. Dev Med Child Neurol [Internet]. 1965 Dec 1 [cited 2023 Aug 14];7(6):681–8. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1469-8749.1965.tb07844.x

* View Article

* Google Scholar

5. 5. Williams CA, Angelman H, Clayton-Smith J, Driscoll DJ, Hendrickson JE, Knoll JHM, et al. Angelman syndrome: Consensus for diagnostic criteria. Am J Med Genet. 1995;56(2):237–8.

* View Article

* Google Scholar

6. 6. Matsuura T, Sutcliffe JS, Fang P, Galjaard RJ, Jiang YH, Benton CS, et al. De novo truncating mutations in E6-AP ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet [Internet]. 1997 Jan [cited 2023 Aug 14];15(1):74–7. Available from: https://www.nature.com/articles/ng0197-74 pmid:8988172

* View Article

* PubMed/NCBI

* Google Scholar

7. 7. Kishino T, Lalande M, Wagstaff J. UBE3A/E6-AP mutations cause Angelman syndrome. Nat Genet [Internet]. 1997 Jan [cited 2023 Aug 14];15(1):70–3. Available from: https://www.nature.com/articles/ng0197-70 pmid:8988171

* View Article

* PubMed/NCBI

* Google Scholar

8. 8. Holm VA, Cassidy SB, Butler MG, Hanchett JM, Greenswag LR, Whitman BY, et al. Prader-Willi Syndrome: Consensus Diagnostic Criteria. Pediatrics [Internet]. 1993 Feb 1 [cited 2023 Aug 14];91(2):398–402. Available from: /pediatrics/article/91/2/398/58658/Prader-Willi-Syndrome-Consensus-Diagnostic pmid:8424017

* View Article

* PubMed/NCBI

* Google Scholar

9. 9. Cassidy SB, Driscoll DJ. Prader–Willi syndrome. Eur J Hum Genet [Internet]. 2009 [cited 2023 Aug 14];17(1):3. Available from: /pmc/articles/PMC2985966/ pmid:18781185

* View Article

* PubMed/NCBI

* Google Scholar

10. 10. Prader A, Labhart A, Willi H. Ein Syndrom von Adipositas, Kleinwuchs, Kryptorchismus und Oligophrenie nach myatonieartigem Zustand im Neugeborenenalter. Schweiz Med Wochenschr. 1956;

* View Article

* Google Scholar

11. 11. Tan Q, Potter KJ, Burnett LC, Orsso CE, Inman M, Ryman DC, et al. Prader–Willi-Like Phenotype Caused by an Atypical 15q11.2 Microdeletion. Genes (Basel) [Internet]. 2020 Jan 25 [cited 2023 Jun 30];11(2):128. Available from: https://www.mdpi.com/2073-4425/11/2/128/htm pmid:31991769

* View Article

* PubMed/NCBI

* Google Scholar

12. 12. Schaaf CP, Marbach F. Schaaf-Yang Syndrome. GeneReviews® [Internet]. 2021 Nov 4 [cited 2023 Aug 30]; Available from: https://www.ncbi.nlm.nih.gov/books/NBK567492/

* View Article

* Google Scholar

13. 13. Glenn CC, Driscoll DJ, Yang TP, Nicholls RD. Genomic imprinting: potential function and mechanisms revealed by the Prader-Willi and Angelman syndromes. Mol Hum Reprod [Internet]. 1997 [cited 2023 Aug 14];3(4):321–32. Available from: https://pubmed.ncbi.nlm.nih.gov/9237260/ pmid:9237260

* View Article

* PubMed/NCBI

* Google Scholar

14. 14. Kim SJ, Miller JL, Kuipers PJ, German JR, Beaudet AL, Sahoo T, et al. Unique and atypical deletions in Prader-Willi syndrome reveal distinct phenotypes. Eur J Hum Genet [Internet]. 2012 Mar [cited 2023 Aug 10];20(3):283–90. Available from: https://pubmed.ncbi.nlm.nih.gov/22045295/ pmid:22045295

* View Article

* PubMed/NCBI

* Google Scholar

15. 15. Amos-Landgraf JM, Yonggang J, Gottlieb W, Depinet T, Wandstrat AE, Cassidy SB, et al. Chromosome breakage in the Prader-Willi and Angelman syndromes involves recombination between large, transcribed repeats at proximal and distal breakpoints. Am J Hum Genet [Internet]. 1999 [cited 2023 Aug 10];65(2):370–86. Available from: https://pubmed.ncbi.nlm.nih.gov/10417280/ pmid:10417280

* View Article

* PubMed/NCBI

* Google Scholar

16. 16. Nicholls RD, Saitoh S, Horsthemke B. Imprinting in Prader-Willi and Angelman syndromes. Trends Genet. 1998 May 1;14(5):194–200. pmid:9613204

* View Article

* PubMed/NCBI

* Google Scholar

17. 17. Brannan I C, Bartolomei MS. Mechanisms of genomic imprinting. Curr Opin Genet Dev [Internet]. 1999 [cited 2021 Feb 13];9(2):164–70. Available from: http://biomednet.com/elecref/0959437X00900164 pmid:10322141

