Capsaicin‐mediated repair of circadian disruption‐induced Intestinal barrier damage via the gut microbiota

Abstract

Circadian clock serves as a regulator of gastrointestinal health, and the disruption of circadian rhythm may trigger the dysregulation of the intestinal barrier functions. This study investigated the effectiveness of capsaicin (CAP) in mitigating intestinal barrier dysfunction induced by circadian disruption in male SPF C57BL/6J mice. Our findings indicated that CAP supplementation attenuated abnormal weight gain, alterations in serum lipid levels, and misalignment in hepatic and colonic circadian clock gene expressions in mice caused by constant darkness (CD) treatment. The restoration of the intestinal barrier integrity was also observed through the increase in mucosal thickness and goblet cell numbers. Both the diversity and the circadian rhythm of gut microbiota were improved in CAP‐treated group. Correlation analysis indicated that CAP could modulate the gut microbiota by affecting intestinal barrier function and systemic metabolism in CD‐treated mice. These results highlight the potential of CAP as a functional food component in maintaining the intestinal barrier homeostasis through regulating gut microbiota.

INTRODUCTION

The circadian clock has evolved across diverse organisms to integrate external environmental changes with internal physiological processes (Patke et al., 2020). In humans, endogenous circadian rhythms are governed by a genetically encoded molecular clock, whose components induce cyclical changes in abundance and activity over approximately 24 h (Healy et al., 2021). This molecular clock orchestrates circadian gene expression in various organs, ensuring the periodic regulation and stability of neural, endocrine, and metabolic pathways. Brain and muscle arnt-like 1 (Bmal1) and circadian locomotor output cycles kaput (Clock) are core components of the positive limb of the molecular clock, forming a heterodimer that drives the transcription of various clock-controlled genes. Reverse erythroblastosis virus α (Reverbα) is part of the feedback loop that represses Bmal1 expression, thus playing a crucial role in maintaining the precision and stability of circadian rhythms. Numerous gastrointestinal (GI) functions, including digestion, absorption, epithelial renewal, and barrier integrity, are subject to circadian regulation. Circadian clock genes have been identified throughout the rodent GI tract, with expression levels gradually increasing from the duodenum to the colon, particularly prominent in epithelial cells compared to other mucosal cells (Sládek et al., 2007). While circadian mechanisms governing gastric and small intestinal functions have been extensively studied, the highest levels of clock genes have been found in colonic epithelial cells (Ayyar & Sukumaran, 2021).

The GI tract plays a crucial role as the primary interface for nutrient absorption, making it a key organ system in metabolic regulation. Increasing evidence suggests that gut barrier functions are intricately regulated by circadian rhythms. Tight junction proteins, such as occludin and claudin-1, exhibit circadian fluctuations in expression levels within the colonic epithelia, impacting intestinal permeability in wild-type mice (Kyoko et al., 2014). Notably, mice with Clock mutant genes demonstrate elevated baseline intestinal permeability (Summa et al., 2013). Moreover, Per1/2 mutant mice exhibit disruptions in mucosal barrier integrity due to heightened necroptotic cell death in the epithelium (Pagel et al., 2017). Impaired intestinal barrier function results in heightened intestinal permeability, leading to compromised glucose homeostasis and contributing to metabolic disorders. Thus, the intestinal barrier serves as a critical intermediary influenced by clock genes in host metabolic processes (Zhang et al., 2022). Current research indicates that dysregulation of the circadian rhythm not only directly affects permeability proteins but also exacerbates colitis and enhances the secretion of proinflammatory cytokines in mice, thereby increasing the risk of metabolic diseases, especially with circadian disruption induced by phase shifts and alternating light schedules (Pastorelli et al., 2013). It appears that vagal innervation of the gut may not play a significant role in setting the time for the GI clock, as evidenced by studies showing that vagotomy does not impact the expression of clock genes in the stomach and intestines (Hoogerwerf et al., 2007). Therefore, the microbiota emerges as a pivotal regulator of circadian rhythmicity within the intestinal epithelium (Thaiss et al., 2016).

