In Vivo Evidence for the Preventive Role of Vaccinium macrocarpon Aiton in Indomethacin‐Induced Gastric Ulcer: Focusing on Antioxidant, Anti‐Inflammatory and Anti‐Apoptotic Mechanisms

Abstract

ABSTRACT

The present study aimed to unveil the gastroprotective potential of Vaccinium macrocarpon (VM) extract and its mechanism of action against indomethacin (INDO)‐induced gastric ulcers in rats. To achieve this goal, rats were pretreated with either omeprazole (20 mg/kg) or VM (100 mg/kg) orally for 14 consecutive days. Gastric tissue samples were collected and various parameters were evaluated to understand the mechanism of VM's action, including the levels of superoxide dismutase, malondialdehyde, glutathione, CAT and transforming growth factor beta (TGF‐β), as well as the mRNA expression levels of tumour necrosis factor alpha, interleukin 1 beta, nuclear factor kappa B (NF‐κB) and inhibitor kappa B (IκB). Additionally, the immunopositivity of cyclooxygenase (COX)‐1, COX‐2, PGE2, proliferating cell nuclear antigen (PCNA) and caspase‐3 was assessed. The total amount of phenolic compounds present in the VM extract was high (58.08 µg/mL gallic acid equivalent/mg extract). The healing effect of VM was demonstrated by an increase in the expression of PCNA. Furthermore, the level of TGF‐β was found to increase upon treatment with VM. Analyses of COX‐1, COX‐2 and PGE2 expression in gastric tissue confirmed the gastroprotective effect of VM. Notably, the expression of NF‐κB was markedly reduced, whereas that of IκB was substantially increased. Overall, the findings of this study demonstrate that VM extract has gastroprotective and curative effects against INDO‐induced ulcers through its antioxidant, anti‐inflammatory, mucosal regenerative and anti‐apoptotic activities. Therefore, VM may serve as a useful adjuvant treatment for nonsteroidal anti‐inflammatory drugs–induced gastric ulcer disease.

Introduction

Gastric ulcer is one of the most common gastrointestinal disorders with lesions in the lining of the stomach that may extend to the submucosa or muscularis propria (Guo et al. 2020). In addition to their high incidence, stomach ulcers have many serious complications, such as perforation, bleeding and obstruction, which lead to high morbidity and mortality rates (Escobedo-Hinojosa et al. 2018). The use of nonsteroidal anti-inflammatory drugs (NSAIDs) is the second leading cause of gastric ulcer disease, surpassed only by Helicobacter pylori infection and outranking alcohol use and smoking (Bytzer and Teglbjaerg 2001).

NSAIDs are ubiquitous in the treatment of pain, fever and inflammation, frequently relied upon by millions worldwide. There is an important limitation in the use of these drugs due to their adverse effects in the gastrointestinal system (Takeuchi 2012). The mechanism of NSAID-induced gastric damage occurs because of inhibition of cyclooxygenase (COX) enzymes and suppression of prostaglandin (PG) synthesis. In addition, factors, such as hypermotility, leukocyte–endothelial interactions, neutrophil infiltration, cytokine imbalance and oxidative stress, contribute to the pathogenesis of NSAID-induced gastric damage (Souza et al. 2008; Yadav et al. 2012).

Although there are various chemical drugs that act by suppressing one or more processes involved in the pathogenesis of gastric ulcers, a perfect treatment for this disease has not yet been provided due to the side effects of currently used drugs (Farzaei, Abdollahi, and Rahimi 2015). Due to their safety and wide biological activity, interest in natural medicines is gaining attention daily (Ali Khan, Nazan, and Mat Jais 2017). Despite all this information, natural remedies should be used with caution.

Vaccinium macrocarpon Aiton (VM) is a perennial herb commonly known as the American cranberry. It grows close to the ground and has a woody stem. The plant is native to North America, and its fruit is edible and is known as cranberry. The cranberry, blueberry and Concord grape are the only commercially significant fruits native to North America. Cranberries are grown worldwide, with the majority being grown in the northern United States (85%) and Canada (15%), and a small amount in Chile. Cranberries are currently used for urinary tract infections, stomach ulcers and improving oral hygiene (McKay and Blumberg 2007).

With a history dating back to ancient times, this herb has remained a cornerstone of traditional folk medicine, cherished for its potent medicinal properties in the treatment of urinary tract infections and kidney diseases (Dugoua et al. 2008). In addition, in recent studies, it has been reported that this plant has various protective effects against H. pylori (Li et al. 2019), cancer (Neto, Amoroso, and Liberty 2008), diabetes (Crittenden and Playne 1996), inflammation (Baron et al. 2020), cardiovascular diseases (McKay and Blumberg 2007), oxidative stress (Grace et al. 2014) and endothelial dysfunction (Thimoteo et al. 2019). All these properties have been attributed to the high polyphenolic contents of VM (Vattem, Ghaedian, and Shetty 2005). These polyphenolic compounds include proanthocyanidins, phenolic acids, anthocyanins, catechins, tannins, flavonols, resveratrol and quercetin (Shukla et al. 2018). In particular, proanthocyanidins are effective in urinary tract infections and in the treatment of H. pylori infection due to their anti-adhesive properties (Burger et al. 2000). Additionally, cranberries appear to be a beneficial therapeutic agent for the protection of urinary tract infections in women who are either pregnant or breastfeeding (Dugoua et al. 2008).

This research aims to explore the potential of VM as a gastroprotective agent in cases of gastric ulcers caused by NSAIDs. We seek to determine the mechanisms behind the interactions between nuclear factor kappa B (NF-κB)/inhibitor kappa B (IκB) and COX-1/COX-2/PGE2, and how VM may affect these pathways to provide gastroprotection. By investigating these underlying mechanisms, we hope to shed light on the potential therapeutic benefits of VM in treating NSAID-induced gastric ulcers.

Materials and Methods

Drugs and Chemicals

VM was purchased from Herb Pharm (Oregon, USA) as a hydroalcoholic extract prepared by treating dried cranberry fruits with solvent (52%–62% organic cane alcohol) at a ratio of 1:4. Indomethacin (INDO) and omeprazole (OME) were purchased from Deva (Istanbul, Turkey).

Animals

Twenty-four are adult male Wistar rats, which weighed between 220 and 320 g. The rats were kept in cages that had a 12-h dark/light cycle, at a constant temperature of 22°C ± 1°C.