* View Article

* PubMed/NCBI

* Google Scholar

18. 18. Shemer R, Hershko AY, Perk J, Mostoslavsky R, Tsuberi BZ, Cedar H, et al. The imprinting box of the Prader-Willi/Angelman syndrome domain. Nat Genet [Internet]. 2000 [cited 2023 Aug 14];26(4):440–3. Available from: https://www.nature.com/articles/ng1200_440 pmid:11101841

* View Article

* PubMed/NCBI

* Google Scholar

19. 19. Gray TA, Saitoh S, Nicholls RD. An imprinted, mammalian bicistronic transcript encodes two independent proteins [Internet]. Vol. 96, Genetics. 1999. Available from: pmid:10318933

* View Article

* PubMed/NCBI

* Google Scholar

20. 20. Ariyanfar S, Good DJ. Analysis of SNHG14: A Long Non-Coding RNA Hosting SNORD116, Whose Loss Contributes to Prader–Willi Syndrome Etiology. Genes (Basel) [Internet]. 2022 Dec 29 [cited 2023 Aug 14];14(1):97. Available from: https://www.mdpi.com/2073-4425/14/1/97/htm pmid:36672838

* View Article

* PubMed/NCBI

* Google Scholar

21. 21. Runte M, Hüttenhofer A, Groß S, Kiefmann M, Horsthemke B, Buiting K. The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A [Internet]. Vol. 10, Human Molecular Genetics. 2001. Available from: www.hgmp.mrc.ac.uk/ pmid:11726556

* View Article

* PubMed/NCBI

* Google Scholar

22. 22. Cavaillé J, Buiting K, Kiefmann M, Lalande M, Brannan CI, Horsthemke B, et al. Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc Natl Acad Sci U S A [Internet]. 2000;97(26):14311–6. Available from: www.pnas.orgcgidoi10.1073pnas.250426397 pmid:11106375

* View Article

* PubMed/NCBI

* Google Scholar

23. 23. Rougeulle C, Cardoso C, Fontés M, Colleaux L, Lalande M. An imprinted antisense RNA overlaps UBE3A and a second maternally expressed transcript. Nat Genet [Internet]. 1998 [cited 2023 Aug 14];19(1):15–6. Available from: https://www.nature.com/articles/ng0598-15 pmid:9590281

* View Article

* PubMed/NCBI

* Google Scholar

24. 24. Kiss T, Filipowicz W. Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns. Genes Dev [Internet]. 1995 Jun 1 [cited 2023 Aug 14];9(11):1411–24. Available from: http://genesdev.cshlp.org/content/9/11/1411 pmid:7797080

* View Article

* PubMed/NCBI

* Google Scholar

25. 25. Castle JC, Armour CD, Lö Wer M, Haynor D, Biery M. Digital Genome-Wide ncRNA Expression, Including SnoRNAs, across 11 Human Tissues Using PolyA-Neutral Amplification. PLoS One [Internet]. 2010 [cited 2021 Feb 14];5(7):11779. Available from: www.plosone.org

* View Article

* Google Scholar

26. 26. Chamberlain SJ, Chen PF, Ng KY, Bourgois-Rocha F, Lemtiri-Chlieh F, Levine ES, et al. Induced pluripotent stem cell models of the genomic imprinting disorders Angelman and Prader-Willi syndromes. Proc Natl Acad Sci U S A [Internet]. 2010 Oct 12 [cited 2021 Feb 21];107(41):17668–73. Available from: https://pubmed.ncbi.nlm.nih.gov/20876107/ pmid:20876107

* View Article

* PubMed/NCBI

* Google Scholar

27. 27. Hsiao JS, Germain ND, Wilderman A, Stoddard C, Wojenski LA, Villafano GJ, et al. A bipartite boundary element restricts UBE3A imprinting to mature neurons. Proc Natl Acad Sci U S A [Internet]. 2019 Feb 5 [cited 2022 Oct 21];116(6):2181–6. Available from: /pmc/articles/PMC6369781/ pmid:30674673

* View Article

* PubMed/NCBI

* Google Scholar

28. 28. Langouët M, Glatt-Deeley HR, Chung MS, Dupont-Thibert CM, Mathieux E, Banda EC, et al. Zinc finger protein 274 regulates imprinted expression of transcripts in prader-willi syndrome neurons. Hum Mol Genet. 2018;27(3):505–12. pmid:29228278

* View Article

* PubMed/NCBI

* Google Scholar

29. 29. Langouët M, Gorka D, Orniacki C, Dupont-Thibert CM, Chung MS, Glatt-Deeley HR, et al. Specific ZNF274 binding interference at SNORD116 activates the maternal transcripts in Prader-Willi syndrome neurons. Hum Mol Genet. 2020;29(19):3285–95. pmid:32977341

* View Article

* PubMed/NCBI

* Google Scholar

30. 30. Dunham I, Kundaje A, Aldred SF, Collins PJ, Davis CA, Doyle F, et al. An integrated encyclopedia of DNA elements in the human genome. Nature [Internet]. 2012 Sep 5 [cited 2023 Aug 29];489(7414):57–74. Available from: https://www.nature.com/articles/nature11247 pmid:22955616

