1. Introduction
Global demand for animal protein is expected to grow by 52% by 2050 [1]. Aquaculture is an industry where production can increase rapidly, and it can address nutritional deficiencies [2,3,4]. Aquaculture will therefore play an important role in the future of food. However, wild fish populations are struggling to keep up with demand; thus, aquaculture will need to expand further to meet human needs [5]. However, the rapid development of aquaculture through high-density farming may lead to the frequent occurrence of disease [6,7,8]. Antibiotics are widely used to combat such diseases, yet their increased use may lead to a number of long-term consequences, such as health problems in fish and environmental pollution [9,10,11]. Most countries have banned the use of antibiotics in aquaculture. Hence, there is an urgent need to develop eco-friendly and healthy functional additives that can serve as alternatives to antibiotics to allow for the healthy development of the aquaculture industry. Dietary supplement functional additives can enhance the production performance and health status of aquaculture species, in addition to improving feed absorption, reducing environmental pollution caused by aquaculture, and enhancing economic and environmental benefits [12].
Polysaccharides can be extracted from a variety of plants, animals, and microorganisms, and more than 300 polysaccharide compounds have been identified thus far [13]. Yeast polysaccharide (YPS) is the primary component of the yeast cell wall, accounting for approximately 75% of its dry weight [14]. YPS exhibits various biological functions, such as growth promotion [15], antioxidant effects [16], immune regulation [17], and antibacterial resistance [18]. Consequently, YPS has been used as a feed additive for aquatic animals. Dietary YPS supplementation can improve the immunity of sea cucumber (Stichopus japonicus) [19,20,21] and catfish (Pangasius pangasius) [22]. In addition, dietary YPS supplementation increases the blood monocytes and phagocytic activity of leukocytes and improves the intestinal morphology of channel catfish (Ictalurus punctatus) [17]. Moreover, it improves the growth performance, intestinal digestive enzyme and microbial activity, and gene expression of white shrimp (Litopenaeus vannamei) [15]. Furthermore, synergistic use of YPS and sunflower powder can eliminate soybean powder-induced enteritis and diarrhea in Atlantic salmon (Salmo salar) [23]. These reports suggest that dietary YPS supplementation has broad application prospects in aquaculture.
The largemouth bass (Micropterus salmoides), also known as the California bass, is a typical freshwater carnivorous fish that is native to the Mississippi River in California, USA [24]. M. salmoides is widely consumed, owing to its rapid growth rate, cold resistance, tender meat, delicious taste, and high nutritional value. Since its introduction in the 1980s, it has become an important freshwater breeding variety in China due to its high economic value. However, the increase in breeding density and the deterioration of the breeding environment in recent years have led to a decrease in the immunity of M. salmoides, causing recurrent disease outbreaks and subsequent economic losses. Considering the beneficial effects of polysaccharides, including their growth-promotive, immunoregulatory, antioxidant, and antimicrobial activities [25,26], a number of scholars have evaluated the role of immunomodulatory polysaccharides, such as laminarin [27], lentinan [28], Spirulina platensis polysaccharide [29], Atractylodes macrocephala polysaccharide [30], and Astragalus polysaccharide [31], in M. salmoides. However, there are no reports on the effects of dietary YPS supplementation on M. salmoides. Thus, in this study, we sought to investigate the effects of dietary YPS supplementation on the growth, whole-body composition, antioxidant capacity, and immunity of M. salmoides.
2. Materials and Methods
2.1. Experimental Diet
The approximate composition and formula of the five iso-nitrogen and iso-energy experimental diets are shown in Table 1. The five experimental diets, namely the control, 0.05Y, 0.10Y, 0.15Y, and 0.20Y, were formulated with 0.00%, 0.05%, 0.10%, 0.15%, and 0.20% YPS, respectively. YPS was purchased from Hubei Jingruitianheng Biotechnology Co., Ltd. (Yichang, China). The proximal composition of YPS is 7.00% nucleic acid, 2.50% nucleotide, and 13.00% mannan. To prepare the diets, all of the ingredients were ground, sieved through an 80-mesh sieve, combined as per the formula, and then mixed with water. Thereafter, a TSE65-type bulking granulator (Beijing, China) was used to produce 1.5 mm diameter granules for each of the five mixtures, which were then dried in a ventilated oven. Subsequently, the granules were mixed with oil. Lastly, the granules were stored in a self-sealing bag at −20 °C until further use. The feed composition analysis was conducted according to the AOAC method [32]. The gross energy of the feed was analyzed using an oxygen bomb calorimeter (Staufen, Germany).
2.2. M. Salmoides Culture Conditions
M. salmoides was cultured in the ponds at the Nanquan base of the Freshwater Fisheries Research Center (Wuxi, China). The size of the pond was 2000 m2 (width: 25 m; length: 80 m). The fish were fed a commercial diet (crude protein, 51%; crude lipid, 12%) for 2 weeks prior to the formal feeding experiment. After fasting all fish for 24 h, a total of 300 healthy fish (3.20 ± 0.03 g) were randomly assigned to 15 square floating cages (1 × 1 × 1 m), with 20 fish per floating cage and 3 floating cages per group. Twenty fish of similar size and robustness were selected and weighed as a whole. The distribution of the floating cages and the selection of the fish were randomized. The fish were hand-fed twice daily at 6:30 a.m. and 4:30 p.m. for a period of 56 days until visual satiation. During the experimental period, we sampled water around the floating cages and used a SunpuTest (Beijing Sunpu Biochem. Tech. Co., Ltd., Beijing, China) to test the quality of the water. The water temperature was 30 ± 2 °C, the concentration of dissolved oxygen was greater than 6 mg/L, the pH was 7.4 ± 0.4, the nitrite content was less than 0.1 mg/L, and the ammonia nitrogen concentration was less than 0.1 mg/L.
2.3. Sample Collection
After the feeding experiment, samples were collected after 24 h of fasting, and the weight and quantity of fish in each floating cage were recorded. Each floating cage contained five fish chosen at random, among which two were used for whole-body composition analysis and the remaining three earmarked for biochemical and gene expression analyses. Fish were anesthetized using MS-222 (100 mg/L), and their blood was then drawn and immediately centrifuged (3000 rpm, 10 min, 4 °C) to obtain the upper plasma samples. The liver tissue of three fish was then dissected and immediately preserved in liquid nitrogen for gene expression analysis.
2.4. Laboratory Trial Analysis
The whole-body composition analysis was conducted according to the AOAC method [32].
Plasma biochemical indices were measured using a Mindray BS-400 automatic biochemical analyzer from Shenzhen Mindray Bio-Medical Electronics Co., Ltd. (Shenzhen, China), with all necessary kits provided by the same company.
The levels of antioxidant indices in plasma were measured using corresponding kits provided by Jian Cheng Bioengineering Institute (Nanjing, China).
Total RNA was extracted from the liver tissues using the FreeZol Reagent kit from Vazyme Biotech Co., Ltd. (Nanjing, China), and the RNA quality was assessed using a NanoDrop 2000 spectrophotometer (Shanghai, China). The real-time polymerase chain reaction (RT-PCR) assay was performed using a one-step kit provided by Vazyme Biotech Co., Ltd. (Nanjing, China) on a CFX96 Real-Time PCR Detection System from Bio-Rad Laboratories (Hercules, America). Relative mRNA expression was determined according to the Pfaffl mathematical model [33]. Beta-actin (β-actin) was used as the reference gene. The primers used for the RT-PCR assay were synthesized based on the methods described in previous studies [34,35,36] and are shown in Table 2.
2.5. Statistical Analysis
Data analysis was performed via variance (ANOVA) using IBM SPSS Statistics 20 software. Graphing used the OriginPro 9.0 software. The results are presented as mean ± SEM, with statistical significance defined as p < 0.05 by Duncan’s test.
3. Results
3.1. Growth Performance
The results of the growth performance analysis of the five groups are shown in Table 3. The study found no significant differences in weight gain rate (WGR), initial body weight (IBW), specific growth rate (SGR), final body weight (FBW), and survival rate (SR) among the groups (p > 0.05). However, the 0.10Y and 0.20Y groups showed a significantly elevated feed conversion ratio (FCR) (p < 0.05).
3.2. Whole-Body Composition
The results of the whole-body composition analysis of the five groups are shown in Table 4. The 0.10Y group had the highest moisture content and the lowest ash content (p > 0.05). Meanwhile, the control group had the lowest crude protein and crude lipid content (p > 0.05). The whole-body composition of M. salmoides was not significantly different among the five groups (p > 0.05).