Methodology for Conducting Experiments

Four groups of rats were allocated randomly (n = 6). Group I was designated as the control group. Group II was given 100 mg/kg of INDO orally by gavage after fasting for 24 h (El-Ashmawy et al. 2016). Group III was pretreated with 20 mg/kg of OME orally for 14 consecutive days by gavage, then fasted for 24 h before being given INDO. Group IV was pretreated with 100 mg/kg of VM orally for 14 consecutive days by gavage, then fasted for 24 h before being given INDO (Elberry et al. 2010; Galal et al. 2019).

Four hours after INDO administration, the rats were sacrificed using anesthesia. The stomachs were removed and cut into pieces. The samples were fixed in a solution for histopathological and immunohistochemical analysis. The unused tissues were cryogenically stored for future use in biochemical and molecular analysis.

Antioxidant and Free Radical Scavenging Activity

Determination of Total Phenolic Component (TPC)

To determine the total amount of phenolic compounds in the plant extract, a modified version of the Folin and Denis method was used, which was developed by Singleton (Slinkard and Singleton 1977). Gallic acid was used as the standard substance. Gallic acid solutions were prepared in the concentration range of 100–700 µg/mL and were treated with Folin–Ciocalteu Reagent (FCR) and aqueous Na₂CO₃. The gallic acid standard graph was obtained by recording absorbances at 760 nm (blank: distilled water). Stock solutions of the extract were prepared at a concentration of 1 mg/mL. Samples were treated the same as standard solutions and absorbances were recorded at 760 nm. The gallic acid equivalents (GAEs) corresponding to the absorbance values of the samples were found with the equation obtained from the reference graph. Results were expressed in GAE and micrograms.

DPPH^• Radical-Scavenging Activity

To determine the antioxidant activity of VM extract, the DPPH^• radical scavenging method was used on the basis of Blois's (1958) method. In this method, a 1 mM DPPH^• solution was used as a free radical, and α-tocopherol and Trolox were used as standard antioxidants. To prepare the extract, stock solutions were prepared at 10 different concentrations ranging from 10 to 300 µg/mL. The absorbance of the samples was measured at 517 nm.

ABTS^•+ Radical-Scavenging Activity

To determine the ABTS^•+ cation radical scavenging activities of the extracts, the study by Re et al. (1999) was followed. A 2 mM ABTS^•+ solution was used as a free radical, whereas α-tocopherol and Trolox were used as standard antioxidants. Ten different concentrations of the extracts were prepared at the range of 10–300 µg/mL. The absorbances of whole samples were gained at 734 nm.

Biochemical Analysis

Malondialdehyde (MDA) (Cat No.:E-EL-0060) and transforming growth factor beta (TGF-β) (Cat No.: E-EL-R0084) levels and superoxide dismutase (SOD) (Cat No.: E-EL-R1424) catalase (CAT) (Cat No.: E-BC-K031-M) and glutathione (GSH) (Cat No.: E-EL-0026) activity were measured using an ELISA kit (Elabscience, United States) consistent with the guidelines provided by the manufacturer (Okkay et al. 2021; Ahiskali et al. 2021).

Molecular Analysis

RT-PCR analysis was conducted following the methods outlined in the previous literature (Vattem, Ghaedian, and Shetty 2005). The Rotor-Gene Q (QIAGEN) was employed to evaluate the relative mRNA expressions of NF-κB, inhibitor kappa B (IκB), tumour necrosis factor alpha (TNF-α) and interleukin 1 beta (IL-1β) mRNA in stomach tissue. The obtained target gene expression levels were normalized to the reference gene 𝛽-actin (Ferah Okkay, Okkay, and Cicek 2024). The PCR primers utilized are listed in Table 1. The results were obtained with the 2^−ΔΔCt method (Ferah Okkay et al. 2021).

TABLE 1 List of the sequences of the primers used for reverse transcription real-time quantitative polymerase chain reaction (RT-qPCR).

Genes	Forward sequence (5′–3′)	Reverse sequence (3′–5′)
NF-κB	CGAATGTAGACACGAAGCGT	CAACCAGGAAGCATAGACCG
IκB	CTCATGCTACACTCACTGCC	GCTCTTCTGCCGGACTTTAG
IL-1β	TGCTGTGTGATTGCAGACAA	GTACAGCGTTCCCAGTCATC
TNF-α	CACACGAGACGCTGAAGTAG	AACAGTCTGGGAAGCTCTGA

Tissue Analysis of Stomach Tissue Using Histopathological Methods

Samples of stomach tissues were taken from all rats in each group and then preserved in a solution called neutral buffered formalin. They were then processed according to a standard protocol. Thin sections of the tissues, about 5 µm in thickness, were cut and stained with H&E dye, and stained sections were then examined under a light microscope. A pathologist who did not know which treatment the rats had received, looked at the samples to see if there were any abnormal changes in the tissues (Liu, Wang, and Luo 2016).

Immunohistochemical Analysis

The sections were exposed to primary antibodies against 8-OHDG, 4 Hydroxynonenal (4-HNE) and dityrosine (DT), which were diluted 1:200. Diaminobenzidine tetrachloride (DAB) was used to visualize the immune reaction. The staining was graded as negative, weak, moderate, or strong depending on the intensity of the staining (Ferah Okkay et al. 2022). The percentage of area expressing COX-1, COX-2, PGE2 and proliferating cell nuclear antigen (PCNA) was estimated by measuring the stained areas of each section and calculating an average using imaging software called Image J (Okkay et al. 2022). The person analyzing the images was not aware of the treatments given to the animals. The individual examining the images was blinded to the treatments administered to the animals.

Statistical Methods Used in the Analysis of Data

The mean ± standard deviation (SD) was used to represent all values. One-way ANOVA was conducted on biochemical and molecular data, followed by post hoc Tukey's test using IBM SPSS (Version 23.0, IBM-USA) software (p < 0.05). For histopathological parameters, Kruskal–Wallis one-way analysis was performed to determine differences between the groups, followed by the Mann–Whitney U test (p < 0.05). In vitro antioxidant assays were performed in triplicate for phytochemical assays, and the statistical significance was determined using the Kruskal–Wallis test (p < 0.05).