* View Article

* PubMed/NCBI

* Google Scholar

31. 31. Roadmap Epigenomics Consortium, Kundaje A, Meuleman W, Ernst J, Bilenky M, Yen A, et al. Integrative analysis of 111 reference human epigenomes. Nature. 2015 Feb 19;518(7539):317–29. pmid:25693563

* View Article

* PubMed/NCBI

* Google Scholar

32. 32. Schuldiner M, Eiges R, Eden A, Yanuka O, Itskovitz-Eldor J, Goldstein RS, et al. Induced neuronal differentiation of human embryonic stem cells. Brain Res. 2001 Sep 21;913(2):201–5. pmid:11549388

* View Article

* PubMed/NCBI

* Google Scholar

33. 33. Itskovitz-Eldor J, Schuldiner M, Karsenti D, Eden A, Yanuka O, Amit M, et al. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol Med [Internet]. 2000 [cited 2023 Aug 29];6(2):88. Available from: /pmc/articles/PMC1949933/?report=abstract pmid:10859025

* View Article

* PubMed/NCBI

* Google Scholar

34. 34. Elamin M, Dumarchey A, Stoddard C, Robinson TM, Cowie C, Gorka D, et al. The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons. Stem Cell Reports [Internet]. 2023 Apr 4 [cited 2023 Jul 31];18(4):884. Available from: /pmc/articles/PMC10147551/

* View Article

* Google Scholar

35. 35. Germain ND, Chen PF, Plocik AM, Glatt-Deeley H, Brown J, Fink JJ, et al. Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1. Mol Autism [Internet]. 2014 Aug 20 [cited 2021 Mar 18];5(1):1–19. Available from: https://link.springer.com/articles/10.1186/2040-2392-5-44

* View Article

* Google Scholar

36. 36. Sirois CL, Bloom JE, Fink JJ, Gorka D, Keller S, Germain ND, et al. Abundance and localization of human UBE3A protein isoforms. Hum Mol Genet [Internet]. 2020 Sep 9 [cited 2023 Aug 1];29(18):3021. Available from: /pmc/articles/PMC7645711/ pmid:32833011

* View Article

* PubMed/NCBI

* Google Scholar

37. 37. Germain ND, Banda EC, Becker S, Naegele JR, Grabel LB. Derivation and isolation of NKX2.1-positive basal forebrain progenitors from human embryonic stem cells. Stem Cells Dev [Internet]. 2013 May 15 [cited 2021 Feb 21];22(10):1477–89. Available from: https://pubmed.ncbi.nlm.nih.gov/23351095/ pmid:23351095

* View Article

* PubMed/NCBI

* Google Scholar

38. 38. Chen PF, Hsiao JS, Sirois CL, Chamberlain SJ. RBFOX1 and RBFOX2 are dispensable in iPSCs and iPSC-derived neurons and do not contribute to neural-specific paternal UBE3A silencing. Sci Rep [Internet]. 2016 May 5 [cited 2023 Aug 1];6. Available from: /pmc/articles/PMC4857170/

* View Article

* Google Scholar

39. 39. Burns MJ, Nixon GJ, Foy CA, Harris N. Standardisation of data from real-time quantitative PCR methods–evaluation of outliers and comparison of calibration curves. BMC Biotechnol [Internet]. 2005 Dec 7 [cited 2024 Jun 18];5:31. Available from: /pmc/articles/PMC1326201/

* View Article

* Google Scholar

40. 40. Ahmed M, Kim DR. pcr: An R package for quality assessment, analysis and testing of qPCR data. PeerJ [Internet]. 2018 Mar 16 [cited 2024 Apr 14];6:e4473. Available from: https://peerj.com/articles/4473 pmid:29576953

* View Article

* PubMed/NCBI

* Google Scholar

41. 41. Landrum MJ, Lee JM, Riley GR, Jang W, Rubinstein WS, Church DM, et al. ClinVar: public archive of relationships among sequence variation and human phenotype. Nucleic Acids Res [Internet]. 2014 Jan 1 [cited 2023 Aug 29];42(D1):D980–5. Available from: https://dx.doi.org/10.1093/nar/gkt1113 pmid:24234437

* View Article

* PubMed/NCBI

* Google Scholar

42. 42. Firth H V., Richards SM, Bevan AP, Clayton S, Corpas M, Rajan D, et al. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. Am J Hum Genet. 2009 Apr 10;84(4):524–33. pmid:19344873

* View Article

* PubMed/NCBI

* Google Scholar

43. 43. Antonacci F, Dennis MY, Huddleston J, Sudmant PH, Steinberg KM, Rosenfeld JA, et al. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability. Nat Genet [Internet]. 2014 Oct 19 [cited 2023 Aug 10];46(12):1293–302. Available from: https://www.nature.com/articles/ng.3120 pmid:25326701