3.3. Plasma Biochemical Indices
The results of the biochemical analysis are shown in Table 5. The content of alkaline phosphatase (ALP) in plasma was the highest in the 0.10Y group (p < 0.05) and showed an initial increasing and subsequent decreasing trend. The content of glucose (GLU) in plasma was higher in both the 0.15Y and 0.20Y groups (p < 0.05), with a positive association with the YPS concentration. However, the total cholesterol (TC), aspartate transaminase (AST), triglyceride (TG), and alanine aminotransferase (ALT) levels were not significantly affected by dietary YPS supplementation (p > 0.05).
3.4. Plasma Antioxidant Indices
The results of the antioxidant indices analysis of the five groups are shown in Figure 1. Superoxide dismutase (SOD) activity and glutathione (GSH) content were the highest in the 0.10Y group (p < 0.05) and showed an initial increasing and subsequent decreasing trend. The total antioxidant capacity (T-AOC) was the highest in the 0.05Y group (p > 0.05). The plasma malondialdehyde (MDA) content was significantly lower in the 0.15Y and 0.20Y groups (p < 0.05), with a negative association with dietary YPS concentration. However, dietary YPS supplementation did not have any significant effect on catalase (CAT) and glutathione peroxidase (GSH-Px) activities (p > 0.05).
3.5. Hepatic Antioxidant Gene Expression
Figure 2 illustrates the hepatic antioxidant genes’ relative expression. Notably, the 0.05Y and 0.10Y groups exhibited a significant increase in cat mRNA expression (p < 0.05). Additionally, the sod mRNA expression was the highest in the 0.05Y and 0.10Y groups (p > 0.05). However, none of the other three genes was significantly affected by dietary YPS supplementation (p > 0.05).
3.6. Hepatic Immune-Related Gene Expression
Figure 3 illustrates the hepatic immune-related genes’ relative expression. nf-κb mRNA expression was the highest in the 0.05Y group (p < 0.05), and the trend of rela mRNA expression was similar to it (p > 0.05). The il-10 and il-8 mRNA expressions were the highest in the 0.05Y and 0.20Y groups (p < 0.05). However, the tlr2 mRNA expression was not significantly affected by dietary YPS supplementation (p > 0.05).
4. Discussion
Although several studies have demonstrated the positive effects of dietary YPS supplementation in aquatic animals [15,17,19,20,21,22,23], the effects of different concentrations of YPS on different fish species vary, and studies on the effects of dietary YPS supplementation on M. salmoides are lacking. In this study, the whole-body composition of M. salmoides in all five groups was not significantly affected by dietary YPS supplementation. This finding is consistent with the results of the effect of dietary selenium polysaccharide on the whole-body composition of juvenile black sea bream (Acanthopagrus schlegelii) [37]. Dietary YPS supplementation had no positive effect on its growth. In addition, the 0.10Y and 0.20Y groups had significantly higher FCRs. Similarly, there was no significant effect of yeast cultures on the growth performance of gibel carp (Carassius auratus gibelio CAS III) and β-glucan on the growth performance of rainbow trout (Oncorhynchus mykiss), in agreement with our findings. [38,39]. YPS is widely recognized for its high nutritional value and growth-promotive effects in aquatic animals [15,40]. In contrast, the authors of some studies have found that the less digestible components of yeasts may act as anti-trophic factors, resulting in reduced digestive capacity and absorption of nutrients and thereby resulting in decreased growth performance [41,42]. Moreover, growth performance can be influenced by various factors, including the species and size of the fish, environment, and feeding volume.
Plasma biochemical indices reflect the physiological, pathological, and toxicological status of fish [43,44]. In this study, there were no significant differences in plasma ALT and AST levels among the five groups. ALT and AST activities are recognized as key non-specific immune markers in fish [45,46], and elevated activities are associated with abnormal liver function [47,48,49]. Therefore, our results indicate that YPS supplementation maintained hepatic homeostasis and had no negative effects on the liver function of M. salmoides. ALP is abundant in the intestines, bones, and liver and plays an essential role in the digestion and absorption of nutrients, such as glucose and lipids [50]. In addition, ALP is also an indicator of liver health and immune status in fish [51]. The 0.10Y group exhibited significantly higher plasma ALP levels than the control group, indicating that 0.10% YPS supplementation increased the immune, digestive, and absorption capacity of M. salmoides. This finding is consistent with previous results on the addition of ginger (Zingiber officinale) polysaccharides to promote ALP elevation in crucian carp (Carassius auratus) [52].
The results of some studies have shown that YPS has glucose-lowering and blood lipid-lowering properties [53,54,55]. However, its lipid-lowering activity has not been fully established in fish [36,56]. In the present study, GLU levels increased with YPS concentration. This change may be attributed to saccharide intolerance observed in fish [57,58]. For instance, high administration of saccharides can lead to pronounced and persistent hyperglycemic responses in numerous fish [59,60]. In particular, carnivorous fish are thought to have a poor ability to use saccharides, and their blood sugar drops very slowly [61,62]. In addition, there was no significant difference in TG between the groups in the present study. Our results are consistent with the results of the effect of Poria cocos polysaccharides on the TG of the spotted sea bass (Lateolabrax maculatus) [63].
Oxidative stress refers to an imbalance in free radical and antioxidant levels in the body and may cause various diseases [64,65,66]. Antioxidant enzymes play a crucial role in protecting against oxidative stress in fish [67,68]. In the present study, the 0.10Y group exhibited the highest levels of both SOD activity and GSH content; in comparison, the 0.05Y group showed the highest T-AOC. SOD and GSH are important antioxidant indices, and their activities are closely correlated [69]. T-AOC is another common antioxidant index, which reflects the oxidative stress status of the body [70]. Therefore, our results indicate that YPS supplementation improves the antioxidant capacity of M. salmoides by regulating its antioxidant indices. In this study, MDA content decreased with the increase in YPS. Since MDA reflects the degree of lipid peroxidation [71], our results indicate that YPS supplementation decreased lipid peroxidation in M. salmoides. The results of numerous have shown that polysaccharides can directly scavenge reactive oxygen species and improve antioxidant enzyme activity [72,73,74]. For example, Astragalus polysaccharide [75] and fucoidan [76] can significantly increase CAT and SOD activities and reduce MDA content in fish, consistent with the results of our study. The antioxidant genes, cat and sod, which are downstream of the Nrf2 signaling pathway, showed the highest expression in the 0.05Y and 0.10Y groups, indicating that their expression was negatively correlated with YPS concentration. The Nrf2 signaling pathway activates the transcription of downstream antioxidant genes, thereby serving as an essential component of the antioxidant defense mechanism in fish [77,78]. Our results showed that YPS supplementation enhanced the antioxidant status of M. salmoides by up-regulating the expression of antioxidant enzymes. The results of a previous study showed that YPS has a similar effect on the antioxidant genes in broilers [79]. Similarly, chitosan was found to improve the antioxidant capacity of golden pompano (Trachinotus ovatus) by up-regulating the expression of its antioxidant genes [80]. These reports are consistent with our findings on the plasma antioxidant indices of M. salmoides. Altogether, our results indicate that YPS supplementation, especially at lower concentrations (0.05% and 0.10%), enhanced antioxidant enzyme activity and antioxidant gene expression in M. salmoides. In contrast, while high YPS concentrations (0.15% and 0.20%) significantly reduced the MDA content, they also decreased the concentration of other antioxidant indices to varying degrees. High levels of YPS are difficult to metabolize and can lead to the production of harmful hydroxyl radicals, which adversely affect the antioxidant mechanisms of fish [40]. Our findings were similar to those of the related studies by Yousefi [81]. In other studies, it has also been found that dietary YPS supplementation must be at an appropriate level; in the study by Zhu, the maximum recommended addition of YPS to I. punctatus was 0.3% [17].
