Comparison of Development and Antioxidative Ability in Fertilized Crossbred (Yorkshire × Landrace × Duroc) Oocytes Using Duroc and Landrace Sperm

Abstract

Simple Summary

The use of male semen is critical in pig breeding. For meat production, three-way crossbred Yorkshire × Landrace × Duroc (YLD) has commonly been used; however, reproductive data on the outcomes of crossbreeding between purebred males and crossbred females in pigs remain lacking. Therefore, we compared the fertility of Duroc sperm (DS) and Landrace sperm (LS) when used for the fertilization of YLD oocytes. The cleavage of DS and LS was similar in fertilized oocytes; however, the blastocyst rate was increased by LS. Moreover, our findings confirmed that the expression of genes associated with pluripotency, antioxidant enzymes, and cell cycle was upregulated in embryos fertilized with LS. These results suggest that LS improves the fertilization rate in three-way crossbred YLD female pigs.

1. Introduction

The swine industry, which has advanced in various fields, including reproduction, genetics, disease prevention, and production management [1,2], provides stable supplements to animal protein and biomedical models for humans. Several porcine species are used for the breeding and making of pork, including Yorkshire, Landrace, and Large White, which are widely used for breeding piglets, have excellent fertility, and maternal behavior for reproduction [3,4]. The characteristics of each variety can be compared and analyzed, and the preferred array can be selected for production [5]. Additionally, combining the excellent qualities of both breeds through crossbreeding with crossbred sows could provide a model for developing diversity and improving production efficiency in the breeding of pigs [6].

The Duroc is widely used as the primary sire breed since it is characterized by superior muscle development, high meat quality, and rapid growth [7]. Pigs used for pork production are typically the offspring of a three-way crossbreeding system, Yorkshire × Landrace × Duroc (YLD), utilizing Landrace and Yorkshire sows inseminated with Duroc boar semen in the livestock industry [8]. For successful breeding improvements, it is essential to evaluate the ability of female and male gametes to produce purebred and crossbred terminal lines [9]. Specifically, comparing the sperm from Duroc and Landrace boars is critical as these breeds represent distinct genetic contributions and reproductive characteristics, which are pivotal for optimizing terminal crossbreeding strategies and enhancing overall breeding efficiency [10].

Considerable variability has been reported in the fertility and reproductive efficiency of crossbred sows produced from crossbred Pietrain and Duroc × Pietrain boar terminal lines [11]. Assessing the conception rate through artificial insemination (AI) is the best diagnostic method to accurately verify sperm fertility according to male species under in vivo conditions; however, this method is time-consuming, labor-intensive, and cannot be used to analyze embryo quality after fertilization. Therefore, it is necessary to use in vitro fertilization (IVF) technology to accurately analyze the quality of embryos fertilized with sperm, depending on the boar species.

IVF includes ovarian stimulation, oocyte retrieval, fertilization, embryo culture, and embryo transfer to the uterus, with fertilization achieved either by co-culturing the oocyte and sperm or through a procedure called intracytoplasmic sperm injection (ICSI) [12]. In addition, IVF research has been conducted in various fields, such as humans [13], mice [14], sheep [15], cows [16], and pigs [17]. IVF technology is used in multiple ways in the swine industry, such as producing high-quality embryos through breeding programs [18], selective breeding through genetic characteristics [19], and analyzing mechanisms through reproductive physiology research [17]. Additionally, a previous study assessed fertilization and embryo development at two different sperm–oocyte ratios using pigs from the Duroc and Landrace breeds [20]. Sperm morphological parameters in semen used for artificial insemination showed different proportions depending on the variety [21]. Various studies have attempted to increase the efficiency of embryo development and improve embryo quality during IVF; however, this depends on the semen characteristics of each pig breed. Therefore, to achieve efficient production of high-quality embryos derived from in vitro production, a comparative analysis of the semen used for IVF is necessary. IVF experiments to determine semen capacity can be used to assess fertilization capacity. Competency assessments should be made, especially for the Duroc and Landrace varieties used primarily in economic animals.

The quality of ejaculated sperm is generally evaluated based on its volume, concentration, viability, and motility for use in artificial insemination. The concentration [22], viability [23], and motility [24] of mammalian semen highly correlate with fertilization. Moreover, sperm head size, tail size, and concentration vary among species; these indicators are related to fertilization capacity. Although differences in semen quality between Duroc and Landrace boars have been reported [25], data on the fertility of Duroc and Landrace boar sperm in Landrace × Yorkshire sows bred for pork production in the swine industry remain lacking. This necessitates further verification of the specific capabilities of semen according to breed through in vitro research that can precisely evaluate its fertilization capacity.

Oxidative stress is closely related to sperm characteristics, such as plasma membrane integrity, acrosome reaction, and the antioxidative ability of fertilized oocytes, interrupting successful fertilization in pigs [26]. Among the Landrace and Duroc breeds, sperm with a lower antioxidant capacity to defend against oxidative stress are more likely to experience DNA fragmentation, negatively affecting fertilization capability and resulting in smaller litter sizes [10]. In embryos fertilized in vitro, cleavage and metabolic activities are affected by oxidative stress during development. Previous studies have confirmed that inhibiting oxidative stress during this process can improve embryo development [27,28]. Therefore, evaluating the oxidative stress and antioxidant capacity of in vitro embryos is essential for assessing their development and quality.

Several physiological differences exist between Duroc and Landrace pigs, yet there is a lack of reproductive cells in both breeds [29]. Additionally, there is a lack of information on the molecular impact of damaged sperm DNA on fertilization and subsequent embryo development [30]. Understanding the changes in the relative mRNA abundance of specific genes can provide insights into sperm DNA damage and improve embryo quality. Therefore, characterizing the sperm from Duroc and Landrace pigs enhances their usability.

Therefore, this study compared the fertility of Duroc and LS by analyzing plasma membrane integrity and the acrosome reaction in Duroc and Landrace boar sperm, as well as in vitro fertility, antioxidative capacity, apoptosis, and cell cycle gene expression in embryos fertilized with YLD oocytes and Duroc and Landrace boar sperm.