* View Article

* PubMed/NCBI

* Google Scholar

44. 44. Maggiolini FAM, Cantsilieris S, D’Addabbo P, Manganelli M, Coe BP, Dumont BL, et al. Genomic inversions and GOLGA core duplicons underlie disease instability at the 15q25 locus. PLOS Genet [Internet]. 2019 Mar 1 [cited 2023 Aug 10];15(3):e1008075. Available from: https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1008075

* View Article

* Google Scholar

45. 45. Adikusuma F, Williams N, Grutzner F, Hughes J, Thomas P. Targeted Deletion of an Entire Chromosome Using CRISPR/Cas9. Mol Ther. 2017;25(8):1736–8. pmid:28633863

* View Article

* PubMed/NCBI

* Google Scholar

46. 46. Zuo E, Huo X, Yao X, Hu X, Sun Y, Yin J, et al. CRISPR/Cas9-mediated targeted chromosome elimination. Genome Biol. 2017;18(1):1–18.

* View Article

* Google Scholar

47. 47. Tai DJC, Ragavendran A, Manavalan P, Stortchevoi A, Seabra CM, Erdin S, et al. Engineering microdeletions and microduplications by targeting segmental duplications with CRISPR. Nat Neurosci [Internet]. 2016 Feb 1 [cited 2023 Aug 29];19(3):517–22. Available from: https://www.nature.com/articles/nn.4235 pmid:26829649

* View Article

* PubMed/NCBI

* Google Scholar

48. 48. Landers M, Bancescu DL, Le Meur E, Rougeulle C, Glatt-Deeley H, Brannan C, et al. Regulation of the large (∼1000 kb) imprinted murine Ube3a antisense transcript by alternative exons upstream of Snurf/Snrpn. Nucleic Acids Res [Internet]. 2004;32(11):3480–92. Available from: www.ncbi.nlm.nih.gov/

* View Article

* Google Scholar

49. 49. Yamasaki K, Joh K, Ohta T, Masuzaki H, Ishimaru T, Mukai T, et al. Neurons but not glial cells show reciprocal imprinting of sense and antisense transcripts of Ube3a. Hum Mol Genet [Internet]. 2003 Apr 15 [cited 2023 Aug 29];12(8):837–47. Available from: https://pubmed.ncbi.nlm.nih.gov/12668607/ pmid:12668607

* View Article

* PubMed/NCBI

* Google Scholar

50. 50. Dindot S V., Christian S, Murphy WJ, Berent A, Panagoulias J, Schlafer A, et al. An ASO therapy for Angelman syndrome that targets an evolutionarily conserved region at the start of the UBE3A-AS transcript. Sci Transl Med [Internet]. 2023 Mar 22 [cited 2023 Aug 29];15(688). Available from: https://www.science.org/doi/10.1126/scitranslmed.abf4077 pmid:36947593

* View Article

* PubMed/NCBI

* Google Scholar

51. 51. Chen H, Kaitlyn Victor A, Klein J, Tacer KF, Tai DJC, de Esch C, et al. Loss of MAGEL2 in Prader-Willi syndrome leads to decreased secretory granule and neuropeptide production. JCI Insight [Internet]. 2020 Sep 9 [cited 2023 Sep 22];5(17). Available from: /pmc/articles/PMC7526459/ pmid:32879135

* View Article

* PubMed/NCBI

* Google Scholar

52. 52. Favaro R, Valotta M, Ferri ALM, Latorre E, Mariani J, Giachino C, et al. Hippocampal development and neural stem cell maintenance require Sox2-dependent regulation of Shh. Nat Neurosci [Internet]. 2009 Sep 6 [cited 2024 Jun 14];12(10):1248–56. Available from: https://www.nature.com/articles/nn.2397 pmid:19734891

* View Article

* PubMed/NCBI

* Google Scholar

53. 53. Qin S, Zhang C-L. Role of Krüppel-Like Factor 4 in Neurogenesis and Radial Neuronal Migration in the Developing Cerebral Cortex. Mol Cell Biol [Internet]. 2012 Nov 1 [cited 2024 Jun 14];32(21):4297–305. Available from: /pmc/articles/PMC3486145/

* View Article

* Google Scholar

54. 54. Fink JJ, Robinson TM, Germain ND, Sirois CL, Bolduc KA, Ward AJ, et al. Disrupted neuronal maturation in Angelman syndrome-derived induced pluripotent stem cells. Nat Commun [Internet]. 2017 [cited 2023 Aug 14];8. Available from: /pmc/articles/PMC5413969/ pmid:28436452

* View Article

* PubMed/NCBI

* Google Scholar

Citation: Gilmore RB, Gorka D, Stoddard CE, Sonawane P, Cotney J, Chamberlain SJ (2024) Generation of isogenic models of Angelman syndrome and Prader-Willi syndrome in CRISPR/Cas9-engineered human embryonic stem cells. PLoS ONE 19(11): e0311565. https://doi.org/10.1371/journal.pone.0311565

About the Authors:

Rachel B. Gilmore

Contributed equally to this work with: Rachel B. Gilmore, Dea Gorka

Roles: Data curation, Formal analysis, Investigation, Resources, Writing – original draft, Writing – review & editing