Numerous phytochemicals, such as flavonoids, melatonin, and resveratrol, have been identified for their potential to regulate intestinal barrier function through mechanisms linked to the circadian clock (Zhang et al., 2022). Capsaicin (CAP), the colorless, pungent, liposoluble alkaloid with the chemical formula C₁₈H₂₇NO₃ and molecular weight of 305.40 g/mol, is the main bioactive ingredient of chili peppers with multiple health benefits (Lu et al., 2020). Our Recent studies have demonstrated that CAP could modulate metabolic disorders by influencing the expression of circadian clock genes in the liver (Liang et al., 2023). However, it remains unclear whether CAP exerts protective effects on intestinal barrier damage induced by circadian rhythm disruption through modulation of the gut microbiota. In this study, circadian rhythm disorder in mice was induced by constant darkness (CD) treatment to evaluate the circadian clock related mechanisms underlying the protective effect of CAP on the intestinal barrier. In current study, we aim to further elucidate the protective mechanisms of CAP against intestinal barrier damage caused by circadian clock disruption. This understanding will provide valuable insights for the development of functional foods aimed at alleviating metabolic abnormalities resulting from intestinal barrier damage.

MATERIALS AND METHODS

Materials

CAP (purity ∼99%) was purchased from Ji'an Shengda Fragrance Oils Company (Ji'an, Jiangxi, China). Medium chain triacylglycerol (MCT) (Neobee 1053) was provided by Stepan Company (Northfield, IL, USA). Tween 80 (polyoxyethylenesorbitan monooleate) was obtained from Sigma-Aldrich (St. Louis, MO, USA). Sugar ester (sucrose stearate S-370) was provided by Mitsubishi-Kagaku Foods Company (White Plains, NY, USA). Milli-Q water (18.3 MΩ) was used in all experiments.

Animals and experimental design

Five-week-old male specific pathogen-free (SPF) C57BL/6J mice were obtained from Guangdong Medical Laboratory Animal Center. The mice were housed in a controlled environment (temperature 23°C, 12-h light/dark cycle) with free access to food and water. The ingredient compositions of the experimental diets are provided in Table 1. All animal experimental procedures followed the guidelines of the Laboratory Animal Center of South China Agricultural University and were approved by the Animal Ethical Committee (No. 2021b088).

TABLE 1 Composition of experimental diets.

Ingredients	Weight (g/kg)
Casein, 80 mesh L-cystine Corn starch Maltodextrin 10 Sucrose Cellulose, BW200 Soybean oil Lard Mineral mix S10026 DiCalcium phosphate Calcium carbonate Potassium citrate, 1 H20 Vitamin mix V1001 Choline bitartrate	191.28 2.87 432.48 71.73 165.27 47.82 23.91 19.13 9.56 12.43 5.26 15.78 9.56 1.91

Following a 1-week acclimation phase, mice were divided into three groups (n = 16): a regular light/dark cycle group (CONT group, [ZT0, lights on; ZT12, lights off]); a constant darkness group (CD group); and a constant darkness plus CAP supplementation group (CD-CAP group). Mice in the CONT and CD groups received 0.2 mL of oral saline daily. CAP was formulated into a nanoemulsion using a method described in our previously published article (Lu et al., 2017). Mice in the CD-CAP group were administered CAP nanoemulsion at a dose of 2 mg/kg body weight (referring to only CAP content). According to the standard body surface area conversion method, the human-to-mouse dose ratio is 9.1, resulting in a human equivalent dose of 18.2 mg/kg. All groups received their respective treatments at ZT0. After an 8-week treatment period, mice were euthanized every 6 h (ZT2, ZT8, ZT14, ZT20) following a 12-h fasting period.

Sample collection

Capillary blood samples were collected from the orbital vein of mice. The liver, cecum, and colon were dissected and weighed. Tissue samples were flash-frozen in liquid nitrogen for subsequent analysis. The concentrations of triacylglycerol (TG), total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) in serum samples were quantified using enzyme immunoassay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). All experiments were conducted in triplicate. The serum, livers and cecal contents were collected immediately after mice were sacrificed, which were then placed in liquid nitrogen and stored at −80°C.

Histological analysis

Colon was harvested and fixed in 10% buffered formalin. Following fixation, the tissue samples were embedded in paraffin, stained with hematoxylin and eosin (H&E), and visualized using an Olympus CX41 light microscope (Olympus Optical Co. Ltd., Tokyo, Japan).