The cytokine-mediated response is essential for liver immunity in aquatic animals, and the NF-κB/RelA signaling pathway is crucial for regulating the immune response [82,83]. In this study, the 0.05Y group exhibited significant up-regulation of the nf-κb gene but not the rela gene; however, their gene expression trends were notably similar. Therefore, our study revealed that the 0.05Y group exhibited a robust inflammatory response and a pronounced immune reaction. These results are consistent with a previous report on the effects of A. macrocephala polysaccharide and Astragalus polysaccharide on the liver immunity of M. salmoides [31] and turbot (Scophthalmus maximus L.) [84], respectively. il-8 and il-10 are important pro-inflammatory and anti-inflammatory cytokines, respectively [85,86]. In our study, the expression of il-8 and il-10 genes was elevated in the 0.05Y and 0.20Y groups. The authors of previous studies found that il-8 plays a crucial role in the host defense system by promoting immune cell (neutrophils, lymphocytes, monocytes, and macrophages) migration to the inflammatory site and their adherence to various endothelial cells [87,88]. Another possible reason for this finding was the fact that il-8 participated in angiogenesis and therefore led to an increase in gene expression [89], rather than as a pro-inflammatory cytokine. Furthermore, the authors of a previous study found that il-10 inhibits an over-activated immune response [90]. It can adjust the intensity of immune and inflammatory responses according to pathological states [91,92]. It can be inferred that YPS induces the expression of both pro-inflammatory and anti-inflammatory factors, thereby modulating the intensity of the immune response. The authors of some studies have found that both Cordyceps militaris polysaccharide and sulfated polysaccharide elevate both pro-inflammatory and anti-inflammatory factors, and such findings are similar to our findings [93,94]. Altogether, our results indicate that 0.05% YPS supplementation can enhance the immunity of M. salmoides.
5. Conclusions
In the present study, the addition of YPS had no positive effect on growth performance, and high levels of YPS (0.10% and 0.20%) may adversely affect FCR. The addition of low concentrations of YPS (0.05–0.10%) improved antioxidant and immune capacity of M. salmoides, whereas high concentrations of YPS (0.15–0.20%) in turn resulted in a significant reduction in MDA content. Based on our results, YPS is a beneficial feed additive and provides a referable nutritional pathway to improve M. salmoides’s growth performance, antioxidant capacity, and immune capacity.
Conceptualization, T.T. and H.Y.; methodology, H.M.; formal analysis, J.Q. and D.H.; investigation, M.R. and T.T.; data curation, M.R., H.M. and D.H.; writing—original draft preparation, J.Q.; writing—review and editing, H.L. and L.Z. All authors have read and agreed to the published version of the manuscript.
The study was conducted according to Management Rule of Laboratory Animals (Chinese Order No. 676 of the State Council, revised 1 March 2017). The study was approved by the Laboratory Animal Ethics Committee of the Freshwater Fisheries Research Center (LAECFFRC-2023-03-26).
Not applicable.
Data are contained within the article.
Author Lu Zhang, Haifeng Mi, Tao Teng, and Heng Yin are employed by Tongwei Agricultural Development Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest. Lu Zhang, Haifeng Mi, Tao Teng, and Heng Yin made important contributions to experimental techniques.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
![View Image - Figure 1. Plasma antioxidant indices (n = 9). Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.](https://media.proquest.com/media/hms/THUM/2/1N2Mb?_a=ChgyMDI1MDYwNzEwMjM0MjA3OTo0OTg3NzYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuOTkqBzIwNTU0MTMyCjMxNTk0MTIyNzk6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNS8wMS8wMXIKMjAyNS8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNjA3MTAyMzQyMDc5OjY3NjA5NA%3D%3D&_s=nQ3LTvomzUa7eHtE6xra2TSQYjs%3D "View Image - Figure 1. Plasma antioxidant indices (n = 9). Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.")
Enlarge this image.Figure 1. Plasma antioxidant indices (n = 9). Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.
![View Image - Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.](https://media.proquest.com/media/hms/THUM/4/1N2Mb?_a=ChgyMDI1MDYwNzEwMjM0MjA3OTo0OTg3NzYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuOTkqBzIwNTU0MTMyCjMxNTk0MTIyNzk6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNS8wMS8wMXIKMjAyNS8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNjA3MTAyMzQyMDc5OjY3NjA5NA%3D%3D&_s=GnRuFR8DWJ2EGi91ElsklQcZ%2Biw%3D "View Image - Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.")
Enlarge this image.Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.
![View Image - Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.](https://media.proquest.com/media/hms/THUM/6/1N2Mb?_a=ChgyMDI1MDYwNzEwMjM0MjA3OTo0OTg3NzYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuOTkqBzIwNTU0MTMyCjMxNTk0MTIyNzk6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNS8wMS8wMXIKMjAyNS8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNjA3MTAyMzQyMDc5OjY3NjA5NA%3D%3D&_s=BgNlSw7uYDdRRVETrtFSmUaJ%2B30%3D "View Image - Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.")
Enlarge this image.Figure 2. Hepatic antioxidant genes’ expression (n = 9): (A) keap1, (B) nrf2, (C) cat, (D) gpx, and (E) sod. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.
![View Image - Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.](https://media.proquest.com/media/hms/THUM/8/1N2Mb?_a=ChgyMDI1MDYwNzEwMjM0MjA3OTo0OTg3NzYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuOTkqBzIwNTU0MTMyCjMxNTk0MTIyNzk6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNS8wMS8wMXIKMjAyNS8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNjA3MTAyMzQyMDc5OjY3NjA5NA%3D%3D&_s=PB92anRONh3jKX0qbBfqZOhlZQI%3D "View Image - Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.")
Enlarge this image.Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.
![View Image - Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.](https://media.proquest.com/media/hms/THUM/10/1N2Mb?_a=ChgyMDI1MDYwNzEwMjM0MjA3OTo0OTg3NzYSBzEzODMzMjMaCk9ORV9TRUFSQ0giDTIxNi43My4yMTYuOTkqBzIwNTU0MTMyCjMxNTk0MTIyNzk6C0lubGluZUltYWdlQgEwUgZPbmxpbmVaA0lMSWIEVEhVTWoKMjAyNS8wMS8wMXIKMjAyNS8xMi8zMXoAggEgUC0xMDAwMDg0LTIwMTM5NS1TVEFGRi1udWxsLW51bGySAQZPbmxpbmXKAWdNb3ppbGxhLzUuMCBBcHBsZVdlYktpdC81MzcuMzYgKEtIVE1MLCBsaWtlIEdlY2tvOyBjb21wYXRpYmxlOyBDbGF1ZGVCb3QvMS4wOyArY2xhdWRlYm90QGFudGhyb3BpYy5jb20p0gESU2Nob2xhcmx5IEpvdXJuYWxzmgIHUHJlUGFpZKoCG09TOkVNUy1GdWxsVGV4dC1nZXRGdWxsVGV4dMoCD0FydGljbGV8RmVhdHVyZeICAU7yAgD6AgFZggMDV2ViigMcQ0lEOjIwMjUwNjA3MTAyMzQyMDc5OjY3NjA5NA%3D%3D&_s=OzeNUxpX6N1eD8kG83gCD%2Bbl2r0%3D "View Image - Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.")
Enlarge this image.Figure 3. Hepatic immune-related genes’ expression (n = 9): (A) tlr2, (B) nf-κb, (C) rela, (D) il-8, and (E) il-10. Different lowercase letters on the bar graph indicate significant differences (p [less than] 0.05); no labeling indicates no significant difference.
Experimental basic formula (% dry matter).
| Ingredients | Level (%) | Ingredients | Level (%) |
|---|---|---|---|
| Fish meal a | 30.00 | Fish oil | 6.66 |
| Chicken meal a | 5.00 | Cassava starch | 5.00 |
| Soy protein concentrate a | 8.00 | Choline chloride | 0.50 |
| Soybean meal a | 11.00 | Vitamin premix b | 1.00 |
| Rapeseed meal a | 7.20 | Mineral premix b | 1.00 |
| Blood meal a | 5.00 | Monocalcium phosphate | 3.46 |
| Wheat meal | 5.00 | Vitamin C | 0.05 |
| Corn gluten meal a | 7.70 | L-lysine c | 0.28 |
| Wheat gluten a | 3.00 | L-methionine c | 0.15 |
| Analyzed proximate composition (dry matter) | |||
| Crude protein (%) | 50.25 ± 0.15 | ||
| Crude lipid (%) | 11.25 ± 0.14 | ||
| Ash (%) | 10.05 ± 0.01 | ||
| Gross energy (KJ/g) | 20.45 ± 0.04 | ||
a The crude protein contents of fish meal, chicken meal, soy protein concentrate, soybean meal, rapeseed meal, blood meal, corn gluten meal, and gluten were 65.80%, 62.00%, 63.00%, 46.00%, 39.00%, 90.00%, 60.57%, and 80.00%; and the crude lipid contents were 9.50%, 9.00%, 4.10%, 4.25%, 6.00%, 0.00%, 3.30%, and 2.00% respectively. Biomar Tongwei Biotech Co., Ltd. (Wuxi, China) provided them. b Vitamin premix (IU or mg/kg of premix): The contents of vitamin A, vitamin D3, vitamin E, vitamin K3, thiamin, riboflavin, calcium pantothenate, pyridoxine HCl, cyanocobalamin, biotin, folic acid, niacin, inositol, and vitamin C were 800,000 IU, 150,000–250,000 IU, 4500 IU, 600 mg, 800 mg, 800 mg, 2000 mg, 2500 mg, 8 mg, 16 mg, 400 mg, 2800 mg, 10,000 mg, and 10,000 mg. Mineral premix (g/kg of premix): The contents of calcium biphosphate, sodium chloride, potassium chloride, magnesium sulphate, ferrous sulphate, zinc sulphate, cupric sulphate, manganese sulphate, sodium selenate, cobalt chloride, and potassium iodide were 20 g, 2.6 g, 5 g, 2 g, 0.9 g, 0.06 g, 0.02, 0.03 g, 0.02 g, 0.05 g, and 0.004 g; zeolite was used as a carrier. Hanove Animal Health Products Co., Ltd. (Wuxi, China) provided vitamin premix and mineral premix. c Feeer Co., Ltd. (Shanghai, China) provided L-lysine and L-methionine.