Results

Phytochemical Analysis

In our study, the amount of polyphenolic compounds in the extract from VM was detected by testing the TPC. The total amount of phenolic compounds given in GAEs of the plant extract was high, as expected (58.09 ± 0.003 µg/mL GAE/mg extract). Although the ABTS^•+ and DPPH^• radical scavenging capacities of the extract were lower than those of the standard compounds, the results were considered significant in terms of antioxidant effects. The ABTS^•+ radical scavenging activity for VM extract and the standards is expressed as percent inhibition: (Trolox [54.96] > α-tocopherol [27.6] > VM extract [6.9] at a concentration of 50 µg/mL). Similarly, the DPPH^• scavenging activity results for VM and the standards are presented as percent inhibition: (Trolox [65.75] > α-ocopherol [30.09] > VM extract [8.76] at a concentration of 25 µg/mL). These findings highlight the comparative antioxidant activity of the extract and standards, as summarized in Table 2. Trolox and α-tocopherol serve as positive controls due to their well-established antioxidant properties.

TABLE 2 ABTS^•+ and DPPH^• radical scavenging activity results of Vaccinium macrocarpon.

ABTS•+ radical scavenging activity
	% Inhibition (25 µg/mL)	% Inhibition (50 µg/mL)
Vaccinium macrocarpon extract	2.51 ± 0.015	6.9 ± 0.027
Trolox	19.02 ± 0.049	54.96 ± 0.011
α-Tocopherol	4.22 ± 0.041	27.6 ± 0.0002
DPPH• radical scavenging activity
Vaccinium macrocarpon extract	8.76 ± 0.048	20.87 ± 0.008
Trolox	65.75 ± 0.037	91.65 ± 0.002
α-Tocopherol	30.09 ± 0.044	61.78 ± 0.024

Biochemical Results

Oxidative Stress Markers

The results presented in Figure 1 indicate that the activities of SOD, CAT and GSH were markedly lower in the INDO group compared to the control group, whereas MDA levels were markedly higher (p < 0.001). In contrast, the activities of SOD, CAT and GSH were markedly higher, and MDA levels were significantly lower in the VM and OME groups in comparison with the INDO group (p < 0.001).

[IMAGE OMITTED. SEE PDF]

Concentrations of TGF-β in Stomach Tissue

The results indicate that there was a marked decrease in TGF-β levels in the INDO group when compared to the control group (p < 0.001). However, treatment with OME and VM significantly increased TGF-β levels in the VM and OME groups (p < 0.001) (Figure 2).

[IMAGE OMITTED. SEE PDF]

Molecular Results

TNF-α, IL-1β, NF-κB and IκB mRNA Expression in Stomach Tissue

The relative mRNA expression of IL-1β, NF-κB and TNF-α was markedly increased in the INDO group than in the control group (p < 0.001). Conversely, the IκB relative mRNA expression level was markedly reduced in the INDO group compared to the control group. However, the level of relative mRNA expressions of IL-1β, NF-κB and TNF-α mRNA decreased significantly in the OME and VM groups in comparison to the INDO group. Additionally, the IκB relative mRNA expression was significantly increased in the OME and VM treatment groups (p < 0.001). Among the treatment groups, the VM-treated group had the highest increase in IκB relative mRNA expression (Figures 2 and 3).

[IMAGE OMITTED. SEE PDF]

Histopathological Results

The control group displayed normal structure with an undamaged epithelium and gastric glands. In contrast, the IND group showed severe pathological changes with disruption in the epithelium and necrosis in the gastric glands, accompanied by haemorrhagic damage. Additionally, leukocyte infiltration in the mucosa deeply extended into the submucosal area. OME treatment relieved the pathological changes when compared to INDO treatment alone. Moreover, pretreatment with VM showed a normal mucosa with minimal infiltration of inflammatory cells and mild histopathological changes. There were no superficial mucosal ulcers and fewer inflammatory cellular infiltrates in the VM group. Our results showed that administering INDO resulted in a significant (p < 0.05) elevation in gastric mucosal integrity, leukocyte infiltration and gastric haemorrhage. However, a marked reduction (p < 0.05) was observed in both the OME and VM groups compared to the INDO group. The results were expressed as a histopathological score using the histology section score criteria for scoring in microscopic evaluation, as shown in Figure 4E–G.

[IMAGE OMITTED. SEE PDF]

Immunohistochemical Results

Immunohistochemical staining was performed to measure the immunoreactivity of COX-1, COX-2, PGE₂, caspase-3 and PCNA in the stomach sections, and immunohistochemical staining was carried out (Figures 5–9). Immunohistochemical staining of COX-1, COX-2, PGE₂ and PCNA in the stomach tissues was markedly (p < 0.05) lower in the INDO group than in the control group, whereas these biomarkers were significantly higher in both the OME and VM groups. No significant difference was observed between the scores of COX-1 and COX-2 in the OME and VM groups, whereas PGE₂ and PCNA scores were significantly different between the VM and OME groups. Caspase-3 expression was increased significantly (p < 0.05) in the INDO group compared to the control group, whereas the VM and OME groups showed a significant decrease in caspase-3 expression. The expression of caspase-3 did not show any significant difference between the VM and OME groups.

[IMAGE OMITTED. SEE PDF]

[IMAGE OMITTED. SEE PDF]

[IMAGE OMITTED. SEE PDF]

[IMAGE OMITTED. SEE PDF]

[IMAGE OMITTED. SEE PDF]

Discussion

There are many factors known to cause gastric ulcers, and one of the leading factors is the use of NSAIDs. Although these drugs are frequently prescribed in the treatment of inflammation, fever and pain, they have serious side effects on the gastrointestinal tract (Sostres, Gargallo, and Lanas 2013). INDO, an NSAID, is frequently used to induce ulcerative gastric damage (Pastoris, Verri, and Boschi 2008).