RNA extraction and real-time qPCR

Total RNA was extracted from the liver and colon using RNAiso Plus (Takara Bio Inc., Dalian, China). The mRNA was reverse-transcribed utilizing an RT-PCR kit (Takara Bio Inc., Otsu, Japan) with a CFX96 Real-Time RT-PCR Detection System equipped with a C1000 Thermocycler (Bio-Rad, Hercules, CA, USA). The method of 2^−ΔΔCt was used to calculate the differences in relative expression levels of mRNAs, normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Liver and colon clock gene expression curves were fitted with trigonometric functions using OriginPro (Version 8.0, OriginLab Corporation, Northampton, MA, USA). The primer sequences used for quantitative real-time PCR are listed in Table 2.

TABLE 2 Quantitative real-time PCR primer sequences.

Gene	Forward primer (5′−3′)	Reverse primer (5′−3′)
GAPDH	TGGAGAAACCTGCCAAGTATGA	TGGAAGAATGGGAGTTGCTGT
Bmal1	ACAGTCAGATTGAAAAGAGGCG	GCCATCCTTAGCACGGTGAG
Clock	CTTCCTGGTAACGCGAGAAAG	GTCGAATCTCACTAGCATCTGAC
Rev-erbα	ACTTCCCACCATCACCTACTG	GGGGAGCTATCATCACTGAGA

Extraction of fecal DNA and gut microbiota analysis

Fecal microbial DNA was extracted utilizing a DNA extraction kit (Qiagen Inc., Shanghai, China), and the V3-V4 region of the 16S rRNA gene was PCR-amplified using specific primers [forward primer (5′-ACTCCTACGGGGAGGCAGCA-3′) and reverse primer (5′-GGACTACHVGGGGTWTCTAAT-3′)]. PCR products underwent purification and quantification with the DNA gel extraction kit (Axygen Biosciences, Union City, CA, USA) and Quantus Fluorometer (Promega, Madiso, WI, USA), respectively. Sequencing was performed on Illumina's NovaSeq PE250 platform (BioNovoGene Co. Ltd., Suzhou, China). Microbiome bioinformatics analyses were conducted using QIIME 2.14 with slight modifications as per official tutorials (). Data analysis was executed on a cloud-based platform ().

Statistical analysis

All data were expressed as means ± standard error of the mean (SEM). Variances between groups were determined using one-way ANOVA by GraphPad Prism (Version 8.3, GraphPad Software, Inc., San Diego, CA, USA). The post hoc analysis following ANOVA was conducted using the Tukey–Kramer method to compare multiple groups. Significance levels at p < .05 were considered statistically significant.

For microbiome analysis, relative abundances within taxonomy were calculated based on operational taxonomic units (OTU). OTUs were used to calculate alpha diversity measures of alpha diversity. Wilcoxon ranks test was used to compare individual bacteria at each taxonomic level and alpha diversity indexes.

RESULTS AND DISCUSSION

CAP suppressed obesity in circadian disruption mice

To investigate the effects of CAP on circadian rhythm disruption, a CD-induced circadian disruption model was established in mice. The protocol of the animal experiment was presented in Figure 1A. Previous studies have shown that CD treatment can result in excessive weight gain in mice (Kolbe et al., 2019). The initial body weight of mice in all experimental groups were similar. After eleven weeks, the body weight of mice in the CD group (31.050 ± 0.999 g) was higher than the CONT group (29.250 ± 1.360 g), which was significantly reduced in the CAP group (29.800 ± 1.335 g) (p < .05) (Figure 1B–E). CD treatment increased the levels of TC, TG, and LDL-C, while CAP treatment significantly decreased LDL-C levels (p < .05) (Figure 1F–I). These results demonstrated that treatment with CAP effectively attenuated the excessive body weight gain and dysregulation in serum lipid levels in mice induced by CD without altering food and water intake.

[IMAGE OMITTED. SEE PDF]

Protective effect of CAP on the intestinal barrier

The intestinal barrier, crucial for blocking harmful substances while allowing nutrient uptake, can be compromised by disrupted circadian rhythms, affecting gut health (Eum et al., 2023). According to Figure 2A, the damage in the colonic morphology was observed in CD-treated mice with irregular surfaces, reduced mucosal layers, and decreased goblet cell numbers. Reduce in colon length was also apparent in CD group compared to the CONT group (Figure 2B), suggesting that the intestinal barrier integrity was negatively influenced by darkness treatment in mice. After CAP supplementation, the colon length and morphology were improved. Additionally, CD treatment significantly reduced the mRNA levels of occludin and claudin-1, which were effectively restored by CAP (Figure 2C), indicating its protective effect against CD-induced intestinal barrier damage. These results suggested that the modulatory effect of CAP on intestinal barrier integrity is reflected in the protection of colonic morphology and the enhancement of tight junction proteins (occludin and claudin-1).