Real-time PCR primer sequences.
| Genes | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Source |
|---|---|---|---|
| V-rel reticuloendotheliosis viral oncogene homolog A | GCTGGTGTCTGGTTCATT | GCCTCCTCTTCCATCTCT | [ |
| Nuclear factor-kappa B | CCACTCAGGTGTTGGAGCTT | TCCAGAGCACGACACACTTC | [ |
| Glutathione peroxidase | GAAGGTGGATGTGAATGGA | CCAACCAGGAACTTCTCAA | |
| Kelch-like ECH-associated protein 1 (keap1) | CCGTTGGAGGCTATGATG | GCACTGGTAGACTGAGAC | |
| Interleukin-8 (il-8) | TCGGTCCTCCTGGGTGAAAA | GTGCTCCTTCCTGCTGATGTA | |
| Interleukin-10 (il-10) | CGGCACAGAAATCCCAGAGC | CAGCAGGCTCACAAAATAAACATCT | [ |
| Beta-actin (β-actin) | CCACCTTCAACAGCATCA | AGCCTCCAATCCATACAGA | |
| Catalase (cat) | CTATGGCTCTCACACCTTC | TCCTCTACTGGCAGATTCT | |
| Superoxide dismutase (sod) | TGGCAAGAACAAGAACCACA | CCTCTGATTTCTCCTGTCACC | |
| Toll-like receptor-2 (tlr2) | TCGCTGTTCACCAATCTG | TAGTTCTCCTCTCCATCTGT | |
| Nuclear factor erythroid 2-related factor 2 (nrf2) | AGAGACATTCGCCGTAGA | TCGCAGTAGAGCAATCCT |
Growth performance of M. salmoides.
| Control | 0.05Y | 0.10Y | 0.15Y | 0.20Y | |
|---|---|---|---|---|---|
| IBW (g) | 3.23 ± 0.02 | 3.21 ± 0.01 | 3.21 ± 0.02 | 3.20 ± 0.01 | 3.23 ± 0.01 |
| FBW (g) | 26.65 ± 0.35 | 26.01 ± 1.29 | 23.86 ± 0.44 | 24.97 ± 0.40 | 25.70 ± 2.34 |
| WGR (%) | 725.04 ± 5.73 | 709.99 ± 39.95 | 643.61 ± 14.67 | 679.54 ± 13.40 | 696.66 ± 72.91 |
| SGR (%/d) | 3.70 ± 0.01 | 3.67 ± 0.09 | 3.52 ± 0.03 | 3.60 ± 0.03 | 3.63 ± 0.16 |
| SR (%) | 91.67 ± 8.33 | 95.00 ± 5.00 | 91.67 ± 1.67 | 88.33 ± 1.67 | 80.00 ± 2.89 |
| FCR | 1.02 ± 0.01 b | 1.19 ± 0.10 ab | 1.27 ± 0.05 a | 1.19 ± 0.04 ab | 1.29 ± 0.06 a |
Data were expressed as mean ± SEM (n = 3). Values labeled with different superscript lowercase letters represent significant differences (p < 0.05). WGR (%) = 100 × (W2 (g) − W1 (g))/W1 (g). SR (%) = 100 × (N1/N2). SGR (%/d) = 100 × [(Ln (W2 (g)) − Ln (W1 (g)))/days]. FCR = W3 (g)/(W4 + W5) (g). W1 is initial body average weight, W2 is final body average weight, W3 is dry feed fed, W4 is wet weight gain, W5 is weight of dead fish, N1 is survival fish number, and N2 is total fish number.
Whole-body composition of M. salmoides fed with different diets.
| Moisture (%) | Crude Protein (%) | Crude Lipid (%) | Ash (%) | |
|---|---|---|---|---|
| Control | 72.63 ± 0.18 | 16.45 ± 0.06 | 6.02 ± 0.47 | 3.74 ± 0.22 |
| 0.05Y | 72.47 ± 0.09 | 16.51 ± 0.16 | 6.98 ± 0.03 | 3.95 ± 0.12 |
| 0.10Y | 72.98 ± 0.16 | 16.60 ± 0.05 | 6.33 ± 0.53 | 3.63 ± 0.15 |
| 0.15Y | 72.53 ± 0.13 | 16.56 ± 0.15 | 6.41 ± 0.14 | 4.00 ± 0.10 |
| 0.20Y | 72.58 ± 0.23 | 16.67 ± 0.27 | 6.38 ± 0.09 | 3.83 ± 0.14 |
Data were expressed as means with SEM (n = 3). Moisture (%) = 100 × (W6 (g) − W7 (g))/W6 (g). Crude protein (%) = 100 × (V1 (ml) − V2 (ml)) × C × 0.014 × 6.25/W7 (g). Crude lipid (%) = 100 × (W8 (g) − W9 (g))/W7 (g). Ash (%) = 100 × W10 (g)/W7 (g). W6 is wet weight of fish, W7 is dry weight of fish, V1 is volume of standard titration solution of hydrochloric acid required to titrate the sample, V2 is volume of standard titration solution of hydrochloric acid required for blank titration, C is concentration of standard titration solution of hydrochloric acid, W8 is weight of dry sample before extraction, W9 is weight of dry sample after extraction, and W10 is dry sample ash weight.
Blood biochemical indicators of M. salmoides fed with different diets.
| Control | 0.05Y | 0.10Y | 0.15Y | 0.20Y | |
|---|---|---|---|---|---|
| ALT (U/L) | 5.11 ± 0.90 | 2.68 ± 0.44 | 5.04 ± 0.89 | 4.24 ± 0.90 | 5.14 ± 0.87 |
| AST (U/L) | 13.47 ± 2.11 | 12.67 ± 2.05 | 10.93 ± 3.06 | 14.40 ± 2.18 | 13.43 ± 0.83 |
| ALP (U/L) | 18.33 ± 1.63 b | 22.23 ± 2.26 ab | 22.80 ± 2.31 a | 22.58 ± 2.20 ab | 20.65 ± 1.93 ab |
| GLU (mmol/L) | 5.88 ± 0.49 c | 5.71 ± 0.91 c | 6.64 ± 0.44 bc | 7.26 ± 0.32 ab | 8.05 ± 0.27 a |
| TC (mmol/L) | 6.82 ± 0.39 | 7.86 ± 0.33 | 7.32 ± 0.47 | 7.62 ± 0.32 | 7.58 ± 0.31 |
| TG (mmol/L) | 12.69 ± 0.53 | 13.02 ± 0.79 | 13.43 ± 0.46 | 13.14 ± 0.85 | 12.89 ± 0.54 |
Data were expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
References
1. Alagawany, M.; Taha, A.E.; Noreldin, A.; El-Tarabily, K.A.; El-Hack, M.E.A. Nutritional applications of species of Spirulina and Chlorella in farmed fish: A review. Aquaculture; 2021; 542, 736841. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2021.736841]
2. Garlock, T.; Asche, F.; Anderson, J.; Bjorndal, T.; Kumar, G.; Lorenzen, K.; Ropicki, A.; Smith, M.D.; Tyeteras, R. A Global Blue Revolution: Aquaculture Growth Across Regions, Species, and Countries. Rev. Fish. Sci. Aquac.; 2020; 28, pp. 107-116. [DOI: https://dx.doi.org/10.1080/23308249.2019.1678111]
3. Garlock, T.; Asche, F.; Anderson, J.; Ceballos-Concha, A.; Love, D.C.; Osmundsen, T.C.; Pincinato, R.B.M. Aquaculture: The missing contributor in the food security agenda. Glob. Food Secur. Agric. Policy Econ. Environ.; 2022; 32, 100620. [DOI: https://dx.doi.org/10.1016/j.gfs.2022.100620]
4. Golden, C.D.; Koehn, J.Z.; Shepon, A.; Passarelli, S.; Free, C.M.; Viana, D.F.; Matthey, H.; Eurich, J.G.; Gephart, J.A.; Fluet-Chouinard, E. et al. Aquatic foods to nourish nations. Nature; 2021; 598, pp. 315-320. [DOI: https://dx.doi.org/10.1038/s41586-021-03917-1] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34526720]
5. Ministry of Agriculture of the People’s Republic of China. Chinese Fishery Statistical Yearbook 2022; Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2022.