2. Materials and Methods

2.1. Sample Preparation

A total number of 20 ejaculates were collected from Duroc (n = 10) and Landrace (n = 10) using the gloved-hand method (Gumbo Artificial Insemination Industry, Wonju, Republic of Korea). The age of the experimental five Duroc and Landrace were 25.6 ± 4.2 and 28.3 ± 7.9 months, respectively. For the analysis of sperm characteristics, the collected DS and LS were diluted with modified Modena B to 1.0 × 10⁷ sperm/mL, as previously described [31]. Only ejaculates with >80% total motility, 60% plasma membrane integrity, and <20% acrosome reaction were used in the experiment, and the samples were transported to the laboratory within 2 h at 18 °C [31,32].

2.2. Sperm Characteristics

Fluorescent staining was performed using the LIVE/DEAD Sperm Viability Kit (Invitrogen, Carlsbad, CA, USA) to assess boar sperm membrane integrity [33]. Briefly, the final concentrations of SYBR14 and propidium iodide (PI, Sigma, St. Louis, MO, USA) were 1.0 nM and 1.2 µM, respectively. The acrosome reaction was assessed after staining sperm with peanut agglutinin conjugated with phycoerythrin (FITC-PNA, Sigma) and PI double staining [34]. The final concentrations of FITC-PNA and PI were 2.0 and 1.2 µM, respectively. To analyze intracellular hydrogen peroxide (H₂O₂) and glutathione (GSH) levels, samples were incubated with 0.5 μM 2′,7′-Dichlorodihydrofluorescein diacetate (H₂DCFDA, Invitrogen) and 1.0 μM CellTracker Red CMTPX (Invitrogen) for 30 min at 38.5 °C, following which 10,000 sperm per sample (n = 10) were analyzed using flow cytometry (FACSymphony, BD BioSciences, Billerica, MA, USA).

2.3. In Vtiro Fertilization (IVF)

The ovaries were obtained from a local slaughterhouse and transported to the laboratory within 2 h. The ovaries were collected from pigs prior to prepuberty. Cumulus–oocyte complexes (COCs) were aspirated from 3 to 6 mm antral follicles using an 18-gauge syringe and collected in phosphate-buffered saline with polyvinyl alcohol (PBS-PVA) under a stereomicroscope (SZX16, Olympus, Tokyo, Japan). The COCs were then pre-incubated in tissue culture medium-199 (TCM-199), supplemented with 0.5 µg/mL follicle-stimulating hormone (FSH, Sigma), 10 ng/mL epithelial growth factor (EGF, Sigma), 10 IU/mL human chorionic gonadotropin (hCG, Intervet, the Netherlands), and 10% porcine follicular fluid (pFF) at 38.5 °C and 5.0% CO₂ for 22 h [35]. The COCs were matured in TCM-199 medium for 22 h and then cultured in the same medium without FSH and hCG at 38.5 °C with 5.0% CO₂ for 22 h. Collected DS (n = 10) and LS (n = 10) were used for IVF, and samples with >80% motility and 60% viability were used; motility and viability were assessed as previously described [31].

The samples were centrifuged at 1500 rpm for 5 min at room temperature and washed with modified Modena B [36]. After removing the supernatant, the final sperm concentration was adjusted to 5.0 × 10⁶ sperm/mL and added to a modified Tris Buffer Medium (mTBM) containing caffeine. Mature COCs were segregated from the cumulus complex using 0.1% hyaluronidase (Sigma) and transferred to mTBM without caffeine. A 50 µL sperm suspension was added to 50 µL of culture medium containing the oocytes and co-cultured at 38.5 °C and 5% CO₂ for 5–6 h. Fertilized YLD oocytes (YLDO) with DS (DS+YLDO, n = 537, 10 replications) and LS (LS+YLDO, n = 574, 10 replications) were washed with porcine zygote medium-3 (PZM-3); any remaining residues, such as sperm and cumulus cells, were removed using a glass pipette. The fertilized oocytes were transferred to 100 µL of PZM-3 and cultured at 38.5 °C and 5% CO₂ for 48 h, following which the PZM-3 was changed, and fertilized oocytes (embryos) were cultured for an additional 120 h. The average cleavage and blastocyst formation of the embryos were analyzed under a stereomicroscope 192 h post-fertilization.

2.4. Detection of Intracellular H₂O₂ and GSH in Embryos

Intracellular H₂O₂ was detected via H₂DCFDA staining in DS+YLDO (n = 66) and LS+YLDO (n = 63) groups. The embryos were incubated in 0.5 μM H₂DCFDA for 30 min at 38.5 °C and 5% CO₂. To confirm the GSH, the DS+YLDO (n = 35) and LS+YLDO (n = 47) were stained in 1.0 μM CellTracker Red CMTPX (Invitrogen) for 30 min at 38.5 °C and 5.0%. After staining, the embryos were washed three times with PBS-PVA and imaged using an EVOS M7000 imaging system (Invitrogen). For fluorescence staining, embryo images were captured using green (482/524 nm for intracellular H₂O₂) and red (542/593 nm for GSH) fluorescence filters. Fluorescence intensity was analyzed using ImageJ software version 1.54 (NCBI, Bethesda, MD, USA).

2.5. Gene Analysis

DS+YLDO and LS+YLDO were collected at 192 h post-fertilization. The collected embryos (50 per sample and a total of six replications) were immediately transferred to liquid nitrogen and stored at −80 °C for later experiments. Total RNA was extracted using the RNAqueous™-Micro Total RNA Isolation kit (Thermo Fisher Scientific, Waltham, MA, USA). The mRNA concentration was measured using EzDrop 1000 (Blue-Ray Biotech, New Taipei City, Taiwan). cDNA was synthesized using the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan), and reverse transcription was performed at 45 °C for 60 min after 95 °C for 5 min according to the manufacturer’s instructions [37]. Antioxidant enzyme genes (SOD1, SOD2, CAT, and GPx2), pluripotency genes (Oct4, Nanog, and Sox2), cell cycle-related genes (Cdc2 and CCNB1), and apoptosis-related genes (Bax and Bcl-2) were analyzed using qRT-PCR (Table 1). The 1.0 µL synthesized cDNA was used to conduct PCR according to the conditions (Table 1) using a PCR premix kit (Bioneer, Seoul, Republic of Korea). Amplified products were separated using 1.5% agarose gel with RedSafe Nucleic Acid Staining Solution (INtRON Biotechnology, Seoul, Republic of Korea) electrophoresis at 100 V for 20 min and photographed under UV illumination. Relative expression of mRNA was normalized to β-actin, and ImageJ (NCBI) was used for image analysis.