[IMAGE OMITTED. SEE PDF]

CAP restored the circadian misalignment in liver and colon

To investigate whether CAP affected the circadian rhythm of the CD group, we measured the expression levels of clock genes Bmal1, Clock, and Rev-erbα every 6 h over a 24-h period. As shown in Figure 2D–I, in the CONT group, Bmal1, Clock, and Rev-erbα genes exhibited significant rhythmic expression in the liver and colon. Following CD treatment, a phase shift in Bmal1 expression in the liver and in Clock and Rev-erbα expression in the colon was observed. Additionally, the oscillation of Bmal1 and Rev-erbα in the liver, and Clock and Rev-erbα in the colon, was attenuated. A decreased rhythmic expression of Rev-erbα was evident in both the liver and colon (p < .05), indicating that CD disrupted the circadian rhythm in the liver and colon of mice. After supplementation with CAP, the oscillation amplitude and rhythmic expression of Rev-erbα in both the liver and colon were restored. These findings suggested that CAP could mitigate the disruption of circadian gene expression oscillations induced by CD in the liver and colon of rats.

To investigate whether CAP affected circadian synchronization of the peripheral biological clock in the CD group, the circadian parameters of the clock genes, including phase shift, amplitude, period, and mesor (adjusted median/baseline) were fitted by trigonometric functions to analyze the changes in the circadian rhythm (Figure 3, Tables S1 and S2). In the CONT group, the synchronicity of Clock and Rev-erbα genes was notably high, with the synchronicity of Clock gene expression being significantly pronounced. Following CD treatment, the synchronicity of Bmal1, Clock, and Rev-erbα expression markedly decreased (p < .05). Upon supplementation with CAP, the synchronicity of Clock and Rev-erbα expression was restored, with significant synchronicity observed for the Rev-erbα gene (p < .05). These findings indicated that CAP could improve the synchronicity of circadian gene expression, especially Rev-erbα expression in the liver and colon of mice. As there exists a close association between circadian rhythm and intestinal physiology, the disruption of the circadian rhythm may lead to various gastrointestinal disorders (Chen et al., 2022). Our results suggested that darkness treatment negatively affected the expression of circadian clock genes in mice liver and colon. After CAP administration, the oscillatory amplitude and rhythmic expression of circadian clock genes (especially Rev-erbα) were improved, indicating the potential of CAP in ameliorating the synchrony of circadian rhythms in the liver and colon.

[IMAGE OMITTED. SEE PDF]

Effects of CAP on gut microbiota

CAP improved the diversity of gut microbiota in mice

To explore the effect of CAP on the diversity, composition and function of the gut microbiota in mice with circadian disorder, fecal samples were collected and analyzed. The dilution curve, Chao1, Shannon, and Simpson indices of the microbiota in the CD group markedly decreased compared to the CONT group, which were improved in the CAP group, indicating that CAP partially restored the α-diversity of the gut microbiota (p < .05) (Figure 4A–D). The principal coordinate analysis (PCoA) and Venn diagram were used to assess the intestinal microbial β-diversity. CD treatment caused a significant change in the distribution of intestinal microbiota on the Pco1 axis, forming two different clusters compared to the CONT group, and CAP partially restored the distribution of intestinal microbiota on the Pco1 axis, indicating that CAP increased the β-diversity of the gut microbiota (Figure 4E). Based on the Venn diagram of amplicon sequence variant/operational taxonomic unit (ASV/OTU), there were 11,749 unique microbes in the CONT group, which were reduced to 7697 in CD group and increased to 10,185 in CAP group, indicating that CAP treatment could recover the CD-induced decrease in the number of unique microbes in mice fecal samples (Figure 4F). These results indicated that CAP mitigated gut microbiota dysbiosis in mice subjected to CD treatment by reinstating the diminished α and β diversity.