Affiliations: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America, Graduate Program in Biomedical Science, Genetics and Developmental Biology, UConn Health, Farmington, CT, United States of America

ORICD: https://orcid.org/0000-0001-7435-263X

Dea Gorka

Contributed equally to this work with: Rachel B. Gilmore, Dea Gorka

Roles: Formal analysis, Investigation, Resources, Visualization, Writing – original draft, Writing – review & editing

Affiliations: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America, Graduate Program in Biomedical Science, Genetics and Developmental Biology, UConn Health, Farmington, CT, United States of America

Christopher E. Stoddard

Roles: Resources, Writing – review & editing

Affiliation: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America

ORICD: https://orcid.org/0000-0002-7137-761X

Pooja Sonawane

Roles: Investigation, Writing – review & editing

Affiliations: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America, Graduate Program in Biomedical Science, Genetics and Developmental Biology, UConn Health, Farmington, CT, United States of America

ORICD: https://orcid.org/0009-0003-3485-416X

Justin Cotney

Roles: Funding acquisition, Project administration, Supervision, Writing – review & editing

E-mail: [email protected] (JC); [email protected] (SJC)

¶‡ JC and SJC also contributed equally to this work.

Affiliations: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America, Institute for Systems Genomics, University of Connecticut, Storrs, CT, United States of America

ORICD: https://orcid.org/0000-0001-8230-2157

Stormy J. Chamberlain

Roles: Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review & editing

E-mail: [email protected] (JC); [email protected] (SJC)

¶‡ JC and SJC also contributed equally to this work.

Affiliations: Department of Genetics and Genome Sciences, University of Connecticut School of Medicine, Farmington, CT, United States of America, Institute for Systems Genomics, University of Connecticut, Storrs, CT, United States of America

References

1. Clayton-Smith J, Pembrey ME. Angelman syndrome. J Med Genet [Internet]. 1992 Jun 1 [cited 2023 Aug 14];29(6):412–5. Available from: https://jmg.bmj.com/content/29/6/412 pmid:1619637

2. Burd L, Vesely B, Martsolf J, Kerbeshian J. Prevalence study of Prader-Willi syndrome in North Dakota. Am J Med Genet [Internet]. 1990 [cited 2023 Aug 14];37(1):97–9. Available from: https://pubmed.ncbi.nlm.nih.gov/2240051/ pmid:2240051

3. Whittington JE, Holland AJ, Webb T, Butler J, Clarke D, Boer H. Population prevalence and estimated birth incidence and mortality rate for people with Prader-Willi syndrome in one UK Health Region. J Med Genet [Internet]. 2001 Nov 1 [cited 2023 Aug 14];38(11):792–8. Available from: https://jmg.bmj.com/content/38/11/792 pmid:11732491

4. Angelman H. ‘Puppet’ Children A Report on Three Cases. Dev Med Child Neurol [Internet]. 1965 Dec 1 [cited 2023 Aug 14];7(6):681–8. Available from: https://onlinelibrary.wiley.com/doi/full/10.1111/j.1469-8749.1965.tb07844.x

5. Williams CA, Angelman H, Clayton-Smith J, Driscoll DJ, Hendrickson JE, Knoll JHM, et al. Angelman syndrome: Consensus for diagnostic criteria. Am J Med Genet. 1995;56(2):237–8.

6. Matsuura T, Sutcliffe JS, Fang P, Galjaard RJ, Jiang YH, Benton CS, et al. De novo truncating mutations in E6-AP ubiquitin-protein ligase gene (UBE3A) in Angelman syndrome. Nat Genet [Internet]. 1997 Jan [cited 2023 Aug 14];15(1):74–7. Available from: https://www.nature.com/articles/ng0197-74 pmid:8988172

7. Kishino T, Lalande M, Wagstaff J. UBE3A/E6-AP mutations cause Angelman syndrome. Nat Genet [Internet]. 1997 Jan [cited 2023 Aug 14];15(1):70–3. Available from: https://www.nature.com/articles/ng0197-70 pmid:8988171

8. Holm VA, Cassidy SB, Butler MG, Hanchett JM, Greenswag LR, Whitman BY, et al. Prader-Willi Syndrome: Consensus Diagnostic Criteria. Pediatrics [Internet]. 1993 Feb 1 [cited 2023 Aug 14];91(2):398–402. Available from: /pediatrics/article/91/2/398/58658/Prader-Willi-Syndrome-Consensus-Diagnostic pmid:8424017

9. Cassidy SB, Driscoll DJ. Prader–Willi syndrome. Eur J Hum Genet [Internet]. 2009 [cited 2023 Aug 14];17(1):3. Available from: /pmc/articles/PMC2985966/ pmid:18781185

10. Prader A, Labhart A, Willi H. Ein Syndrom von Adipositas, Kleinwuchs, Kryptorchismus und Oligophrenie nach myatonieartigem Zustand im Neugeborenenalter. Schweiz Med Wochenschr. 1956;