2.6. Blastocyst Cell Number

The produced blastocysts by DS (DS-B, n = 27) and LS (LS-B, n = 36) at 192 h post-fertilization were fixed for 15 min in 4.0% paraformaldehyde at room temperature, stained with 1.0 µL/mL Hoechst 33342 (Sigma) for 30 min at 38.5 °C and 5.0% CO₂, and washed three times with PBS-PVA. The intensity was measured using a fluorescence microscope (EVOS M7000, Invitrogen) at 357/447 nm. Fluorescent image data analysis was performed using ImageJ software (NCBI).

2.7. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM). The collected data were analyzed using Student’s t-test with statistical analysis system software (SAS version 9.3, SAS Institute, Cary, NC, USA). Differences were considered significant when the probability of occurrence by chance was <5% (p < 0.05).

3. Results

3.1. Comparison of Sperm Characteristics Between Duroc and Landrace Sperm

The sperm characteristics (viability, acrosome reaction, intracellular H₂O₂, and GSH) of the Duroc and Landrace breeds are shown in Figure 1. No significant differences in viability (Figure 1A), acrosome reaction (Figure 1B), intracellular H₂O₂ (Figure 1C), or GSH (Figure 1D) between DS and LS were observed.

3.2. Comparison of Fertility and Blastocyst Formation in Fertilized Crossbred Oocytes with Duroc and Landrace Sperm

Fertility and blastocyst formation rates of the DS+YLDO and LS+YLDO groups are shown in Table 2. We observed no significant difference in the cleavage between the DS+YLDO and LS+YLDO groups; however, the four cell stage of LS+YLDO was significantly higher than that of LS+YLDO (p < 0.05), and blastocyst formation was significantly higher in LS+YLDO than in DS+YLDO (p < 0.05).

3.3. Evaluation of Antioxidative Enzyme Genes, Intracellular H₂O₂, and GSH in Fertilized Crossbred Oocytes by Duroc and Landrace Sperm

The antioxidative enzyme genes, intracellular H₂O₂, and GSH in the DS+YLDO and DS+YLDO groups are shown in Figure 2. GPx1 mRNA was significantly higher in the LS+YLDO than DS+YLDO groups (p < 0.05), whereas SOD1, SOD2, and CAT mRNAs showed no significant expression (Figure 2A). The intracellular H₂O₂ intensity (Figure 2B,C, green) was significantly (p < 0.05) lower in the LS+YLDO than DS+YLDO groups (Figure 2F); however, there was no significant difference in GSH levels (Figure 2D,F, red; Figure 2G).

3.4. Differential Gene Expression in Fertilized Crossbred Oocytes with Duroc and Landrace Sperm

The expression of Oct4 mRNA was significantly higher in the LS+YLDO than DS+YLDO groups (p < 0.05); however, for the other pluripotency genes, Sox2 and Nanog, mRNAs did not significantly differ (Figure 3A). In addition, the expression of Cdc2 mRNA was significantly increased in the LS+YLDO group (p < 0.05); however, CCNB1 mRNA levels did not differ between the DS+YLDO and LS+YLDO groups (Figure 3B). Lastly, the expression of Bcl-2 mRNA was significantly improved in the LS+YLDO group compared with that in the DS+YLDO group (p < 0.05). In contrast, the expression of Bax mRNA did not change (Figure 3C).

3.5. Evaluation of Blastocyst Cell Numbers in In Vitro Produced Embryos

A comparison of the total number of blastocysts produced in vitro is shown in Figure 4. The total cell number of blastocysts showed no significant difference (Figure 4C) between DS-B (51.56 ± 3.26 cells, Figure 4A) and LS-B (49.97 ± 2.65 cells, Figure 4B) in pigs.

4. Discussion

The analysis of sperm characteristics is critical for determining the success of implantation and pregnancy following IVF [9,11]. It plays a key role in embryonic development and overall reproductive potential, with sperm characteristics selectively managed by breeders to meet breeding and meat production goals. Therefore, in this study, we compared sperm characteristics and fertility between the Duroc and Landrace, as these two species are representative sites for breeding in the swine industry. We verified the fertility of DS and LS from the perspective of embryo development based on antioxidant activity, pluripotency, apoptosis, and cell cycle properties using IVF techniques.

Individual boars have different fertilization, cleavage, and blastocyst formation rates when fresh and freeze-thawed sperm are fertilized with oocytes [20]. In the present study, we collected sperm from Duroc and Landrace pigs and bred them to supply semen for artificial insemination to nearby pig farms. We confirmed no difference in viability, acrosome reaction, intracellular H₂O₂, or GSH in semen derived from 20 boars (Duroc = 10 and Landrace = 10) when >10,000 sperm per sample were analyzed using flow cytometry. A previous study reported differences in semen volume and concentration between Duroc and Landrace but not in sperm motility [25]. Similarly, we found no significant differences in sperm characteristics between the Duroc and Landrace groups. However, it is important to note that sperm viability, acrosome reaction, intracellular H₂O₂, and GSH levels alone do not fully represent fertility potential. While flow cytometry is effective for high-throughput quantitative analysis, it may not capture the functional aspects of sperm or their interactions with oocytes, which are essential for fertilization and subsequent embryonic development. To address these limitations, future studies should integrate complementary techniques such as sperm chromatin structure assays (SCSA) to evaluate DNA integrity or advanced imaging methods such as live-cell imaging and time-lapse microscopy to investigate sperm–oocyte interactions in greater detail. Additionally, we utilized the IVF system to assess indicators of embryo developmental ability, providing deeper insights into fertility-related parameters.