Medicinal plants are traditionally used in the treatment and prevention of many diseases due to the effective compounds they contain. In addition, the pharmaceutical industry uses the active chemical substances contained in medicinal plants in drug synthesis. They are also valuable for the food and cosmetic industries as additives due to their protective effects due to the presence of antioxidant and antimicrobial components (Skrovankova, Misurcova, and Machu 2012). In studies on plants, it has been understood that plants carry various secondary metabolites with antioxidant capacity as well as mineral and primary metabolites. These antioxidant substances are produced by the plant for the purpose of self-defence and vitality and include carotenoids, flavonoids, cinnamic acids, benzoic acids, folic acid, ascorbic acid, tocopherols, tocotrienols. Antioxidants are vital substances that can protect the body against oxidative stress caused by ROSls (Bharti et al. 2012). Although it is known that oxidative stress is among the causes of ageing, it has been proven to play a role in the occurrence of various metabolic diseases in the body, such as cardiovascular, lung and neurodegenerative (Liguori et al. 2018). In another study conducted to determine the antioxidant activity of the lyophilized aqueous extract of VM, the IC₅₀ value was given as 86.63 µg/mL for the DPPH^• radical scavenging effect, and the IC₅₀ value was 99.00 µg/mL for the ABTS^•+ radical scavenging effect (Kalin, Gulcin, and Goren 2015). In a study comparing the antioxidant effects of water, ethanol, methanol and ethyl acetate extracts prepared from V. arctostaphylos L., it was determined that the ethyl acetate extract had a stronger antioxidant effect (IC₅₀ value: 15.6 µg/mL) (Mahboubi, Kazempour, and Taghizadeh 2013). In the study in which the DPPH^• and ABTS^•+ radical scavenging effects of aqueous and hydroethanolic extracts prepared from V. myrtillus were compared, it was observed that the hydroethanolic extract had a better DPPH radical scavenging effect than the aqueous extract. However, the effect was found to be lower when compared to commercial antioxidants (IC₅₀ values for aqueous and hydroethanolic extract DPPH^• radical scavenging activity: 59.0 and 17.8; IC₅₀ values for aqueous and hydroethanolic extract ABTS^•+ radical scavenging activity: 251.2 and 252.2) (Bljajic et al. 2017).

It has been previously shown that INDO administration significantly increases ROS formation. SOD, CAT and GSH are vital endogenous enzymes that protect the cell from oxidative damage by clearing ROS. SOD, an intracellular antioxidant enzyme, mainly converts harmful free radicals into hydrogen peroxide and then into water (Halabi et al. 2014). GSH acts as a barrier, protecting the gastric mucosa against oxidative stress caused by free radicals and peroxides (Brzozowski et al. 2004). The CAT enzyme can scavenge ROS, with its key role in the conversion of the peroxyl radical to water and oxygen (Wong et al. 2013). MDA is the end product of lipid peroxidation and is a biomarker used to assess oxidative stress (Ibrahim, Abdulla, and Hajrezaie 2016). In this study, a significant elevation in MDA levels and a decrease in SOD, GSH and CAT levels were observed in the INDO group, consistent with previous studies (Kim et al. 2013; Koriem, Gad, and Nasiry 2015). However, VM reversed the depletion of SOD, CAT and GSH and elevation of MDA levels. In addition, in parallel with our study, it was noted that VM decreased the level of MDA and increased the activity of SOD, CAT and GSH (Shukla et al. 2018; Palikova et al. 2010; Santana, Oliveira, and Souza 2018). These results showed that VM improves antioxidant enzyme levels and reduces oxidative stress through its high antioxidant capacity.

COX is the key enzyme that converts arachidonic acid to PG. NSAIDs reduce PGE₂ synthesis by inhibiting COX and ultimately cause damage to the mucosa in the gastrointestinal tract (Tanaka et al. 2002). According to our immunohistochemical results, COX-1 and COX-2 expression levels in the VM group were significantly increased compared to those in the INDO group. VM appeared to be able to reverse the inhibition of COX caused by NSAIDs and protected the gastric mucosa.

PGE₂, one of the most important products of the arachidonic acid pathway, is known to inhibit gastric acid secretion, increase blood flow in the gastric mucosa, promote protein synthesis and contribute to cellular regeneration to repair damaged gastric mucosa (Vane and Botting 1998). In addition to all these properties, it was reported that PGE₂ stimulated antioxidant activity in a rat model (Bhattacharya et al. 2007). According to our immunohistochemical findings, VM increased PGE₂ levels compared to INDO and prevented gastric mucosal damage.

There is a widely accepted relationship between inflammation and NSAID-associated stomach ulcers. Oxidative stress may also lead to the activation of proinflammatory cytokines that play an active role in the ulcer, and thus, the increase in ROS-related oxidative stress also leads to an increase in proinflammatory mediators (Diaz-Rivas et al. 2015). TNF-α and IL-1β are proinflammatory cytokines that play important roles in inflammatory reactions (Duvigneau et al. 2019). In our study, although TNF-α and IL-1β cytokine levels increased in the ulcer group, these levels decreased significantly in the VM group. In previous studies, it has been shown that TNF-α and IL-1β levels are increased in INDO-induced ulcers in rats (Eraslan et al. 2020). In addition, VM extract has also been reported to have an anti-inflammatory effect and reduce TNF-α and IL-1β levels (Cai et al. 2019).

The transcription of various inflammation-related proteins and those involved in apoptotic cell death is regulated by NF-κB. When not activated, NF-κB is found in the cytosol complexed with an inhibitory protein IκB (Albensi and Mattson 2000). However, when faced with pathological conditions like inflammation, the IκB protein gets phosphorylated or ubiquitinated, resulting in the degradation and activation of NF-κB. It is believed that the activation of NF-κB plays a crucial role in the pathogenesis of inflammation and could be a promising therapeutic target for treating gastric ulcers (Kunnumakkara et al. 2018).

To gain insight into the signalling pathway of VM, the levels of NF-κB, IκB, TNF-a, IL-1β, PGE₂ and COX-2 were examined in this study. COX-2 has been generally recognized as an inflammatory marker in injured tissues (Frech and Go 2009). Previous studies have demonstrated that NF-κB is a transcription factor that might regulate the expression of COX-2 and inflammatory parameters (Zhao et al. 2013). IκB, an inhibitor of the NF-κB signalling pathway, effectively prevents inflammation in vivo (Zeng et al. 2016).

In an ulcer study conducted by Roh et al. (2017), it was shown that IκBα levels decreased and NF-κB levels increased in the ulcer group, consistent with our results. In the VM-treated group, NF-κB expression levels significantly decreased, in-line with previous studies (Tipton, Christian, and Blumer 2016). However, in our study, IκB levels increased in parallel with the decrease in NF-κB levels in the VM group. In light of these data, it can be hypothesized that the healing and protective effects of VM in ulcer treatment are closely related to the NF-κB/IκB pathway.

TGF-β, one of the important growth factors associated with ulcers, has a healing effect on stomach ulcers by inducing cell migration, enhancing vascular proliferation and increasing extracellular matrix accumulation (Albaayit et al. 2016). Consistent with the studies conducted with INDO, our results also showed that TGF-β decreased in the INDO group; however, treatment with VM upregulated TGF-β levels (Tominaga et al. 1997). It can be concluded that VM supports ulcer healing by upregulating TGF-β levels.