6. Cretu, M.; Dediu, L.; Cristea, V.; Zugravu, A.; Rahoveanu, M.M.T.; Bandi, A.-C.; Rahoveanu, A.T.; Mocuta, D.N. Environmental Impact of Aquaculture: A Literature Review. Proceedings of the 27th International Business Information Management Association Conference; Milan, Italy, 4–5 May 2016.
7. Ahmed, N.; Thompson, S. The blue dimensions of aquaculture: A global synthesis. Sci. Total Environ.; 2019; 652, pp. 851-861. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2018.10.163]
8. Julia, P. Aquaculture and the Environment: The Risks and Rewards. J. Agric. Food Inf.; 2003; 5, pp. 43-50.
9. Shao, Y.T.; Wang, Y.P.; Yuan, Y.W.; Xie, Y.J. A Systematic Review on Antibiotics Misuse in Livestock and Aquaculture and Regulation Implications in China. Sci. Total Environ.; 2021; 798, 149205. [DOI: https://dx.doi.org/10.1016/j.scitotenv.2021.149205]
10. Chen, J.; Sun, R.; Pan, C.; Sun, Y.; Mai, B.; Li, Q.X. Antibiotics and Food Safety in Aquaculture. J. Agric. Food Chem.; 2020; 68, pp. 11908-11919. [DOI: https://dx.doi.org/10.1021/acs.jafc.0c03996]
11. Limbu, S.M.; Chen, L.Q.; Zhang, M.L.; Du, Z.Y. A global analysis on the systemic effects of antibiotics in cultured fish and their potential human health risk: A review. Rev. Aquac.; 2021; 13, pp. 1015-1059. [DOI: https://dx.doi.org/10.1111/raq.12511]
12. Dawood, M.A.O.; Koshio, S.; Angeles Esteban, M. Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Rev. Aquac.; 2018; 10, pp. 950-974. [DOI: https://dx.doi.org/10.1111/raq.12209]
13. Yin, M.; Zhang, Y.; Li, H. Advances in Research on Immunoregulation of Macrophages by Plant Polysaccharides. Front. Immunol.; 2019; 10, 00145. [DOI: https://dx.doi.org/10.3389/fimmu.2019.00145] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30804942]
14. Zhao, W.; Liang, M.; Wei, J.; Wang, S. Effects of Dietary Yeast Polysaccharides on the Immune Responses of Apostichopus japonicus to a Sudden Drop in Temperature. J. World Aquac. Soc.; 2017; 48, pp. 656-665. [DOI: https://dx.doi.org/10.1111/jwas.12363]
15. Zheng, Y.D.; Hou, C.H.; Yan, Z.; Chen, J.; Wang, H.M.; Tan, B.P.; Zhang, S. Effects of Dietary Zymosan-A on the Growth Performance and Intestinal Morphology, Digestive Capacity, and Microbial Community in Litopenaeus vannamei. Front. Mar. Sci.; 2022; 9, 877865. [DOI: https://dx.doi.org/10.3389/fmars.2022.877865]
16. Li, H.X.; Wu, M.J.; Li, Z.H.; Zhang, Q.; Zhang, X.H.; Zhang, Y.Y.; Zhao, D.; Wang, L.; Hou, Y.Q.; Wu, T. Effect of supplementation with yeast polysaccharides on intestinal function in piglets infected with porcine epidemic diarrhea virus. Front. Microbiol.; 2024; 15, 1378070. [DOI: https://dx.doi.org/10.3389/fmicb.2024.1378070]
17. Zhu, H.L.; Liu, H.Y.; Yan, J.; Wang, R.; Liu, L.H. Effect of yeast polysaccharide on some hematologic parameter and gut morphology in channel catfish (Ictalurus punctatus). Fish Physiol. Biochem.; 2012; 38, pp. 1441-1447. [DOI: https://dx.doi.org/10.1007/s10695-012-9631-3]
18. Trevisi, P.; Priori, D.; Gandolfi, G.; Colombo, M.; Coloretti, F.; Goossens, T.; Bosi, P. In vitro test on the ability of a yeast cell wall based product to inhibit the Escherichia coli F4ac adhesion on the brush border of porcine intestinal villi. J. Anim. Sci.; 2012; 90, pp. 275-277. [DOI: https://dx.doi.org/10.2527/jas.53771]
19. Yang, G.; Tian, X.L.; Dong, S.L.; Peng, M.; Wang, D.D.; Zhang, K. Effects of dietary rhubarb, Bacillus cereus, yeast polysaccharide, and florfenicol supplementation on growth, intestinal morphology, and immune responses of sea cucumber (Apostichopus japonicus). Aquac. Int.; 2016; 24, pp. 675-690. [DOI: https://dx.doi.org/10.1007/s10499-015-9957-9]
20. Zhao, W.; Liang, M.; Zhang, P. Effect of yeast polysaccharide on the immune function of juvenile sea cucumber, Apostichopus japonicus Selenka under pH stress. Aquac. Int.; 2010; 18, pp. 777-786. [DOI: https://dx.doi.org/10.1007/s10499-009-9300-4]
21. Zhao, W.; Liang, M.; Liu, Q.; Yin, X.W.; Wei, J. The effect of yeast polysaccharide (YSP) on the immune function of Apostichopus japonicus Selenka under salinity stress. Aquac. Int.; 2014; 22, pp. 1753-1766. [DOI: https://dx.doi.org/10.1007/s10499-014-9780-8]
22. Hayati, R.L.; Prihanto, A.A. Effects of polysaccharides-crude extract from Candida sp. OCL1 on hematological parameters of Aeromonas hydrophila-infected catfish (Pangasius pangasius). Proceedings of the 1st International Conference on Sustainable Aquatic Resources (ICoSAR)—Increasing Ocean Health Index (OHI) Through Sustainable Aquatic-Food Resources Utilization; Malang, Indonesia, 27–28 August 2019.