Traditionally, purebred females, such as Landrace, Large White, and Yorkshire, and purebred males, such as Duroc, Landrace, and Pietrain, have been widely used for breeding pork [8]. The genetic diversity of each breed has influenced variations in breeding, reproduction, nutrition, and meat quality [38,39]. Recently, crossbreeds have been used to produce growing–finishing pigs in the swine industry; however, studies investigating the reproductive physiology of crossbred females and purebred males utilizing their reproductive cells are limited. Therefore, comparative studies on fertility using purebred semen remain warranted to increase production efficiency in the swine industry, as YLD is one of the most commonly used species in producing growing–finishing pigs. While improved reproductive performance achieved through artificial insemination, such as litter size and litter weight at birth, has been reported [11,40], data on the developmental capacity, antioxidant potential, and genes associated with embryo development in fertilized oocytes with sperm derived from crossbred females (YLD) and purebred males (Duroc and Landrace) are lacking. In this study, although there were no differences in sperm characteristics according to breed, embryo development and blastocyst formation in YLD oocytes differed according to DS and LS.

Moreover, fertilized oocytes showed differing antioxidant capacities and developmental gene expression according to sperm type. This indicates that, apart from the characteristics of purebred sperm, other factors influence embryonic development when fertilized with oocytes derived from crossbreeds. While this study primarily focused on sperm-derived factors, variables such as media composition, incubation conditions, and external stressors cannot be excluded as potential contributors to embryonic development outcomes. Although we did not confirm differences in the genotypes of DS and LS from the perspective of genetics, we intend to investigate embryo production efficiency according to the genetic traits of purebred semen using techniques such as whole sequencing.

Embryos and blastocysts created via IVF are intricately linked to fertility. The normal cleavage process of pre-implantation embryos encompasses a complex series of events directly influencing their ability to develop into blastocysts [41,42]. In this study, we performed IVF using DS and LS sperm with oocytes from YLD to assess embryo development and blastocyst formation. There was no difference in the cleavage rate and total cell number of blastocysts between DS and LS; however, blastocyst formation was increased in DS. Generally, many factors are involved in embryo development and blastocyst formation; for example, pluripotency, antioxidative capacity, apoptosis factors, and cell cycle level are directly related to embryo development [41,42]. Therefore, we investigated the reason for the increased blastocyst formation rate of YLD oocytes by LS by analyzing the antioxidative capacity and genes associated with pluripotency, antioxidative enzymes, apoptosis, and the cell cycle in fertilized embryos. Surprisingly, we obtained positive results for antioxidative enzyme gene expression and intracellular H₂O₂ levels in the LS+YLDO group. As byproducts of embryo development, superoxide (O₂⁻) and hydrogen peroxide (H₂O₂) affect reproductive potential [43]. This indicates that the balance between reductive and oxidative homeostasis plays a key role in regulating embryonic development [44], and various antioxidative enzymes play an important role in maintaining the intracellular redox state to protect cells against harmful effects caused by oxidative stress [45]. Herein, the overall antioxidative enzyme (SOD1, SOD2, CAT, and GPx1) genes showed a tendency to increase. Of these, GPx1 was significantly increased in fertilized YLD oocytes when LS was used. Generally, glutathione peroxidase 1 (GPx1) is abundant in the cytoplasm of nearly all mammalian cells, whose preferred substrate is H₂O₂, a reactive oxygen species (ROS), and the balance between reductive and oxidative homeostasis is directly related to blastocyst formation in mammals [46]. Interestingly, intracellular H₂O₂ in fertilized YLD oocytes was significantly decreased by LS. These findings suggest that using LS enhances the developmental potential of embryos and improves their resilience to oxidative stress in three crossbred species (YLD). In the GSH detection assay using CellTracker Red CMTPX, no significant differences were observed between the two treatment groups (YLDO and LS+YLDO). We found no correlation between the antioxidant capacity of the sperm and that of the in vitro-produced embryos. In future studies, we intend to determine the influence of DS and LS on embryo development using various methods that can directly detect intracellular glutathione peroxidase.

The embryo is a cell with pluripotency, and through this characteristic cell cycle-related signaling pathways are activated along with anti-apoptosis mechanisms; these complex, interrelated processes lead to successful embryo development and blastocyst formation [47]. Oct4 is crucial during early embryonic development, working in conjunction with Sox2 and Nanog to activate pluripotency factors while playing broader regulatory roles in embryogenesis [48]. In this study, a pluripotency gene, Oct4, was upregulated in YLD oocytes fertilized with LS. Furthermore, we observed upregulation of the anti-apoptotic gene (Bcl-2) and the cell cycle-regulating gene (Cdc2) in the LS+YLDO group. From a cell biology perspective, Cdc2 phosphorylates anti-apoptotic factors, such as Bcl-2 and Bcl-xL, during mitosis, which, when sustained, can lead to their inactivation and induce apoptosis [43,44]. Our gene expression data support the conclusion that LS helps to reduce G2/M phase cell cycle arrest and mitigate apoptosis in porcine embryos. These results suggest that they contribute to blastocyst formation in oocytes fertilized with LS. In addition, CCNB1 and Cdc2 play crucial roles as key regulators of the cell cycle in mammals. Cleavage based on cell cycle upregulation actively occurs in embryos, an essential physiological phenomenon for successful blastocyst formation [49]. In our study, the expression of Cdc2 was significantly higher in the LS+YLDO group. These results highlight the importance of Cdc2 as a potential marker of enhanced developmental competence in the LS group. This indicates that the genes differentially expressed during the development and blastocyst formation of oocytes fertilized using DS and LS play an important role in embryonic development, and the sperm derived from Landrace helps to improve blastocyst formation in crossbred (YLS) oocytes.

The primary limitation of this study is its focus on sperm-derived factors, without fully considering the potential influence of oocyte quality, such as cytoplasmic maturity and mitochondrial function, which are critical for embryonic development. Additionally, environmental variables, including culture conditions and external stressors, were not systematically evaluated, which may have impacted the observed outcomes. Future studies should integrate comprehensive analyses of these factors to provide a more holistic understanding of the mechanisms influencing fertility and embryonic development.