In our study, molecular markers of both cell proliferation and apoptosis were investigated to examine the healing effects of VM. Our results showed that there was a significant increase in caspase-3, a marker used to determine apoptotic cell death, in the INDO group, similar to previous studies (Geyikoglu et al. 2018). VM reduced caspase-3 levels and protected against INDO. Cell proliferation is known to make an important contribution to wound healing caused by gastric ulcers (Tarnawski 2005). PCNA is a protein that participates in DNA replication and repair and displays these effects by surrounding DNA as a clamp (Moldovan, Pfander, and Jentsch 2007). In our study, although PCNA levels decreased in the INDO group, PCNA levels increased in the VM group. Previously, it was shown that INDO increased the PCNA level due to tissue damage (Fornai et al. 2011). In studies conducted with SGC-7901 and MCF-7 cancer cell lines, it was found that VM inhibits the proliferation of cancer cells by decreasing PCNA expression (Liu et al. 2009; Sun and Hai Liu 2006).

The tissue damage was also confirmed by our histopathological findings. Deterioration of the lamina epithelium and necrosis of the gastric glands and severe pathological changes were observed in the INDO group, and a significant improvement was observed in the VM group.

Conclusion

The role of VM, which is known to have antimicrobial effects against H. pylori, in ulcer treatment was investigated for the first time in this study. Our study clearly demonstrates that VM extract has gastroprotective effects against INDO-induced ulcers through molecular, biochemical and histopathological analyses.

Author Contributions

Conceptualization and design: Ufuk Okkay, Irmak Ferah Okkay and Ismail Cagri Aydin. Investigation and data analysis: Ufuk Okkay and Irmak Ferah Okkay. Writing–original draft: Ufuk Okkay, Irmak Ferah Okkay and Songul Karakaya. Writing–review and editing: Ufuk Okkay, Irmak Ferah Okkay, Songul Karakaya, Ahmet Hacimuftuoglu and A. M. Abd El-Aty. Methodolody: Ufuk Okkay, Irmak Ferah Okkay, Ismail Cagri Aydin, Songul Karakaya, Mustafa Ozkaraca, Zuhal Güvenalp, Bilge Aydin, Fatma Yesilyurt, Aysegul Yilmaz, Betul Cicek, and Hilal Kadioglu Kalkandelen. All authors have read and agreed to the published version of the article.

Ethics Statement

The research followed ethical procedures that were approved by the Local Animal Care Committee of Ataturk University-Turkey (approval number: E.2100036495).

Conflicts of Interest

The authors declare no conflicts of interest.

Data Availability Statement

Data will be made available on request.

Peer Review

The peer review history for this article is available at .

References

Ahiskali, I., I. Ferah Okkay, and R. Mammadov, et al. 2021. “Effect of Taxifolin on Cisplatin‐Associated Oxidative Optic Nerve Damage in Rats.” Cutaneous and Ocular Toxicology 40, no. 1: 1–6. https://doi.org/10.1080/15569527.2020.1844726.

Albaayit, S. F., Y. Abba, R. Abdullah, and N. Abdullah. 2016. “Prophylactic Effects of Clausena excavata Burum. F. Leaf Extract in EThanol‐Induced Gastric Ulcers.” Drug Design, Development and Therapy 10: 1973–1986.

Albensi, B. C., and M. P. Mattson. 2000. “Evidence for the Involvement of TNF and NF‐KappaB in Hippocampal Synaptic Plasticity.” Synapse 35, no. 2: 151–159.

Ali Khan, M. S., S. Nazan, and A. M. Mat Jais. 2017. “Flavonoids and Anti‐Oxidant Activity Mediated Gastroprotective Action of Leathery Murdah, Terminalia coriacea (Roxb.) Wight & Arn. Leaf Methanolic Extract in Rats.” Arquivos de Gastroenterologia 54, no. 3: 183–191.

Baron, G., A. Altomare, L. Regazzoni, et al. 2020. “Profiling Vaccinium macrocarpon Components and Metabolites in Human Urine and the Urine Ex‐Vivo Effect on Candida albicans Adhesion and Biofilm‐Formation.” Biochemical Pharmacology 173: 113726. https://doi.org/10.1016/j.bcp.2019.113726.

Bharti, R., G. Ahuja, S. Ganapathy, and S. S. Dakappa. 2012. “A Review on Medicinal Plants Having Antioxidant Potential.” Journal of Pharmacy Research 5, no. 8: 4278–4287.

Bhattacharya, S., D. Banerjee, A. K. Bauri, S. Chattopadhyay, and S. K. Bandyopadhyay. 2007. “Healing Property of the Piper betel Phenol, Allylpyrocatechol Against Indomethacin‐Induced Stomach Ulceration and Mechanism of Action.” World Journal of Gastroenterology 13, no. 27: 3705–3713. https://doi.org/10.3748/wjg.v13.i27.3705.

Bljajic, K., R. Petlevski, L. Vujic, et al. 2017. “Chemical Composition, Antioxidant and Alpha‐Glucosidase‐Inhibiting Activities of the Aqueous and Hydroethanolic Extracts of Vaccinium myrtillus Leaves.” Molecules (Basel, Switzerland) 22, no. 5: 703. https://doi.org/10.3390/molecules22050703.

Blois, M. S. 1958. “Antioxidant Determinations by the Use of a Stable Free Radical.” Nature 181: 1199–1200. https://doi.org/10.1038/1811199a0.

Brzozowski, T., P. C. Konturek, S. J. Konturek, et al. 2004. “Exogenous and Endogenous Ghrelin in Gastroprotection Against Stress‐Induced Gastric Damage.” Regulatory Peptides 120, no. 1–3: 39–51. https://doi.org/10.1016/j.regpep.2004.02.010.

Burger, O., I. Ofek, M. Tabak, E. I. Weiss, N. Sharon, and I. Neeman. 2000. “A High Molecular Mass Constituent of Cranberry Juice Inhibits Helicobacter pylori Adhesion to Human Gastric Mucus.” FEMS Immunology and Medical Microbiology 29, no. 4: 295–301. https://doi.org/10.1111/j.1574‐695X.2000.tb01537.x.

Bytzer, P., P. S. Teglbjaerg, and Danish Ulcer Study Group. 2001. “Helicobacter pylori‐Negative Duodenal Ulcers: Prevalence, Clinical Characteristics, and Prognosis–Results From a Randomized Trial With 2‐Year Follow‐Up.” American Journal of Gastroenterology 96, no. 5: 1409–1416.