23. Refstie, S.; Baeverfjord, G.; Seim, R.R.; Elvebo, O. Effects of dietary yeast cell wall β-glucans and MOS on performance, gut health, and salmon lice resistance in Atlantic salmon (Salmo salar) fed sunflower and soybean meal. Aquaculture; 2010; 305, pp. 109-116. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2010.04.005]
24. Wang, P.; Yan, X.F.; Zhang, X.T.; Zhu, Z.L.; Xu, Q.L.; Hou, J.J.; Chen, J.; Gisbert, E.; Zhou, J.S. Increasing levels of fishmeal replacement by defatted black soldier fly larvae meal reduced growth performance without affecting fillet quality in largemouth bass (Micropterus salmoides). Fish Physiol. Biochem.; 2024; 50, pp. 2255-2274. [DOI: https://dx.doi.org/10.1007/s10695-024-01390-x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/39083156]
25. Tan, X.H.; Sun, Z.Z.; Liu, Q.Y.; Ye, H.Q.; Zou, C.Y.; Ye, C.X.; Wang, A.L.; Lin, H.Z. Effects of dietary ginkgo biloba leaf extract on growth performance, plasma biochemical parameters, fish composition, immune responses, liver histology, and immune and apoptosis-related genes expression of hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀) fed high lipid diets. Fish Shellfish. Immunol.; 2018; 72, pp. 399-409. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29032040]
26. Wei, G.B.; Tan, H.M.; Ma, S.H.; Sun, G.R.; Zhang, Y.L.; Wu, Y.Z.; Cai, S.H.; Huang, Y.C.; Jian, J.C. Protective effects of β-glucan as adjuvant combined inactivated Vibrio harveyi vaccine in pearl gentian grouper. Fish Shellfish. Immunol.; 2020; 106, pp. 1025-1030. [DOI: https://dx.doi.org/10.1016/j.fsi.2020.09.027] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32971269]
27. Wu, Y.J.; Cheng, Y.; Qian, S.C.; Zhang, W.; Huang, M.M.; Yang, S.; Fei, H. An Evaluation of Laminarin Additive in the Diets of Juvenile Largemouth Bass (Micropterus salmoides): Growth, Antioxidant Capacity, Immune Response and Intestinal Microbiota. Animals; 2023; 13, 459. [DOI: https://dx.doi.org/10.3390/ani13030459]
28. Wang, Y.Z.; Liu, W.S.; Li, X.Y.; Xin, Y.X.; Tang, Y.Q.; Xiao, H.H.; Guo, X.Z.; Li, S.M. Effects of dietary lentinan on growth performance, nonspecific immunity and disease resistance to Aeromonas hydrophila in largemouth bass (Micropterus salmoides). Aquac. Rep.; 2023; 32, 101696. [DOI: https://dx.doi.org/10.1016/j.aqrep.2023.101696]
29. Zhang, W.Q.; Deng, Y.Y.; Yang, Z.X.; Kong, Q.; Liu, P.Q.; Liao, H.P.; Tang, H.J. Effects of partial replacement of fishmeal with Spirulina platensis powder and addition of Spirulina platensis polysaccharide on growth, nutrition, antioxidant capacity and gut microbiota of Micropterus salmoides. Aquaculture; 2024; 586, 740802. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2024.740802]
30. Dong, B.; Wu, L.Y.; Chen, Q.Z.; Xu, W.J.; Li, D.G.; Han, D.; Zhu, X.M.; Liu, H.K.; Yang, Y.X.; Xie, S.Q. et al. Tolerance Assessment of Atractylodes macrocephala Polysaccharide in the Diet of Largemouth Bass (Micropterus salmoides). Antioxidants; 2022; 11, 1581. [DOI: https://dx.doi.org/10.3390/antiox11081581]
31. Zhao, F.X.; Huo, X.C.; Wang, P.X.; Liu, Q.; Yang, C.R.; Su, J.G. The Combination of β-Glucan and Astragalus Polysaccharide Effectively Resists Nocardia seriolae Infection in Largemouth Bass (Micropterus salmoides). Microorganisms; 2023; 11, 2529. [DOI: https://dx.doi.org/10.3390/microorganisms11102529]
32. Association of Official Analytical Chemists. Official Methods of Analysis of the Association of Official Analytical Chemists; 16th ed. Association of Official Analytical Chemists Inc.: Arlington, VA, USA, 1995.
33. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res.; 2001; 29, pp. 2002-2007. [DOI: https://dx.doi.org/10.1093/nar/29.9.e45]
34. Yang, P.; Wang, W.Q.; Chi, S.Y.; Mai, K.S.; Song, F.; Wang, L. Effects of dietary lysine on regulating GH-IGF system, intermediate metabolism and immune response in largemouth bass (Micropterus salmoides). Aquac. Rep.; 2020; 17, 100323. [DOI: https://dx.doi.org/10.1016/j.aqrep.2020.100323]
35. Yu, Y.Y.; Huang, D.Y.; Zhang, L.; Chen, X.R.; Wang, Y.L.; Zhang, L.; Ren, M.C.; Liang, H.L. Dietary arginine levels affect growth performance, intestinal antioxidant capacity and immune responses in largemouth bass (Micropterus salmoides). Aquac. Rep.; 2023; 32, 101703. [DOI: https://dx.doi.org/10.1016/j.aqrep.2023.101703]
36. Gu, J.Z.; Liang, H.L.; Ge, X.P.; Xia, D.; Pan, L.K.; Mi, H.F.; Ren, M.C. A study of the potential effect of yellow mealworm (Tenebrio molitor) substitution for fish meal on growth, immune and antioxidant capacity in juvenile largemouth bass (Micropterus salmoides). Fish Shellfish Immunol.; 2022; 120, pp. 214-221. [DOI: https://dx.doi.org/10.1016/j.fsi.2021.11.024] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34843945]
37. Wang, L.; Xiao, J.X.; Hua, Y.; Xiang, X.W.; Zhou, Y.F.; Ye, L.; Shao, Q.J. Effects of dietary selenium polysaccharide on growth performance, oxidative stress and tissue selenium accumulation of juvenile black sea bream, Acanthopagrus schlegelii. Aquaculture; 2019; 503, pp. 389-395. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2019.01.033]
38. Sealey, W.M.; Barrows, F.T.; Hang, A.; Johansen, K.A.; Overturf, K.; LaPatra, S.E.; Hardy, R.W. Evaluation of the ability of barley genotypes containing different amounts of β-glucan to alter growth and disease resistance of rainbow trout Oncorhynchus mykiss. Anim. Feed Sci. Technol.; 2008; 141, pp. 115-128. [DOI: https://dx.doi.org/10.1016/j.anifeedsci.2007.05.022]
39. Zhang, P.Y.; Cao, S.P.; Zou, T.; Han, D.; Liu, H.K.; Jin, J.Y.; Yang, Y.X.; Zhu, X.M.; Xie, S.Q.; Zhou, W.H. Effects of dietary yeast culture on growth performance, immune response and disease resistance of gibel carp (Carassius auratus gibelio CAS III). Fish Shellfish Immunol.; 2018; 82, pp. 400-407. [DOI: https://dx.doi.org/10.1016/j.fsi.2018.08.044]
40. Hou, X.Y.; Sun, L.J.; Li, Z.Q.; Deng, X.Y.; Guan, H.K.; Luo, C.Z.; Shi, Y.; Zhou, W.H.; Liang, T.Y.; Yang, Y.H. et al. An Evaluation of Yeast Culture Supplementation in the Diet of Pseudobagrus ussuriensis: Growth, Antioxidant Activity, Nonspecific Immunity, and Disease Resistance to Aeromonas hydrophila. Aquac. Nutr.; 2022; 2022, 9739586. [DOI: https://dx.doi.org/10.1155/2022/9739586]
41. Neuls, L.; de Souza, V.J.; Romao, S.; Bitencourt, T.B.; Raupp Ramos, C.J.; Garcia Parra, J.E.; Cazarolli, L.H. Immunomodulatory effects of Yarrowia lipolytica as a food additive in the diet of Nile tilapia. Fish Shellfish Immunol.; 2021; 119, pp. 272-279. [DOI: https://dx.doi.org/10.1016/j.fsi.2021.10.011]
42. Ozorio, R.O.A.; Portz, L.; Borghesi, R.; Cyrino, J.E.P. Effects of Dietary Yeast (Saccharomyces cerevisia) Supplementation in Practical Diets of Tilapia (Oreochromis niloticus). Animals; 2012; 2, pp. 16-24. [DOI: https://dx.doi.org/10.3390/ani2010016]
43. Chen, F.Y.; Li, X.X.; Wu, Y.J.; Huang, D.; Guo, Y.L.; Zhang, Y.J.; Zhang, W.B.; Mai, K.S. Influences of dietary antimicrobial peptide APSH-07 on the growth performance, immune response and vibriosis resistance of abalone Haliotis discus hannai Ino. Aquac. Nutr.; 2020; 26, pp. 1736-1747. [DOI: https://dx.doi.org/10.1111/anu.13124]
44. Yu, W.; Yang, Y.K.; Zhou, Q.C.; Huang, X.L.; Huang, Z.; Li, T.; Wu, Q.E.; Zhou, C.P.; Ma, Z.H.; Lin, H.Z. Effects of dietary Astragalus polysaccharides on growth, health and resistance to Vibrio harveyi of Lates calcarifer. Int. J. Biol. Macromol.; 2022; 207, pp. 850-858. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2022.03.176]
45. Sheikh, Z.A.; Ahmed, I. Impact of environmental changes on plasma biochemistry and hematological parameters of Himalayan snow trout, Schizothorax plagiostomus. Comp. Clin. Pathol.; 2019; 28, pp. 793-804. [DOI: https://dx.doi.org/10.1007/s00580-019-02914-1]
46. Huang, D.Y.; Zhu, J.; Zhang, L.; Ge, X.P.; Ren, M.C.; Liang, H.L. Dietary Supplementation with Eucommia ulmoides Leaf Extract Improved the Intestinal Antioxidant Capacity, Immune Response, and Disease Resistance against Streptococcus agalactiae in Genetically Improved Farmed Tilapia (GIFT.; Oreochromis niloticus). Antioxidants; 2022; 11, 1800. [DOI: https://dx.doi.org/10.3390/antiox11091800] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36139874]
47. Anoopraj, R.; Hemalatha, S.; Balachandran, C. A preliminary study on serum liver function indices of Diethylnitrosamine induced hepatocarcinogenesis and chemoprotective potential of Eclipta alba in male Wistar rats. Vet. World; 2014; 7, pp. 439-442. [DOI: https://dx.doi.org/10.14202/vetworld.2014.439-442]