5. Conclusions

In conclusion, our study confirmed that LS improved blastocyst formation and the expression of various genes (GPx1, Oct4, Cdc2, and Bcl-2) in YLD oocytes when used for fertilization. This suggests that the differences between DS and LS are influenced by physiological characteristics, which influence fertility outcomes. Future research could provide deeper insights into breed-specific fertility traits by extensively exploring sperm-derived factors and their potential roles in influencing embryonic development. These findings provide valuable insights into reproductive technologies and highlight the need for optimal sperm selection to obtain high-quality embryos in the swine industry. Furthermore, this study provides fundamental knowledge about fertility and the differential impact of oxidative stress, gene expression, and embryonic developmental stages across breeds, as well as the development of breed-specific fertility in the crossbreeding field of the swine industry.

Author Contributions

Conceptualization, S.-H.L.; methodology, H.L., H.K. and J.A.; validation, H.L., H.K. and J.A.; writing—original draft preparation, H.L., H.K. and J.A.; writing—review and editing, H.L. and S.-H.L.; visualization, H.L., H.K. and J.A.; supervision, S.-H.L. and H.-T.C.; project administration, S.-H.L. and H.-T.C. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data generated or analyzed during this study are included in this published article.

Conflicts of Interest

The authors declare no conflicts of interest.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Figures and Tables

Figure 1. Comparison of viability (A), acrosome reaction (B), intracellular hydrogen peroxide (H2O2) (C), and glutathione (GSH) (D) levels between Duroc sperm (DS) and Landrace sperm (LS). Data are presented as the mean ± standard error mean (n = 10).

Figure 2. Antioxidative ability of fertilized Yorkshire × Landrace × Duroc (YLD) oocytes with Duroc sperm (DS+YLDO) and Landrace sperm (LS+YLDO). Antioxidative enzyme genes (SOD1, SOD2, CAT, and GPx1) were detected in DS+YLDO (n = 7) and LS+YLDO (n = 7) after in vitro fertilization (A). Intracellular hydrogen peroxide (H2O2) and glutathione (GSH) intensities in in vitro produced embryos. The intracellular H2O2 level of DS+YLDO ((B), n = 66) and LS+YLDO ((C), n = 63) was detected by H2DCFDA staining and glutathione of DS+YLDO ((D), n = 35) and LS+YLDO ((E), n = 47) was confirmed by CellTracker Red. Intensity of H2O2 (F) and GSH (G) was normalized and compared between DS+YLDO and LS+YLDO in pigs. Data are presented as the mean ± standard error mean. * Values with different superscript letters indicate significant differences between DS+YLDO and LS+YLDO groups (p [less than] 0.05).

Figure 3. Relative expression of pluripotency genes (Oct4, Sox2, and Nanog) (A), cell cycle-related genes (CCNB1 and Cdc2) (B), and apoptotic genes (Bax and Bcl-2) (C) in fertilized YLD oocytes with Duroc sperm (DS+YLDO) and Landrace sperm (LS+YLDO) in pigs. Data are presented as the mean ± standard error mean (n = 7). Values with different superscript letters indicate significant differences between DS-E (white bar) and LS-E (black bar) groups (* p [less than] 0.05, ** p [less than] 0.01).

Figure 4. Blastocyst cell numbers in in vitro produced embryos with Duroc sperm (DS-B) and Landrace sperm (LS-B) in pigs. Hoechst 33342 was used to stain the nucleus in DS-B (A) and LS-B (B). Comparison of blastocyst cell numbers between DS-B (n = 27) and LS-B (n = 36) in pigs (C). Data are presented as the mean ± standard error mean.

Table 1

Information on primer conditions.

Genes	Sequence (5′–3′)	AnnealingTemp. (°C)	Cycle	Product Size (bp)	Accession No.
Oct4	F: AAGCAGTGACTATTCGCAAC	60	40	136	NM_001113060.1
	R: CAGGGTGGTGAAGTGAGG
Nanog	F: TTCCTTCCTCCATGGATCTG	60	40	214	NM_001129971.1
	R: ATCTGCTGGAGGCTGAGGTA
Sox2	F: CGCAGACCTACATGAACG	60	40	103	NM_001123197.1
	R: TCGGACTTGACCACTGAG
SOD1	F: TGCAGGTCCTCACTTCAATC	60	40	257	NM_001190422.1
	R: CCAAACGACTTCCAGCATTTC
SOD2	F: GTTGGCTCGGTTTCAACAAG	60	40	212	NM_214127.2
	R: GGCGTATCGCTCAGTTACAT
CAT	F: CGAAGGCGAAGGTGTTTG	52	40	374	NM_214301.2
	R: AGTGTGCGATCCATATCC
GPx1	F: GGACTACACCCAGATGAATGAG	60	40	216	NM_214201.1
	R: AAGAGCGGGTGAGCATTT
Bax	F: CTCAGGATGCATCTACCAAGAA	60	40	213	XM_003127290.5
	R: GCACCAGTTTACTGGCAAAG
Bcl-2	F: AACTTGGATGGCCACTTACC	60	40	199	NM_214285.1
	R: TTTCCGACTGAAGAGCGAAC
Cdc2	F: GGTGTTCCTAGTACTGCCATTC	60	40	179	NM_001159304.2
	R: GAATCCATGAACTGACCAGGAG
CCNB1	F: GTGTCAGGCTTTCTCTGATGT	62	40	199	NM_001170768.1
	R: CCAGTCAATTAGGATGGCTCTC
β-actin	F: GGACTTCGAGCAGGAGATGG	60	40	233	XM_003124280
	R: GCACCGTGTTGGCGTAGAGG

Table 2

Comparison of in vitro fertility and blastocyst formation in oocytes of Yorkshire × Landrace × Duroc (YLD) with Duroc and Landrace sperm in pigs.

Group	No. of Oocytes	Cleavage(%)	No. of Embryo Development to (%)
			2 Cell	4 Cell	8 Cell	>16 Cell	Blastocyst
DS+YLDO 1	537	460(84.83 ± 3.64)	29(5.78 ± 1.14)	19(3.38 ± 0.47)	86(16.02 ± 3.38)	258(48.28 ± 5.83)	68(15.18 ± 3.64)
LS+YLDO 2	554	470(84.4 ± 3.09)	25(4.54 ± 0.97)	34(6.44 ± 1.16) *	80(13.38 ± 3.53)	225(42.63 ± 5.15)	106(17.41 ± 3.54) *

Data are presented as the mean ± standard error mean (n = 10). * Values with different superscript letters indicate significant differences within the same row (p < 0.05). ¹ Fertilized YLD oocytes with Duroc sperm (DS+YLDO), ² fertilized YLD oocytes with Landrace sperm (LS+YLDO).