Cai, X., Y. Han, M. Gu, et al. 2019. “Dietary Cranberry Suppressed Colonic Inflammation and Alleviated Gut Microbiota Dysbiosis in Dextran Sodium Sulfate‐Treated Mice.” Food & Function 10, no. 10: 6331–6341.

Crittenden, R. G., and M. J. Playne. 1996. “Production, Properties and Applications of Food‐Grade Oligosaccharides.” Trends in Food Science & Technology 7, no. 11: 353–361.

Diaz‐Rivas, J. O., E. Herrera‐Carrera, J. A. Gallegos‐Infante, et al. 2015. “Gastroprotective Potential of Buddleja scordioides Kunth Scrophulariaceae Infusions; Effects Into the Modulation of Antioxidant Enzymes and Inflammation Markers in an In Vivo Model.” Journal of Ethnopharmacology 169: 280–286. https://doi.org/10.1016/j.jep.2015.04.024.

Dugoua, J. J., D. Seely, D. Perri, E. Mills, and G. Koren. 2008. “Safety and Efficacy of Cranberry (Vaccinium macrocarpon) During Pregnancy and Lactation.” Canadian Journal of Clinical Pharmacology = Journal Canadien De Pharmacologie Clinique 15, no. 1: e80–e86.

Duvigneau, J. C., A. Luis, A. M. Gorman, et al. 2019. “Crosstalk Between Inflammatory Mediators and Endoplasmic Reticulum Stress in Liver Diseases.” Cytokine 124: 154577. https://doi.org/10.1016/j.cyto.2018.10.018.

El‐Ashmawy, N. E., E. G. Khedr, H. A. El‐Bahrawy, and H. M. Selim. 2016. “Nebivolol Prevents Indomethacin‐Induced Gastric Ulcer in Rats.” Journal of Immunotoxicology 13, no. 4: 580–589. https://doi.org/10.3109/1547691X.2016.1142488.

Elberry, A. A., A. B. Abdel‐Naim, E. A. Abdel‐Sattar, et al. 2010. “Cranberry (Vaccinium macrocarpon) Protects Against Doxorubicin‐Induced Cardiotoxicity in Rats.” Food and Chemical Toxicology 48, no. 5: 1178–1184. https://doi.org/10.1016/j.fct.2010.02.008.

Eraslan, E., A. Tanyeli, M. C. Guler, N. Kurt, and Z. Yetim. 2020. “Agomelatine Prevents Indomethacin‐Induced Gastric Ulcer in Rats.” Pharmacological Reports 72, no. 4: 984–991. https://doi.org/10.1007/s43440‐019‐00049‐2.

Escobedo‐Hinojosa, W. I., E. Gomez‐Chang, K. Garcia‐Martinez, R. Guerrero Alquicira, A. Cardoso‐Taketa, and I. Romero. 2018. “Gastroprotective Mechanism and Ulcer Resolution Effect of Cyrtocarpa procera Methanolic Extract on Ethanol‐Induced Gastric Injury.” Evidence‐Based Complementary and Alternative Medicine 2018: 2862706. https://doi.org/10.1155/2018/2862706.

Farzaei, M. H., M. Abdollahi, and R. Rahimi. 2015. “Role of Dietary Polyphenols in the Management of Peptic Ulcer.” World Journal of Gastroenterology 21, no. 21: 6499–6517. https://doi.org/10.3748/wjg.v21.i21.6499.

Ferah Okkay, I., U. Okkay, B. Cicek, et al. 2021. “Neuroprotective Effect of Bromelain in 6‐Hydroxydopamine Induced In Vitro Model of Parkinson's Disease.” Molecular Biology Reports 48, no. 12: 7711–7717. https://doi.org/10.1007/s11033‐021‐06779‐y.

Ferah Okkay, I., U. Okkay, B. Cicek, et al. 2024. “Syringic Acid Guards Against Indomethacin‐Induced Gastric Ulcer by Alleviating Inflammation, Oxidative Stress and Apoptosis.” Biotechnic & Histochemistry 99, no. 3: 147–156.

Fornai, M., R. Colucci, L. Antonioli, et al. 2011. “Effects of Esomeprazole on Healing of Nonsteroidal Anti‐Inflammatory Drug (NSAID)‐Induced Gastric Ulcers in the Presence of a Continued NSAID Treatment: Characterization of Molecular Mechanisms.” Pharmacological Research 63, no. 1: 59–67. https://doi.org/10.1016/j.phrs.2010.10.013.

Frech, E. J., and M. F. Go. 2009. “Treatment and Chemoprevention of NSAID‐Associated Gastrointestinal Complications.” Therapeutics and Clinical Risk Management 5, no. 1: 65–73.

Ferah Okkay, I., U. Okkay, I. C. Aydin, et al. 2022. “Centella asiatica Extract Protects Against Cisplatin‐Induced Hepatotoxicity via Targeting Oxidative Stress, Inflammation, and Apoptosis.” Environmental Science and Pollution Research International 29, no. 22: 33774–33784. https://doi.org/10.1007/s11356‐022‐18626‐z.

Galal, S. M., H. F. Hasan, M. K. Abdel‐Rafei, and S. M. El Kiki. 2019. “Synergistic Effect of Cranberry Extract and Losartan Against Aluminium Chloride‐Induced Hepatorenal Damage Associated Cardiomyopathy in Rats.” Archives of Physiology and Biochemistry 125, no. 4: 357–366. https://doi.org/10.1080/13813455.2018.1465437.

Geyikoglu, F., E. G. Yilmaz, H. S. Erol, et al. 2018. “Hepatoprotective Role of Thymol in Drug‐Induced Gastric Ulcer Model.” Annals of Hepatology 17, no. 6: 980–991. https://doi.org/10.5604/01.3001.0012.7198.

Grace, M. H., D. Esposito, K. L. Dunlap, and M. A. Lila. 2014. “Comparative Analysis of Phenolic Content and Profile, Antioxidant Capacity, and Anti‐Inflammatory Bioactivity in Wild Alaskan and Commercial Vaccinium Berries.” Journal of Agricultural and Food Chemistry 62, no. 18: 4007–4017. https://doi.org/10.1021/jf403810y.