11. Tan Q, Potter KJ, Burnett LC, Orsso CE, Inman M, Ryman DC, et al. Prader–Willi-Like Phenotype Caused by an Atypical 15q11.2 Microdeletion. Genes (Basel) [Internet]. 2020 Jan 25 [cited 2023 Jun 30];11(2):128. Available from: https://www.mdpi.com/2073-4425/11/2/128/htm pmid:31991769

12. Schaaf CP, Marbach F. Schaaf-Yang Syndrome. GeneReviews® [Internet]. 2021 Nov 4 [cited 2023 Aug 30]; Available from: https://www.ncbi.nlm.nih.gov/books/NBK567492/

13. Glenn CC, Driscoll DJ, Yang TP, Nicholls RD. Genomic imprinting: potential function and mechanisms revealed by the Prader-Willi and Angelman syndromes. Mol Hum Reprod [Internet]. 1997 [cited 2023 Aug 14];3(4):321–32. Available from: https://pubmed.ncbi.nlm.nih.gov/9237260/ pmid:9237260

14. Kim SJ, Miller JL, Kuipers PJ, German JR, Beaudet AL, Sahoo T, et al. Unique and atypical deletions in Prader-Willi syndrome reveal distinct phenotypes. Eur J Hum Genet [Internet]. 2012 Mar [cited 2023 Aug 10];20(3):283–90. Available from: https://pubmed.ncbi.nlm.nih.gov/22045295/ pmid:22045295

15. Amos-Landgraf JM, Yonggang J, Gottlieb W, Depinet T, Wandstrat AE, Cassidy SB, et al. Chromosome breakage in the Prader-Willi and Angelman syndromes involves recombination between large, transcribed repeats at proximal and distal breakpoints. Am J Hum Genet [Internet]. 1999 [cited 2023 Aug 10];65(2):370–86. Available from: https://pubmed.ncbi.nlm.nih.gov/10417280/ pmid:10417280

16. Nicholls RD, Saitoh S, Horsthemke B. Imprinting in Prader-Willi and Angelman syndromes. Trends Genet. 1998 May 1;14(5):194–200. pmid:9613204

17. Brannan I C, Bartolomei MS. Mechanisms of genomic imprinting. Curr Opin Genet Dev [Internet]. 1999 [cited 2021 Feb 13];9(2):164–70. Available from: http://biomednet.com/elecref/0959437X00900164 pmid:10322141

18. Shemer R, Hershko AY, Perk J, Mostoslavsky R, Tsuberi BZ, Cedar H, et al. The imprinting box of the Prader-Willi/Angelman syndrome domain. Nat Genet [Internet]. 2000 [cited 2023 Aug 14];26(4):440–3. Available from: https://www.nature.com/articles/ng1200_440 pmid:11101841

19. Gray TA, Saitoh S, Nicholls RD. An imprinted, mammalian bicistronic transcript encodes two independent proteins [Internet]. Vol. 96, Genetics. 1999. Available from: pmid:10318933

20. Ariyanfar S, Good DJ. Analysis of SNHG14: A Long Non-Coding RNA Hosting SNORD116, Whose Loss Contributes to Prader–Willi Syndrome Etiology. Genes (Basel) [Internet]. 2022 Dec 29 [cited 2023 Aug 14];14(1):97. Available from: https://www.mdpi.com/2073-4425/14/1/97/htm pmid:36672838

21. Runte M, Hüttenhofer A, Groß S, Kiefmann M, Horsthemke B, Buiting K. The IC-SNURF-SNRPN transcript serves as a host for multiple small nucleolar RNA species and as an antisense RNA for UBE3A [Internet]. Vol. 10, Human Molecular Genetics. 2001. Available from: www.hgmp.mrc.ac.uk/ pmid:11726556

22. Cavaillé J, Buiting K, Kiefmann M, Lalande M, Brannan CI, Horsthemke B, et al. Identification of brain-specific and imprinted small nucleolar RNA genes exhibiting an unusual genomic organization. Proc Natl Acad Sci U S A [Internet]. 2000;97(26):14311–6. Available from: www.pnas.orgcgidoi10.1073pnas.250426397 pmid:11106375

23. Rougeulle C, Cardoso C, Fontés M, Colleaux L, Lalande M. An imprinted antisense RNA overlaps UBE3A and a second maternally expressed transcript. Nat Genet [Internet]. 1998 [cited 2023 Aug 14];19(1):15–6. Available from: https://www.nature.com/articles/ng0598-15 pmid:9590281

24. Kiss T, Filipowicz W. Exonucleolytic processing of small nucleolar RNAs from pre-mRNA introns. Genes Dev [Internet]. 1995 Jun 1 [cited 2023 Aug 14];9(11):1411–24. Available from: http://genesdev.cshlp.org/content/9/11/1411 pmid:7797080

25. Castle JC, Armour CD, Lö Wer M, Haynor D, Biery M. Digital Genome-Wide ncRNA Expression, Including SnoRNAs, across 11 Human Tissues Using PolyA-Neutral Amplification. PLoS One [Internet]. 2010 [cited 2021 Feb 14];5(7):11779. Available from: www.plosone.org