References

1. Samorè, A.B.; Fontanesi, L. Genomic selection in pigs: State of the art and perspectives. Ital. J. Anim. Sci.; 2016; 15, pp. 211-232. [DOI: https://dx.doi.org/10.1080/1828051X.2016.1172034]

2. Lunney, J.K.; Van Goor, A.; Walker, K.E.; Hailstock, T.; Franklin, J.; Dai, C. Importance of the pig as a human biomedical model. Sci. Transl. Med.; 2021; 13, eabd5758. [DOI: https://dx.doi.org/10.1126/scitranslmed.abd5758] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34818055]

3. Benjamin, M.; Yik, S. Precision livestock farming in swine welfare: A review for swine practitioners. Animals; 2019; 9, 133. [DOI: https://dx.doi.org/10.3390/ani9040133] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30935123]

4. Lopez, B.I.M.; Song, C.; Seo, K. Genetic parameters and trends for production traits and their relationship with litter traits in Landrace and Yorkshire pigs. Anim. Sci. J.; 2018; 89, pp. 1381-1388. [DOI: https://dx.doi.org/10.1111/asj.13090]

5. Zhang, S.; Zhang, J.; Olasege, B.S.; Ma, P.; Qiu, X.; Gao, H.; Wang, C.; Wang, Y.; Zhang, Q.; Yang, H. Estimation of genetic parameters for reproductive traits in connectedness groups of Duroc, Landrace and Yorkshire pigs in China. J. Anim. Breed. Genet.; 2020; 137, pp. 211-222. [DOI: https://dx.doi.org/10.1111/jbg.12431]

6. Ogawa, S.; Konta, A.; Kimata, M.; Ishii, K.; Uemoto, Y.; Satoh, M. Estimation of genetic parameters for farrowing traits in purebred Landrace and Large White pigs. Anim. Sci. J.; 2019; 90, pp. 23-28. [DOI: https://dx.doi.org/10.1111/asj.13120]

7. Ding, R.; Quan, J.; Yang, M.; Wang, X.; Zheng, E.; Yang, H.; Fu, D.; Yang, Y.; Yang, L.; Li, Z. Genome-wide association analysis reveals genetic loci and candidate genes for feeding behavior and eating efficiency in Duroc boars. PLoS ONE; 2017; 12, e0183244. [DOI: https://dx.doi.org/10.1371/journal.pone.0183244]

8. Tang, Z.; Yin, L.; Yin, D.; Zhang, H.; Fu, Y.; Zhou, G.; Zhao, Y.; Wang, Z.; Liu, X.; Li, X. Development and application of an efficient genomic mating method to maximize the production performances of three-way crossbred pigs. Brief. Bioinf.; 2023; 24, bbac587. [DOI: https://dx.doi.org/10.1093/bib/bbac587]

9. Fernández-López, P.; Garriga, J.; Casas, I.; Yeste, M.; Bartumeus, F. Predicting fertility from sperm motility landscapes. Commun. Biol.; 2022; 5, 1027. [DOI: https://dx.doi.org/10.1038/s42003-022-03954-0]

10. Myromslien, F.D.; Tremoen, N.H.; Andersen-Ranberg, I.; Fransplass, R.; Stenseth, E.B.; Zeremichael, T.T.; van Son, M.; Grindflek, E.; Gaustad, A.H. Sperm DNA integrity in Landrace and Duroc boar semen and its relationship to litter size. Reprod. Domest. Anim.; 2019; 54, pp. 160-166. [DOI: https://dx.doi.org/10.1111/rda.13322]

11. Barquero, V.; Roldan, E.R.; Soler, C.; Yániz, J.L.; Camacho, M.; Valverde, A. Predictive capacity of boar sperm morphometry and morphometric sub-populations on reproductive success after artificial insemination. Animals; 2021; 11, 920. [DOI: https://dx.doi.org/10.3390/ani11040920] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33805060]

12. Van Voorhis, B.J. In vitro fertilization. N. Engl. J. Med.; 2007; 356, pp. 379-386. [DOI: https://dx.doi.org/10.1056/NEJMcp065743] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17251534]

13. Dhillon, R.; McLernon, D.; Smith, P.; Fishel, S.; Dowell, K.; Deeks, J.; Bhattacharya, S.; Coomarasamy, A. Predicting the chance of live birth for women undergoing IVF: A novel pretreatment counselling tool. Hum. Reprod.; 2016; 31, pp. 84-92. [DOI: https://dx.doi.org/10.1093/humrep/dev268] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26498177]

14. Piotrowska-Nitsche, K.; Chan, A.W. Effect of sperm entry on blastocyst development after in vitro fertilization and intracytoplasmic sperm injection—Mouse model. J. Assist. Reprod. Genet.; 2013; 30, pp. 81-89. [DOI: https://dx.doi.org/10.1007/s10815-012-9896-6] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23224695]

15. Catalá, M.G.; Izquierdo, D.; Rodríguez-Prado, M.; Hammami, S.; Paramio, M.-T. Effect of oocyte quality on blastocyst development after in vitro fertilization (IVF) and intracytoplasmic sperm injection (ICSI) in a sheep model. Fertil. Steril.; 2012; 97, pp. 1004-1008. [DOI: https://dx.doi.org/10.1016/j.fertnstert.2011.12.043]

16. Sirard, M.-A. 40 years of bovine IVF in the new genomic selection context. Reproduction; 2018; 156, pp. R1-R7. [DOI: https://dx.doi.org/10.1530/REP-18-0008]

17. Gil, M.; Cuello, C.; Parrilla, I.; Vazquez, J.; Roca, J.; Martinez, E. Advances in swine in vitro embryo production technologies. Reprod. Domest. Anim.; 2010; 45, pp. 40-48. [DOI: https://dx.doi.org/10.1111/j.1439-0531.2010.01623.x]