Guo, H., B. Chen, Z. Yan, J. Gao, J. Tang, and C. Zhou. 2020. “Metabolites Profiling and Pharmacokinetics of Troxipide and Its Pharmacodynamics in Rats With Gastric Ulcer.” Scientific Reports 10, no. 1: 13619. https://doi.org/10.1038/s41598‐020‐70312‐7.

Halabi, M. F., R. M. Shakir, D. A. Bardi, et al. 2014. “Gastroprotective Activity of Ethyl‐4‐[(3,5‐Di‐Tert‐Butyl‐2‐Hydroxybenzylidene) Amino]Benzoate Against Ethanol‐Induced Gastric Mucosal Ulcer in Rats.” PLoS ONE 9, no. 5: e95908. https://doi.org/10.1371/journal.pone.0095908.

Ibrahim, I. A., M. A. Abdulla, M. Hajrezaie, et al. 2016. “The Gastroprotective Effects of Hydroalcoholic Extract of Monolluma quadrangula Against Ethanol‐Induced Gastric Mucosal Injuries in Sprague Dawley Rats.” Drug Design, Development and Therapy 10: 93–105.

Kalin, P., I. Gulcin, and A. C. Goren. 2015. “Antioxidant Activity and Polyphenol Content of Cranberries (Vaccinium macrocarpon).” Records of Natural Products 9, no. 4: 496–502.

Kim, T. H., E. J. Jeon, D. Y. Cheung, et al. 2013. “Gastroprotective Effects of Grape Seed Proanthocyanidin Extracts Against Nonsteroid Anti‐Inflammatory Drug‐Induced Gastric Injury in Rats.” Gut Liver 7, no. 3: 282–289. https://doi.org/10.5009/gnl.2013.7.3.282.

Koriem, K. M., I. B. Gad, and Z. K. Nasiry. 2015. “Protective Effect of Cupressus sempervirens Extract Against Indomethacin‐Induced Gastric Ulcer in Rats.” Interdisciplinary Toxicology 8, no. 1: 25–34. https://doi.org/10.1515/intox‐2015‐0006.

Kunnumakkara, A. B., B. L. Sailo, K. Banik, et al. 2018. “Chronic Diseases, Inflammation, and Spices: How Are They Linked?” Journal of Translational Medicine 16, no. 1: 14. https://doi.org/10.1186/s12967‐018‐1381‐2.

Li, C., J. Xu, Y. Deng, H. Sun, and Y. Li. 2019. “Selection of Reference Genes for Normalization of Cranberry (Vaccinium macrocarpon Ait.) Gene Expression Under Different Experimental Conditions.” PLoS ONE 14, no. 11: e0224798. https://doi.org/10.1371/journal.pone.0224798.

Liguori, I., G. Russo, F. Curcio, et al. 2018. “Oxidative Stress, Aging, and Diseases.” Clinical Interventions in Aging 13: 757–772. https://doi.org/10.2147/CIA.S158513.

Liu, J., F. Wang, H. Luo, et al. 2016. “Protective Effect of Butyrate Against Ethanol‐Induced Gastric Ulcers in Mice by Promoting the Anti‐Inflammatory, Anti‐Oxidant and Mucosal Defense Mechanisms.” International Immunopharmacology 30: 179–187. https://doi.org/10.1016/j.intimp.2015.11.018.

Liu, M., L. Q. Lin, B. B. Song, et al. 2009. “Cranberry Phytochemical Extract Inhibits SGC‐7901 Cell Growth and Human Tumor Xenografts in Balb/c Nu/Nu Mice.” Journal of Agricultural and Food Chemistry 57, no. 2: 762–768. https://doi.org/10.1021/jf802780k.

Mahboubi, M., N. Kazempour, and M. Taghizadeh. 2013. “In Vitro Antimicrobial and Antioxidant Activity of Vaccinium arctostaphylos L. Extracts.” Journal of Biologically Active Products from Nature 3, no. 4: 241–247.

McKay, D. L., and J. B. Blumberg. 2007. “Cranberries (Vaccinium macrocarpon) and Cardiovascular Disease Risk Factors.” Nutrition Reviews 65, no. 11: 490–502. https://doi.org/10.1301/nr.2007.nov.490‐502.

Moldovan, G. L., B. Pfander, and S. Jentsch. 2007. “PCNA, the Maestro of the Replication Fork.” Cell 129, no. 4: 665–679. https://doi.org/10.1016/j.cell.2007.05.003.

Neto, C. C., J. W. Amoroso, and A. M. Liberty. 2008. “Anticancer Activities of Cranberry Phytochemicals: An Update.” Molecular Nutrition & Food Research 52: S18–S27.

Okkay, U., I. Ferah Okkay, I. C. Aydin, et al. 2021. “Effects of Achillea millefolium on Cisplatin Induced Ocular Toxicity: An Experimental Study.” Cutaneous and Ocular Toxicology 40, no. 3: 214–220. https://doi.org/10.1080/15569527.2021.1919137.

Okkay, U., I. Ferah Okkay, B. Cicek, I. C. Aydin, and M. Ozkaraca. 2022. “Hepatoprotective and Neuroprotective Effect of Taxifolin on Hepatic Encephalopathy in Rats.” Metabolic Brain Disease 37, no. 5: 1541–1556. https://doi.org/10.1007/s11011‐022‐00952‐3.

Palikova, I., J. Vostalova, A. Zdarilova, et al. 2010. “Long‐Term Effects of Three Commercial Cranberry Products on the Antioxidative Status in Rats: A Pilot Study.” Journal of Agricultural and Food Chemistry 58, no. 3: 1672–1678. https://doi.org/10.1021/jf903710y.

Pastoris, O., M. Verri, F. Boschi, et al. 2008. “Effects of Esomeprazole on Glutathione Levels and Mitochondrial Oxidative Phosphorylation in the Gastric Mucosa of Rats Treated With Indomethacin.” Naunyn‐Schmiedeberg's Archives of Pharmacology 378, no. 4: 421–429. https://doi.org/10.1007/s00210‐008‐0314‐7.

Re, R., N. Pellegrini, A. Proteggente, A. Pannala, M. Yang, and C. Rice‐Evans. 1999. “Antioxidant Activity Applying an Improved ABTS Radical Cation Decolorization Assay.” Free Radical Biology and Medicine 26, no. 9–10: 1231–1237. https://doi.org/10.1016/S0891‐5849(98)00315‐3.