48. Yu, W.; Lin, H.Z.; Yang, Y.K.; Zhou, Q.C.; Chen, H.M.; Huang, X.L.; Zhou, C.P.; Huang, Z.; Li, T. Effects of supplemental dietary Haematococcus pluvialis on growth performance, antioxidant capacity, immune responses and resistance to Vibrio harveyi challenge of spotted sea bass Lateolabrax maculatus. Aquac. Nutr.; 2021; 27, pp. 355-365. [DOI: https://dx.doi.org/10.1111/anu.13189]
49. Onyenibe, N.S.; Fowokemi, K.T.; Emmanuel, O.B. African Nutmeg (Monodora Myristica) Lowers Cholesterol and Modulates Lipid Peroxidation in Experimentally Induced Hypercholesterolemic Male Wistar Rats. Int. J. Biomed. Sci. IJBS; 2015; 11, pp. 86-92. [DOI: https://dx.doi.org/10.59566/IJBS.2015.11086]
50. Tengjaroenkul, B.; Smith, B.J.; Caceci, T.; Smith, S.A. Distribution of intestinal enzyme activities along the intestinal tract of cultured Nile tilapia, Oreochromis niloticus L. Aquaculture; 2000; 182, pp. 317-327. [DOI: https://dx.doi.org/10.1016/S0044-8486(99)00270-7]
51. Xu, S.D.; Zheng, X.; Wang, S.Q.; Chu, W.; Ai, Q.H.; Mai, K.S. Effects of dietary tributyrin supplementation on the growth performance, serum biochemistry, antioxidant capability and intestinal morphology and structure of golden pompano (Trachinotus ovatus). Aquac. Res.; 2022; 53, pp. 5463-5474. [DOI: https://dx.doi.org/10.1111/are.16028]
52. Luo, L.; Meng, X.W.; Wang, S.H.; Zhang, R.; Guo, K.; Zhao, Z.G. Effects of dietary ginger (Zingiber officinale) polysaccharide on the growth, antioxidant, immunity response, intestinal microbiota, and disease resistance to Aeromonas hydrophila in crucian carp (Carassius auratus). Int. J. Biol. Macromol.; 2024; 275, 133711. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2024.133711]
53. Shituleni, S.A.; Gan, F.; Nido, S.A.; Mengistu, B.M.; Khan, A.Z.; Liu, Y.; Huang, K. Effects of yeast polysaccharide on biochemical indices, antioxidant status, histopathological lesions and genetic expressions related with lipid metabolism in mice fed with high fat diet. Bioact. Carbohydr. Diet. Fibre; 2016; 8, pp. 51-57. [DOI: https://dx.doi.org/10.1016/j.bcdf.2016.10.001]
54. Cao, Y.; Zou, S.; Xu, H.; Li, M.; Tong, Z.; Xu, M.; Xu, X. Front cover: Hypoglycemic activity of the Baker’s yeast β-glucan in obese/type 2 diabetic mice and the underlying mechanism. Mol. Nutr. Food Res.; 2016; 60, pp. 2678-2690. [DOI: https://dx.doi.org/10.1002/mnfr.201600032]
55. Cao, Y.; Sun, Y.; Zou, S.W.; Li, M.X.; Xu, X.J. Orally Administered Baker’s Yeast β-Glucan Promotes Glucose and Lipid Homeostasis in the Livers of Obesity and Diabetes Model Mice. J. Agric. Food Chem.; 2017; 65, pp. 9665-9674. [DOI: https://dx.doi.org/10.1021/acs.jafc.7b03782] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29035040]
56. Guerreiro, I.; Oliva-Teles, A.; Enes, P. Prebiotics as functional ingredients: Focus on Mediterranean fish aquaculture. Rev. Aquac.; 2018; 10, pp. 800-832. [DOI: https://dx.doi.org/10.1111/raq.12201]
57. Hemre, G.I.; Mommsen, T.P.; Krogdahl, Å. Carbohydrates in fish nutrition: Effects on growth, glucose metabolism and hepatic enzymes. Aquac. Nutr.; 2002; 8, pp. 175-194. [DOI: https://dx.doi.org/10.1046/j.1365-2095.2002.00200.x]
58. Stone, D.A.J.; Allan, G.L.; Anderson, A.J. Carbohydrate utilization by juvenile silver perch, Bidyanus bidyanus (Mitchell).: III.: The protein-sparing effect of wheat starch-based carbohydrates. Aquac. Res.; 2003; 34, pp. 123-134. [DOI: https://dx.doi.org/10.1046/j.1365-2109.2003.00774.x]
59. Enes, P.; Panserat, S.; Kaushik, S.; Oliva-Teles, A. Nutritional regulation of hepatic glucose metabolism in fish. Fish Physiol. Biochem.; 2009; 35, pp. 519-539. [DOI: https://dx.doi.org/10.1007/s10695-008-9259-5]
60. Moon, T.W. Glucose intolerance in teleost fish: Face or fiction?. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol.; 2001; 129, pp. 243-249. [DOI: https://dx.doi.org/10.1016/S1096-4959(01)00316-5]
61. Booth, M.A.; Moses, M.D.; Allan, G.L. Utilisation of carbohydrate by yellowtail kingfish Seriola lalandi. Aquaculture; 2013; 376, pp. 151-161. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2012.11.024]
62. Zhang, Y.M.; Xie, S.W.; Guo, T.Y.; Liu, Z.L.; Fang, H.H.; Zheng, L.; Xie, J.J.; Tian, L.X.; Liu, Y.J.; Jin, N. High dietary starch inclusion impairs growth and antioxidant status, and alters liver organization and intestinal microbiota in largemouth bass Micropterus salmoides. Aquac. Nutr.; 2020; 26, pp. 1806-1821. [DOI: https://dx.doi.org/10.1111/anu.13131]
63. Lu, J.; Huang, Z.F.; Ye, Y.L.; Xu, A.L.; Li, Z.B. Effects of Poria cocos polysaccharide on growth performance, physiological parameters, and lipid metabolism of spotted sea bass Lateolabrax maculatus. J. Oceanol. Limnol.; 2024; 42, pp. 316-331. [DOI: https://dx.doi.org/10.1007/s00343-023-2342-z]
64. Chen, Y.; Zeng, L.; Lu, Y.; Yang, Y.L.; Xu, M.Y.; Wang, Y.X.; Liu, J.G. Treatment effect of a flavonoid prescription on duck virus hepatitis by its hepatoprotective and antioxidative ability. Pharm. Biol.; 2017; 55, pp. 198-205. [DOI: https://dx.doi.org/10.1080/13880209.2016.1255977]
65. Ding, C.; Shi, X.; Guan, Y.L.; Li, X.J. Deoxynivalenol induces carp neutrophil apoptosis and necroptosis via CYP450s/ROS/PI3K/AKT pathway. Aquaculture; 2021; 545, 737182. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2021.737182]
66. Zhao, X.; Shi, X.; Liu, Q.Q.; Li, X.J. Tea polyphenols alleviates acetochlor-induced apoptosis and necroptosis via ROS/MAPK/NF-κB signaling in Ctenopharyngodon idellus kidney cells. Aquat. Toxicol.; 2022; 246, 106153. [DOI: https://dx.doi.org/10.1016/j.aquatox.2022.106153] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35381412]
67. Jiang, W.D.; Wen, H.L.; Liu, Y.; Jiang, J.; Wu, P.; Zhao, J.; Kuang, S.Y.; Tang, L.; Tang, W.N.; Zhang, Y.A. et al. Enhanced muscle nutrient content and flesh quality, resulting from tryptophan, is associated with anti-oxidative damage referred to the Nrf2 and TOR signalling factors in young grass carp (Ctenopharyngodon idella): Avoid tryptophan deficiency or excess. Food Chem.; 2016; 199, pp. 210-219. [DOI: https://dx.doi.org/10.1016/j.foodchem.2015.12.003] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26775963]
68. Fontagne-Dicharry, S.; Lataillade, E.; Surget, A.; Larroquet, L.; Cluzeaud, M.; Kaushik, S. Antioxidant defense system is altered by dietary oxidized lipid in first-feeding rainbow trout (Oncorhynchus mykiss). Aquaculture; 2014; 424, pp. 220-227. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2014.01.009]
69. Li, M.; Chen, L.Q.; Qin, J.G.; Li, E.; Yu, N.; Du, Z.Y. Growth performance, antioxidant status and immune response in darkbarbel catfish Pelteobagrus vachelli fed different PUFA/vitamin E dietary levels and exposed to high or low ammonia. Aquaculture; 2013; 406, pp. 18-27. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2013.04.028]
70. Jiang, X.D.; Zu, L.; Wang, Z.Y.; Cheng, Y.X.; Yang, Y.H.; Wu, X.G. Micro-algal astaxanthin could improve the antioxidant capability, immunity and ammonia resistance of juvenile Chinese mitten crab, Eriocheir sinensis. Fish Shellfish Immunol.; 2020; 102, pp. 499-510. [DOI: https://dx.doi.org/10.1016/j.fsi.2020.05.021]
71. Liang, H.L.; Ji, K.; Ge, X.P.; Ren, M.C.; Liu, B.; Xi, B.W.; Pan, L.K. Effects of dietary arginine on antioxidant status and immunity involved in AMPK-NO signaling pathway in juvenile blunt snout bream. Fish Shellfish Immunol.; 2018; 78, pp. 69-78. [DOI: https://dx.doi.org/10.1016/j.fsi.2018.04.028]
72. Zhang, T.J.; Huang, D.J.; Liu, X.Y.; Chen, F.B.; Liu, Y.Y.; Jiang, Y.; Li, D.P. Antioxidant activity and semi-solid emulsification of a polysaccharide from coffee cherry peel. Int. J. Biol. Macromol.; 2023; 244, 125207. [DOI: https://dx.doi.org/10.1016/j.ijbiomac.2023.125207]
73. Kishk, Y.F.M.; Al-Sayed, H.M.A. Free-radical scavenging and antioxidative activities of some polysaccharides in emulsions. LWT-Food Sci. Technol.; 2007; 40, pp. 270-277. [DOI: https://dx.doi.org/10.1016/j.lwt.2005.11.004]
74. Huang, Z.F.; Ye, Y.L.; Xu, A.L.; Li, Z.B. Effects of dietary crude polysaccharides from Lycium barbarum on growth performance, digestion, and serum physiology and biochemistry of spotted sea bass Lateolabrax maculatus. Aquac. Rep.; 2023; 32, 101710. [DOI: https://dx.doi.org/10.1016/j.aqrep.2023.101710]
75. Xiang, X.; Zhou, X.H.; Chen, J.; Wang, W.J.; Li, D.J. Effect of Astragalus Polysaccharides on Growth, Nutrient Composition of Body and Immunological indices in Schizothorax prenanti. Proceedings of the 14th International Symposium on Fish Nutrition & Feeding; Qingdao, China, 31 May–4 June 2010; 428.