18. Nguyen, B.X.; Kikuchi, K.; Uoc, N.T.; Dang-Nguyen, T.Q.; Linh, N.V.; Men, N.T.; Nguyen, T.T.; Nagai, T. Production of B an miniature pig embryos by in vitro fertilization: A comparative study with L andrace. Anim. Sci. J.; 2015; 86, pp. 487-493. [DOI: https://dx.doi.org/10.1111/asj.12317]

19. Fowler, K.E.; Mandawala, A.A.; Griffin, D.K.; Walling, G.A.; Harvey, S.C. The production of pig preimplantation embryos in vitro: Current progress and future prospects. Reprod. Biol.; 2018; 18, pp. 203-211. [DOI: https://dx.doi.org/10.1016/j.repbio.2018.07.001]

20. Jochems, R.; Gaustad, A.H.; Zak, L.J.; Grindflek, E.; Zeremichael, T.T.; Oskam, I.C.; Myromslien, F.D.; Kommisrud, E.; Krogenæs, A.K. Effect of two ‘progressively motile sperm–oocyte’ratios on porcine in vitro fertilization and embryo development. Zygote; 2022; 30, pp. 543-549. [DOI: https://dx.doi.org/10.1017/S0967199422000053]

21. Schulze, M.; Buder, S.; Rüdiger, K.; Beyerbach, M.; Waberski, D. Influences on semen traits used for selection of young AI boars. Anim. Reprod. Sci.; 2014; 148, pp. 164-170. [DOI: https://dx.doi.org/10.1016/j.anireprosci.2014.06.008] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25001503]

22. Jiesisibieke, D.; Tian, T.; Zhu, X.; Fang, S.; Zhang, N.; Ma, J.; Xia, Y.; Li, R.; Liu, P.; Qiao, J. Reproductive Outcomes of Conventional In Vitro Fertilization and Intracytoplasmic Sperm Injection in Patients with Non-Severe MaleInfertility Across Poor and Different Sub-Optimal Ovarian Response Categories: A Cohort Study Based on 30,352 Fresh Cycles from 2009–2019. Reprod. Sci.; 2024; 31, pp. 1353-1362. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/38228973]

23. Dcunha, R.; Hussein, R.S.; Ananda, H.; Kumari, S.; Adiga, S.K.; Kannan, N.; Zhao, Y.; Kalthur, G. Current insights and latest updates in sperm motility and associated applications in assisted reproduction. Reprod. Sci.; 2022; 29, pp. 7-25. [DOI: https://dx.doi.org/10.1007/s43032-020-00408-y] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33289064]

24. Dordas-Perpinyà, M.; Yanez-Ortiz, I.; Sergeant, N.; Mevel, V.; Bruyas, J.-F.; Catalán, J.; Delehedde, M.; Briand-Amirat, L.; Miró, J. ProAKAP4 concentration is related to sperm motility and motile sperm subpopulations in frozen–thawed horse semen. Animals; 2022; 12, 3417. [DOI: https://dx.doi.org/10.3390/ani12233417]

25. Li, J.; Li, Y.; Cheng, M.; Ye, F.; Li, W.; Wang, C.; Huang, Y.; Wu, Y.; Xuan, R.; Liu, G. Gut microbial diversity among Yorkshire, Landrace and Duroc boars and its impact on semen quality. AMB Express; 2022; 12, 158. [DOI: https://dx.doi.org/10.1186/s13568-022-01496-6]

26. Barranco, I.; Rubio, C.P.; Tvarijonaviciute, A.; Rodriguez-Martinez, H.; Roca, J. Measurement of oxidative stress index in seminal plasma can predict in vivo fertility of liquid-stored porcine artificial insemination semen doses. Antioxidants; 2021; 10, 1203. [DOI: https://dx.doi.org/10.3390/antiox10081203]

27. Hu, J.; Cheng, D.; Gao, X.; Bao, J.; Ma, X.; Wang, H. Vitamin C enhances the in vitro development of porcine pre-implantation embryos by reducing oxidative stress. Reprod. Domest. Anim.; 2012; 47, pp. 873-879. [DOI: https://dx.doi.org/10.1111/j.1439-0531.2011.01982.x]

28. Truong, T.; Gardner, D. Antioxidants improve IVF outcome and subsequent embryo development in the mouse. Hum. Reprod.; 2017; 32, pp. 2404-2413. [DOI: https://dx.doi.org/10.1093/humrep/dex330]

29. Jochems, R.; Gaustad, A.H.; Styrishave, B.; Zak, L.J.; Oskam, I.C.; Grindflek, E.; Myromslien, F.D.; Kommisrud, E.; Krogenæs, A.K. Follicular fluid steroid hormones and in vitro embryo development in Duroc and Landrace pigs. Theriogenology; 2022; 190, pp. 15-21. [DOI: https://dx.doi.org/10.1016/j.theriogenology.2022.07.004]

30. Kim, B.; Min, Y.; Jeong, Y.; Ramani, S.; Lim, H.; Jo, Y.; Kim, W.; Choi, Y.; Park, S. Comparison of growth performance and related gene expression of muscle and fat from Landrace, Yorkshire, and Duroc and Woori black pigs. J. Anim. Sci. Technol.; 2023; 65, 160. [DOI: https://dx.doi.org/10.5187/jast.2022.e93]

31. Lee, S.-H.; Park, C.-K. Effect of magnetized extender on sperm membrane integrity and development of oocytes in vitro fertilized with liquid storage boar semen. Anim. Reprod. Sci.; 2015; 154, pp. 86-94. [DOI: https://dx.doi.org/10.1016/j.anireprosci.2014.12.015] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25592860]

32. Lee, A.-S.; Lee, S.-H.; Lee, S.; Yang, B.-K. Effects of curcumin on sperm motility, viability, mitochondrial activity and plasma membrane integrity in boar semen. Biomed. Sci. Lett.; 2017; 23, pp. 406-410. [DOI: https://dx.doi.org/10.15616/BSL.2017.23.4.406]