26. Chamberlain SJ, Chen PF, Ng KY, Bourgois-Rocha F, Lemtiri-Chlieh F, Levine ES, et al. Induced pluripotent stem cell models of the genomic imprinting disorders Angelman and Prader-Willi syndromes. Proc Natl Acad Sci U S A [Internet]. 2010 Oct 12 [cited 2021 Feb 21];107(41):17668–73. Available from: https://pubmed.ncbi.nlm.nih.gov/20876107/ pmid:20876107

27. Hsiao JS, Germain ND, Wilderman A, Stoddard C, Wojenski LA, Villafano GJ, et al. A bipartite boundary element restricts UBE3A imprinting to mature neurons. Proc Natl Acad Sci U S A [Internet]. 2019 Feb 5 [cited 2022 Oct 21];116(6):2181–6. Available from: /pmc/articles/PMC6369781/ pmid:30674673

28. Langouët M, Glatt-Deeley HR, Chung MS, Dupont-Thibert CM, Mathieux E, Banda EC, et al. Zinc finger protein 274 regulates imprinted expression of transcripts in prader-willi syndrome neurons. Hum Mol Genet. 2018;27(3):505–12. pmid:29228278

29. Langouët M, Gorka D, Orniacki C, Dupont-Thibert CM, Chung MS, Glatt-Deeley HR, et al. Specific ZNF274 binding interference at SNORD116 activates the maternal transcripts in Prader-Willi syndrome neurons. Hum Mol Genet. 2020;29(19):3285–95. pmid:32977341

30. Dunham I, Kundaje A, Aldred SF, Collins PJ, Davis CA, Doyle F, et al. An integrated encyclopedia of DNA elements in the human genome. Nature [Internet]. 2012 Sep 5 [cited 2023 Aug 29];489(7414):57–74. Available from: https://www.nature.com/articles/nature11247 pmid:22955616

31. Roadmap Epigenomics Consortium, Kundaje A, Meuleman W, Ernst J, Bilenky M, Yen A, et al. Integrative analysis of 111 reference human epigenomes. Nature. 2015 Feb 19;518(7539):317–29. pmid:25693563

32. Schuldiner M, Eiges R, Eden A, Yanuka O, Itskovitz-Eldor J, Goldstein RS, et al. Induced neuronal differentiation of human embryonic stem cells. Brain Res. 2001 Sep 21;913(2):201–5. pmid:11549388

33. Itskovitz-Eldor J, Schuldiner M, Karsenti D, Eden A, Yanuka O, Amit M, et al. Differentiation of human embryonic stem cells into embryoid bodies compromising the three embryonic germ layers. Mol Med [Internet]. 2000 [cited 2023 Aug 29];6(2):88. Available from: /pmc/articles/PMC1949933/?report=abstract pmid:10859025

34. Elamin M, Dumarchey A, Stoddard C, Robinson TM, Cowie C, Gorka D, et al. The role of UBE3A in the autism and epilepsy-related Dup15q syndrome using patient-derived, CRISPR-corrected neurons. Stem Cell Reports [Internet]. 2023 Apr 4 [cited 2023 Jul 31];18(4):884. Available from: /pmc/articles/PMC10147551/

35. Germain ND, Chen PF, Plocik AM, Glatt-Deeley H, Brown J, Fink JJ, et al. Gene expression analysis of human induced pluripotent stem cell-derived neurons carrying copy number variants of chromosome 15q11-q13.1. Mol Autism [Internet]. 2014 Aug 20 [cited 2021 Mar 18];5(1):1–19. Available from: https://link.springer.com/articles/10.1186/2040-2392-5-44

36. Sirois CL, Bloom JE, Fink JJ, Gorka D, Keller S, Germain ND, et al. Abundance and localization of human UBE3A protein isoforms. Hum Mol Genet [Internet]. 2020 Sep 9 [cited 2023 Aug 1];29(18):3021. Available from: /pmc/articles/PMC7645711/ pmid:32833011

37. Germain ND, Banda EC, Becker S, Naegele JR, Grabel LB. Derivation and isolation of NKX2.1-positive basal forebrain progenitors from human embryonic stem cells. Stem Cells Dev [Internet]. 2013 May 15 [cited 2021 Feb 21];22(10):1477–89. Available from: https://pubmed.ncbi.nlm.nih.gov/23351095/ pmid:23351095

38. Chen PF, Hsiao JS, Sirois CL, Chamberlain SJ. RBFOX1 and RBFOX2 are dispensable in iPSCs and iPSC-derived neurons and do not contribute to neural-specific paternal UBE3A silencing. Sci Rep [Internet]. 2016 May 5 [cited 2023 Aug 1];6. Available from: /pmc/articles/PMC4857170/

39. Burns MJ, Nixon GJ, Foy CA, Harris N. Standardisation of data from real-time quantitative PCR methods–evaluation of outliers and comparison of calibration curves. BMC Biotechnol [Internet]. 2005 Dec 7 [cited 2024 Jun 18];5:31. Available from: /pmc/articles/PMC1326201/

40. Ahmed M, Kim DR. pcr: An R package for quality assessment, analysis and testing of qPCR data. PeerJ [Internet]. 2018 Mar 16 [cited 2024 Apr 14];6:e4473. Available from: https://peerj.com/articles/4473 pmid:29576953