Roh, S. S., M. R. Shin, S. H. Shin, et al. 2017. “Low‐Molecular‐Weight Oligonol, a Polyphenol Derived From Lychee Fruit, Attenuates Experimental Reflux Esophagitis and HCl/Ethanol‐Induced Gastric Ulcer.” Journal of Medicinal Food 20, no. 12: 1214–1221. https://doi.org/10.1089/jmf.2017.3972.

Santana, D. G., A. S. Oliveira, M. T. D. Souza, et al. 2018. “Vaccinium macrocarpon Aiton Extract Ameliorates Inflammation and Hyperalgesia Through Oxidative Stress Inhibition in Experimental Acute Pancreatitis.” Evidence‐Based Complementary and Alternative Medicine 2018: 9646937. https://doi.org/10.1155/2018/9646937.

Shukla, D., R. A. Maheshwari, K. Patel, R. Balaraman, and A. K. Sen. 2018. “Effect of Vaccinium macrocarpon on MK‐801‐Induced Psychosis in Mice.” Indian Journal of Pharmacology 50, no. 5: 227–235. https://doi.org/10.4103/ijp.IJP_74_17.

Skrovankova, S., L. Misurcova, and L. Machu. 2012. “Antioxidant Activity and Protecting Health Effects of Common Medicinal Plants.” Advances in Food and Nutrition Research 67: 75–139. https://doi.org/10.1016/B978‐0‐12‐394598‐3.00003‐4.

Slinkard, K., and V. L. Singleton. 1977. “Total Phenol Analysis—Automation and Comparison With Manual Methods.” American Journal of Enology and Viticulture 28, no. 1: 49–55. https://doi.org/10.5344/ajev.1977.28.1.49.

Sostres, C., C. J. Gargallo, and A. Lanas. 2013. “Nonsteroidal Anti‐Inflammatory Drugs and Upper and Lower Gastrointestinal Mucosal Damage.” Arthritis Research & Therapy 15, no. 3: S3.

Souza, M., J. Mota, R. B. Oliveira, and F. Q. Cunha. 2008. “Gastric Damage Induced by Different Doses of Indomethacin in Rats is Variably Affected by Inhibiting iNOS or Leukocyte Infiltration.” Inflammation Research 57, no. 1: 28–33. https://doi.org/10.1007/s00011‐007‐7089‐z.

Sun, J., and R. Hai Liu. 2006. “Cranberry Phytochemical Extracts Induce Cell Cycle Arrest and Apoptosis in Human MCF‐7 Breast Cancer Cells.” Cancer Letters 241, no. 1: 124–134. https://doi.org/10.1016/j.canlet.2005.10.027.

Takeuchi, K. 2012. “Pathogenesis of NSAID‐Induced Gastric Damage: Importance of Cyclooxygenase Inhibition and Gastric Hypermotility.” World Journal of Gastroenterology 18, no. 18: 2147–2160. https://doi.org/10.3748/wjg.v18.i18.2147.

Tanaka, A., H. Araki, S. Hase, Y. Komoike, and K. Takeuchi. 2002. “Up‐Regulation of COX‐2 by Inhibition of COX‐1 in the Rat: A Key to NSAID‐Induced Gastric Injury.” Alimentary Pharmacology & Therapeutics 16: 90–101.

Tarnawski, A. S. 2005. “Cellular and Molecular Mechanisms of Gastrointestinal Ulcer Healing.” Digestive Diseases and Sciences 50: S24–S33. https://doi.org/10.1007/s10620‐005‐2803‐6.

Thimoteo, N. S. B., T. M. V. Iryioda, D. F. Alfieri, et al. 2019. “Cranberry Juice Decreases Disease Activity in Women With Rheumatoid Arthritis.” Nutrition (Burbank, Los Angeles County, Calif.) 60: 112–117. https://doi.org/10.1016/j.nut.2018.10.010.

Tipton, D. A., J. Christian, and A. Blumer. 2016. “Effects of Cranberry Components on IL‐1Beta‐Stimulated Production of IL‐6, IL‐8 and VEGF by Human TMJ Synovial Fibroblasts.” Archives of Oral Biology 68: 88–96. https://doi.org/10.1016/j.archoralbio.2016.04.005.

Tominaga, K., T. Arakawa, S. Kim, H. Iwao, and K. Kobayashi. 1997. “Increased Expression of Transforming Growth Factor‐Beta1 During Gastric Ulcer Healing in Rats.” Digestive Diseases and Sciences 42, no. 3: 616–625. https://doi.org/10.1023/A:1018867630686.

Vane, J. R., and R. M. Botting. 1998. “Mechanism of Action of Nonsteroidal Anti‐Inflammatory Drugs.” American Journal of Medicine 104, no. 3A: 2S–8S. discussion 21S–22S. https://doi.org/10.1016/S0002‐9343(97)00203‐9.

Vattem, D. A., R. Ghaedian, and K. Shetty. 2005. “Enhancing Health Benefits of Berries Through Phenolic Antioxidant Enrichment: Focus on Cranberry.” Asia Pacific Journal of Clinical Nutrition 14, no. 2: 120–130.

Wong, J. Y., M. A. Abdulla, J. Raman, et al. 2013. “Gastroprotective Effects of Lion's Mane Mushroom Hericium erinaceus (Bull.:Fr.) Pers. (Aphyllophoromycetideae) Extract Against Ethanol‐Induced Ulcer in Rats.” Evidence‐Based Complementary and Alternative Medicine 2013: 492976. https://doi.org/10.1155/2013/492976.

Yadav, S. K., B. Adhikary, S. Chand, B. Maity, S. K. Bandyopadhyay, and S. Chattopadhyay. 2012. “Molecular Mechanism of Indomethacin‐Induced Gastropathy.” Free Radical Biology and Medicine 52, no. 7: 1175–1187. https://doi.org/10.1016/j.freeradbiomed.2011.12.023.

Zeng, W., H. Li, Y. Chen, et al. 2016. “Survivin Activates NFKappaB p65 via the IKKBeta Promoter in Esophageal Squamous Cell Carcinoma.” Molecular Medicine Reports 13, no. 2: 1869–1880. https://doi.org/10.3892/mmr.2015.4737.

Zhao, F., L. Chen, C. Bi, M. Zhang, W. Jiao, and X. Yao. 2013. “In Vitro Anti‐Inflammatory Effect of Picrasmalignan a by the Inhibition of iNOS and COX2 Expression in LPS‐Activated Macrophage RAW 264.7 Cells.” Molecular Medicine Reports 8, no. 5: 1575–1579. https://doi.org/10.3892/mmr.2013.1663.