[IMAGE OMITTED. SEE PDF]

CAP restored the circadian rhythm of gut microbiota

The gut microbiota exhibits 24-h oscillations in composition and function, which can be influenced by food intake, feeding time, and the interaction between microbes and the host (Bishehsari et al., 2020). Disruptions in circadian rhythms may elevate the Firmicutes/Bacteroidetes ratio, subsequently impacting the integrity of the intestinal barrier and the homeostasis of intestinal immunity (Zhao et al., 2022). To evaluate whether the administration of CAP altered circadian rhythm of gut microbiota, mice fecal samples were collected every 6 h over a 24-h period to evaluate the effect of CAP on circadian rhythm of gut microbiota composition and function. As shown in Figure 4G, the relative abundance oscillations of microbial communities in the CD group exhibited phase shifts, baseline shifts, and periodic variations in Firmicutes and Bacteroidetes within 24 h, with a significant reduction in amplitude observed in Proteobacteria compared to the CONT group (p < .05). Following CAP supplementation, the oscillations in Firmicutes and Bacteroidetes exhibited effective restoration in phase shifts and amplitudes (p < .05), indicating that CAP improved the circadian rhythm disruption of the gut microbiota induced by CD treatment by restoring the rhythmic oscillations of microbial groups. Previous studies have indicated that circadian rhythm disruption can lead to dysbiosis in the intestinal microbiota by increasing the Firmicutes/Bacteroidetes (F/B) ratio (Amara et al., 2024). The F/B ratio was significantly increased in the CD group at the phylum level, which was reduced by 22.7% after CAP supplementation (Figure 4H–J). These results indicated that CAP supplementation significantly regulated gut microbiota composition, structure, diversity, and richness at the genus level, restored abnormal diurnal oscillations of microbiota at the phylum level, and modulated the F/B ratio, thereby maintaining intestinal health and metabolic homeostasis in mice subjected to CD.

CAP regulated the gut microbiota at the genus level

To further investigate the variability and enrichment of gut microbial species at the genus level, MetagenomeSeq analysis was conducted (Figure 5). In comparison to the CONT group, the CD group exhibited a decrease in the relative abundance of Oscillospira, Adlercreutzia, and Brevibacillus by 50.83%, 37.19%, and 98.51%, respectively, while Sutterella and Allobaculum increased by 297.73% and 125.87%, respectively (p < .05). Following CAP supplementation, the relative abundance of Bacteroides, Allobaculum, Sutterella, and Helicobacter were decreased by 35.12%, 28.16%, 76.21%, and 31.43%, respectively, compared to the CD group. Conversely, the relative abundance of Bifidobacterium, Oscillospira, Alistipes, and Brevibacillus were increased by 91.87%, 51.39%, 103.62%, and 8700% (p < .05) in comparison to the CD group. The relative abundance of Oscillospira, a butyrate-producing genus that could regulate intestinal barrier function, inhibit inflammation, and affect host weight and blood glucose levels, was significantly reduced by CD treatment (Yang et al., 2021). The Oscillospira level in CD mice was partially restored by CAP supplementation, indicating a beneficial function of CAP on intestinal health and metabolic homeostasis. In addition, the relative abundance of Bifidobacterium, Alistipes, and Brevibacillus, which could promote intestinal health and immune system function, modulate energy and lipid metabolism, and produce vitamins and short-chain fatty acids, was significantly increased by CAP supplementation (Konieczna et al., 2012; Panda et al., 2014; Parker et al., 2020). Sutterella is associated with gastrointestinal diseases and immune modulation, potentially leading to inflammation and intestinal barrier dysfunction, while Helicobacter is linked to gastrointestinal inflammation and diseases like peptic ulcers and gastric cancer (Kaakoush, 2020; Sun et al., 2023). These results indicated that CAP supplementation significantly modulated the gut microbiota composition at the genus level, restoring beneficial bacteria such as Bifidobacterium, Oscillospira, Alistipes, and Brevibacillus while reducing harmful bacteria like Sutterella and Helicobacter, thereby improving intestinal health and metabolic homeostasis in mice subjected to CD.