41. Landrum MJ, Lee JM, Riley GR, Jang W, Rubinstein WS, Church DM, et al. ClinVar: public archive of relationships among sequence variation and human phenotype. Nucleic Acids Res [Internet]. 2014 Jan 1 [cited 2023 Aug 29];42(D1):D980–5. Available from: https://dx.doi.org/10.1093/nar/gkt1113 pmid:24234437

42. Firth H V., Richards SM, Bevan AP, Clayton S, Corpas M, Rajan D, et al. DECIPHER: Database of Chromosomal Imbalance and Phenotype in Humans Using Ensembl Resources. Am J Hum Genet. 2009 Apr 10;84(4):524–33. pmid:19344873

43. Antonacci F, Dennis MY, Huddleston J, Sudmant PH, Steinberg KM, Rosenfeld JA, et al. Palindromic GOLGA8 core duplicons promote chromosome 15q13.3 microdeletion and evolutionary instability. Nat Genet [Internet]. 2014 Oct 19 [cited 2023 Aug 10];46(12):1293–302. Available from: https://www.nature.com/articles/ng.3120 pmid:25326701

44. Maggiolini FAM, Cantsilieris S, D’Addabbo P, Manganelli M, Coe BP, Dumont BL, et al. Genomic inversions and GOLGA core duplicons underlie disease instability at the 15q25 locus. PLOS Genet [Internet]. 2019 Mar 1 [cited 2023 Aug 10];15(3):e1008075. Available from: https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1008075

45. Adikusuma F, Williams N, Grutzner F, Hughes J, Thomas P. Targeted Deletion of an Entire Chromosome Using CRISPR/Cas9. Mol Ther. 2017;25(8):1736–8. pmid:28633863

46. Zuo E, Huo X, Yao X, Hu X, Sun Y, Yin J, et al. CRISPR/Cas9-mediated targeted chromosome elimination. Genome Biol. 2017;18(1):1–18.

47. Tai DJC, Ragavendran A, Manavalan P, Stortchevoi A, Seabra CM, Erdin S, et al. Engineering microdeletions and microduplications by targeting segmental duplications with CRISPR. Nat Neurosci [Internet]. 2016 Feb 1 [cited 2023 Aug 29];19(3):517–22. Available from: https://www.nature.com/articles/nn.4235 pmid:26829649

48. Landers M, Bancescu DL, Le Meur E, Rougeulle C, Glatt-Deeley H, Brannan C, et al. Regulation of the large (∼1000 kb) imprinted murine Ube3a antisense transcript by alternative exons upstream of Snurf/Snrpn. Nucleic Acids Res [Internet]. 2004;32(11):3480–92. Available from: www.ncbi.nlm.nih.gov/

49. Yamasaki K, Joh K, Ohta T, Masuzaki H, Ishimaru T, Mukai T, et al. Neurons but not glial cells show reciprocal imprinting of sense and antisense transcripts of Ube3a. Hum Mol Genet [Internet]. 2003 Apr 15 [cited 2023 Aug 29];12(8):837–47. Available from: https://pubmed.ncbi.nlm.nih.gov/12668607/ pmid:12668607

50. Dindot S V., Christian S, Murphy WJ, Berent A, Panagoulias J, Schlafer A, et al. An ASO therapy for Angelman syndrome that targets an evolutionarily conserved region at the start of the UBE3A-AS transcript. Sci Transl Med [Internet]. 2023 Mar 22 [cited 2023 Aug 29];15(688). Available from: https://www.science.org/doi/10.1126/scitranslmed.abf4077 pmid:36947593

51. Chen H, Kaitlyn Victor A, Klein J, Tacer KF, Tai DJC, de Esch C, et al. Loss of MAGEL2 in Prader-Willi syndrome leads to decreased secretory granule and neuropeptide production. JCI Insight [Internet]. 2020 Sep 9 [cited 2023 Sep 22];5(17). Available from: /pmc/articles/PMC7526459/ pmid:32879135

52. Favaro R, Valotta M, Ferri ALM, Latorre E, Mariani J, Giachino C, et al. Hippocampal development and neural stem cell maintenance require Sox2-dependent regulation of Shh. Nat Neurosci [Internet]. 2009 Sep 6 [cited 2024 Jun 14];12(10):1248–56. Available from: https://www.nature.com/articles/nn.2397 pmid:19734891

53. Qin S, Zhang C-L. Role of Krüppel-Like Factor 4 in Neurogenesis and Radial Neuronal Migration in the Developing Cerebral Cortex. Mol Cell Biol [Internet]. 2012 Nov 1 [cited 2024 Jun 14];32(21):4297–305. Available from: /pmc/articles/PMC3486145/

54. Fink JJ, Robinson TM, Germain ND, Sirois CL, Bolduc KA, Ward AJ, et al. Disrupted neuronal maturation in Angelman syndrome-derived induced pluripotent stem cells. Nat Commun [Internet]. 2017 [cited 2023 Aug 14];8. Available from: /pmc/articles/PMC5413969/ pmid:28436452