33. Silva, P.; Gadella, B. Detection of damage in mammalian sperm cells. Theriogenology; 2006; 65, pp. 958-978. [DOI: https://dx.doi.org/10.1016/j.theriogenology.2005.09.010] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/16242762]

34. Papaioannou, K.; Murphy, R.; Monks, R.; Hynes, N.; Ryan, M.; Boland, M.; Roche, J. Assessment of viability and mitochondrial function of equine spermatozoa using double staining and flow cytometry. Theriogenology; 1997; 48, pp. 299-312. [DOI: https://dx.doi.org/10.1016/S0093-691X(97)84077-0]

35. Lee, Y.-J.; Kim, Y.-J.; Lee, S.-H.; Cheong, H.-T.; Yang, B.-K.; Park, C.-K. Effect of washing culture oil on in vitro development in porcine embryos. Reprod. Dev. Biol.; 2014; 38, pp. 93-98. [DOI: https://dx.doi.org/10.12749/RDB.2014.38.3.93]

36. Park, J.-E.; Lee, S.-H.; Hwangbo, Y.; Park, C.-K. Porcine follicular fluid derived from> 8 mm sized follicles improves oocyte maturation and embryo development during in vitro maturation of pigs. Zygote; 2021; 29, pp. 27-32. [DOI: https://dx.doi.org/10.1017/S0967199420000398]

37. Yao, X.; Jiang, H.; NanXu, Y.; Piao, X.; Gao, Q.; Kim, N.-H. Kaempferol attenuates mitochondrial dysfunction and oxidative stress induced by H2O2 during porcine embryonic development. Theriogenology; 2019; 135, pp. 174-180. [DOI: https://dx.doi.org/10.1016/j.theriogenology.2019.06.013]

38. Zak, L.J.; Gaustad, A.H.; Bolarin, A.; Broekhuijse, M.L.; Walling, G.A.; Knol, E.F. Genetic control of complex traits, with a focus on reproduction in pigs. Mol. Reprod. Dev.; 2017; 84, pp. 1004-1011. [DOI: https://dx.doi.org/10.1002/mrd.22875]

39. Terada, K.; Ohtani, T.; Ogawa, S.; Hirooka, H. Genetic parameters for carcass and meat quality traits in Jinhua, Duroc, and their crossbred pigs. J. Anim. Breed. Genet.; 2024; 141, pp. 33-41. [DOI: https://dx.doi.org/10.1111/jbg.12823]

40. Barquero, V.; Soler, C.; Sevilla, F.; Calderón-Calderón, J.; Valverde, A. A Bayesian analysis of boar spermatozoa kinematics and head morphometrics and their relationship with litter size fertility variables. Reprod. Domest. Anim.; 2021; 56, pp. 1024-1033. [DOI: https://dx.doi.org/10.1111/rda.13946]

41. Dang-Nguyen, T.Q.; Kikuchi, K.; Somfai, T.; Ozawa, M.; Nakai, M.; Maedomari, N.; Viet-Linh, N.; Kanai, Y.; Nguyen, B.X.; Nagai, T. Evaluation of developmental competence of in vitro-produced porcine embryos based on the timing, pattern and evenness of the first cleavage and onset of the second cleavage. J. Reprod. Dev.; 2010; 56, pp. 593-600. [DOI: https://dx.doi.org/10.1262/jrd.10-038M] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20657154]

42. Isom, S.C.; Li, R.F.; Whitworth, K.M.; Prather, R.S. Timing of first embryonic cleavage is a positive indicator of the in vitro developmental potential of porcine embryos derived from in vitro fertilization, somatic cell nuclear transfer and parthenogenesis. Mol. Reprod. Dev.; 2012; 79, pp. 197-207. [DOI: https://dx.doi.org/10.1002/mrd.22013] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22213403]

43. Leite, R.F.; Annes, K.; Ispada, J.; De Lima, C.B.; Dos Santos, É.C.; Fontes, P.K.; Nogueira, M.F.G.; Milazzotto, M.P. Oxidative stress alters the profile of transcription factors related to early development on in vitro produced embryos. Oxid. Med. Cell. Longev.; 2017; 2017, 1502489. [DOI: https://dx.doi.org/10.1155/2017/1502489] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29209446]

44. Ufer, C.; Wang, C.C. The roles of glutathione peroxidases during embryo development. Front. Mol. Neurosci.; 2011; 4, 11531. [DOI: https://dx.doi.org/10.3389/fnmol.2011.00012]

45. Takahashi, M. Oxidative stress and redox regulation on in vitro development of mammalian embryos. J. Reprod. Dev.; 2012; 58, pp. 1-9. [DOI: https://dx.doi.org/10.1262/jrd.11-138N]

46. Joo, Y.E.; Jeong, P.-S.; Lee, S.; Jeon, S.-B.; Gwon, M.-A.; Kim, M.J.; Kang, H.-G.; Song, B.-S.; Kim, S.-U.; Cho, S.-K. Anethole improves the developmental competence of porcine embryos by reducing oxidative stress via the sonic hedgehog signaling pathway. J. Anim. Sci. Biotechnol.; 2023; 14, 32. [DOI: https://dx.doi.org/10.1186/s40104-022-00824-x]

47. Padgett, J.; Santos, S.D. From clocks to dominoes: Lessons on cell cycle remodelling from embryonic stem cells. FEBS Lett.; 2020; 594, pp. 2031-2045. [DOI: https://dx.doi.org/10.1002/1873-3468.13862]

48. Kim, S.-H.; Choi, K.-H.; Lee, M.; Lee, D.-K.; Lee, C.-K. Porcine OCT4 reporter system can monitor species-specific pluripotency during somatic cell reprogramming. Cell. Reprogram.; 2021; 23, pp. 168-179. [DOI: https://dx.doi.org/10.1089/cell.2021.0001]

49. Santamaría, D.; Barrière, C.; Cerqueira, A.; Hunt, S.; Tardy, C.; Newton, K.; Cáceres, J.F.; Dubus, P.; Malumbres, M.; Barbacid, M. Cdk1 is sufficient to drive the mammalian cell cycle. Nature; 2007; 448, pp. 811-815. [DOI: https://dx.doi.org/10.1038/nature06046]