[IMAGE OMITTED. SEE PDF]

Correlation analysis between the intestinal barrier function and metabolic pathways of gut microbiota

Correlation analysis between the intestinal barrier function and metabolic pathways of gut microbiota revealed significant alterations induced by both CD treatment and CAP supplementation. As shown in Figure 6A, the heatmap analysis revealed that CD treatment altered the relative abundance of several bacterial species that were related to intestinal barrier function. CD treatment reduced the abundance of beneficial bacteria, such as Bacteroides uniformis, Lactobacillus helveticus, Akkermansia muciniphila, and Parabacteroides distasonis, which could produce short-chain fatty acids, modulate mucosal immunity and metabolic balance, and protect the mucosal barrier from pathogens (Parada Venegas et al., 2019). Heatmaps showed that the relative abundance of the gut microbiota was significantly altered by CD (Figure 6B).CD treatment also increased the abundance of harmful bacteria, such as Helicobacter hepaticus, which might cause hepatitis, cholecystitis, and colon cancer (Zhu et al., 2021). CAP supplementation restored the abundance of beneficial bacteria, suggesting a favorable effect of CAP on intestinal barrier function. The KEGG pathway analysis showed that CAP supplementation had significant effects on the expression of genes involved in various metabolic signaling pathways. The pathways that were differentially expressed between the CONT group and the CD group, as well as between the CD group and the CD-CAP group were shown in Figure 6C and D. Among the principal pathways showing differential expression between the CONT group and the CD group, sphingolipid metabolism, tropane, piperidine, and pyridine alkaloid biosynthesis, as well as phenylalanine metabolism, were intricately linked to host lipid and amino acid metabolism. CD treatment might lead to downregulation of genes involved in these pathways in the gut microbiota, thereby affecting the lipid and amino acid balance of the gut microbiota and the host. Among the predominant pathways exhibiting differential regulation between the CD group and the CD-CAP group, pathways such as peroxisome and glycolysis/gluconeogenesis were implicated in oxidative stress mitigation, as well as fatty acid and glycogen metabolism processes. These results indicated that CAP could modulate the gut microbiota by affecting the intestinal barrier function and systemic metabolism in mice treated by CD.

[IMAGE OMITTED. SEE PDF]

CONCLUSIONS

In this work, the modulating effect of CAP on intestinal functions in mice induced by circadian rhythm disruption was studied. CAP demonstrated potent anti-obesity and anti-hyperlipidemic effects, protecting the intestinal barrier at the cellular level and restoring the circadian rhythms at the molecular level. The disrupted circadian oscillations of clock gene expression in the liver and colon in CD-treated mice were mitigated, and the gut microbiota composition was restructured following CAP treatment, which correlated significantly with intestinal barrier integrity. Therefore, CAP could modulate the intestinal barrier functions in mice by attenuating the desynchronization of circadian rhythms in the liver and colon and alterations in the gut microbiota.

CAP has been widely known as an agonist of the transient receptor potential vanilloid member 1 (TRPV1), which are widely expressed in sensory neurons and play an important role in pain perception and modulation. It has been shown that TRPV1 ablation impairs colonic mucus production and leads to intestinal malnutrition, while CAP can activate the TRPV1 pathway to attenuate intestinal oxidative stress. However, the exact mechanism of how CAP protects the intestinal barrier through TRPV1 receptors is still unclear, and further studies are needed to elucidate the interaction between TRPV1 receptors and CAP, and the downstream signaling pathways and molecular targets involved. This study could provide theoretical basis for CAP to work as functional food to alleviate the circadian rhythm misalignment, metabolic disorders and gut microbiota with wide applications in the food and pharmaceutic industries.

ACKNOWLEDGMENTS

This work was financially supported by the Program for Guangdong Introducing Innovative and Entrepreneurial Teams (Grant No. 2019ZT08N291), the Guangdong Basic and Applied Basic Research Foundation (Grant No. 2024A1515030058), and the National Natural Science Foundation of China (Grant No. 31901689).

CONFLICT OF INTEREST STATEMENT

The authors declare no competing financial interest.

References

Amara, J., Itani, T., Hajal, J., Bakhos, J.‐J., Saliba, Y., Aboushanab, S. A., Kovaleva, E. G., Fares, N., Mondragon, A. C., & Miranda, J. M. (2024). Circadian rhythm perturbation aggravates gut microbiota dysbiosis in dextran sulfate sodium‐induced colitis in mice. Nutrients, 16(2), 247. [DOI: https://dx.doi.org/10.3390/nu16020247]