76. Yang, Q.; Yang, R.; Li, M.; Zhou, Q.C.; Liang, X.P.; Elmada, Z.C. Effects of dietary fucoidan on the blood constituents, anti-oxidation and innate immunity of juvenile yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol.; 2014; 41, pp. 264-270. [DOI: https://dx.doi.org/10.1016/j.fsi.2014.09.003] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25234038]
77. Ma, Q. Role of Nrf2 in Oxidative Stress and Toxicity. Annu. Rev. Pharmacol. Toxicol.; 2013; 53, pp. 401-426. [DOI: https://dx.doi.org/10.1146/annurev-pharmtox-011112-140320] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23294312]
78. Xie, J.; Niu, J. Evaluation of four macro-algae on growth performance, anti-oxidant capacity and non-specific immunity in golden pompano (Trachinotus ovatus). Aquaculture; 2022; 548, 737690. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2021.737690]
79. Zhang, J.; Fang, Y.; Fu, Y.T.; Jalukar, S.; Ma, J.L.; Liu, Y.R.; Guo, Y.P.; Ma, Q.G.; Ji, C.; Zhao, L.H. Yeast polysaccharide mitigated oxidative injury in broilers induced by mixed mycotoxins via regulating intestinal mucosal oxidative stress and hepatic metabolic enzymes. Poult. Sci.; 2023; 102, 102862. [DOI: https://dx.doi.org/10.1016/j.psj.2023.102862]
80. Yu, W.; Yang, Y.K.; Chen, H.M.; Zhou, Q.C.; Zhang, Y.W.; Huang, X.L.; Huang, Z.; Li, T.; Zhou, C.P.; Ma, Z.H. et al. Effects of dietary chitosan on the growth, health status and disease resistance of golden pompano (Trachinotus ovatus). Carbohydr. Polym.; 2023; 300, 120237. [DOI: https://dx.doi.org/10.1016/j.carbpol.2022.120237]
81. Yousefi, S.; Shokri, M.M.; Noveirian, H.A.; Hoseinifar, S.H. Effects of dietary yeast cell wall on biochemical indices, serum and skin mucus immune responses, oxidative status and resistance against Aeromonas hydrophila in juvenile Persian sturgeon (Acipenser persicus). Fish Shellfish Immunol.; 2020; 106, pp. 464-472. [DOI: https://dx.doi.org/10.1016/j.fsi.2020.08.007]
82. Yao, C.L.; Kong, P.; Huang, X.N.; Wang, Z.Y. Molecular cloning and expression of IRF1 in large yellow croaker, Pseudosciaena crocea. Fish Shellfish Immunol.; 2010; 28, pp. 654-660. [DOI: https://dx.doi.org/10.1016/j.fsi.2009.12.026]
83. Xun, P.W.; Zhou, C.P.; Huang, X.L.; Huang, Z.; Yu, W.; Yang, Y.K.; Li, T.; Huang, J.B.; Wu, Y.; Lin, H.Z. Effects of Dietary Sodium Acetate on Growth Performance, Fillet Quality, Plasma Biochemistry, and Immune Function of Juvenile Golden Pompano (Trachinotus ovatus). Aquac. Nutr.; 2022; 2022, 9074549. [DOI: https://dx.doi.org/10.1155/2022/9074549]
84. Sun, Y.K.; Wang, X.; Zhou, H.H.; Mai, K.S.; He, G. Dietary Astragalus polysaccharides ameliorates the growth performance, antioxidant capacity and immune responses in turbot (Scophthalmus maximus L.). Fish Shellfish Immunol.; 2020; 99, pp. 603-608. [DOI: https://dx.doi.org/10.1016/j.fsi.2020.02.056]
85. Zhao, W.; Fang, H.H.; Gao, B.Y.; Dai, C.M.; Liu, Z.Z.; Zhang, C.W.; Niu, J. Dietary Tribonema sp. supplementation increased growth performance, antioxidant capacity, immunity and improved hepatic health in golden pompano (Trachinotus ovatus). Aquaculture; 2020; 529, 735667. [DOI: https://dx.doi.org/10.1016/j.aquaculture.2020.735667]
86. Guo, X.; Chen, D.D.; Peng, K.S.; Cui, Z.W.; Zhang, X.J.; Li, S.; Zhang, Y.A. Identification and characterization of Bacillus subtilis from grass carp (Ctenopharynodon idellus) for use as probiotic additives in aquatic feed. Fish Shellfish Immunol.; 2016; 52, pp. 74-84. [DOI: https://dx.doi.org/10.1016/j.fsi.2016.03.017] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/26988285]
87. Hoffmann, E.; Dittrich-Breiholz, O.; Holtmann, H.; Kracht, M. Multiple control of interleukin-8 gene expression. J. Leukoc. Biol.; 2002; 72, pp. 847-855. [DOI: https://dx.doi.org/10.1189/jlb.72.5.847]
88. Resseguier, J.; Dalum, A.S.; Du Pasquier, L.; Zhang, Y.; Koppang, E.O.; Boudinot, P.; Wiegertjes, G.F. Lymphoid Tissue in Teleost Gills: Variations on a Theme. Biology; 2020; 9, 9060127. [DOI: https://dx.doi.org/10.3390/biology9060127]
89. Niu, X.L.; Chen, Y.M.; Qi, L.; Liang, G.Q.; Wang, Y.; Zhang, L.P.; Qu, Y.; Wang, W.L. Hypoxia regulates angeogenic-osteogenic coupling process via up-regulating IL-6 and IL-8 in human osteoblastic cells through hypoxia-inducible factor 1α pathway. Cytokine; 2019; 113, pp. 117-127. [DOI: https://dx.doi.org/10.1016/j.cyto.2018.06.022]
90. Liang, H.L.; Mokrani, A.; Ji, K.; Ge, X.P.; Ren, M.C.; Pan, L.K.; Sun, A.J. Effects of dietary arginine on intestinal antioxidant status and immunity involved in Nrf2 and NF-κB signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol.; 2018; 82, pp. 243-249. [DOI: https://dx.doi.org/10.1016/j.fsi.2018.08.026]
91. Moore, K.W.; de Waal Malefyt, R.; Coffman, R.L.; O’Garra, A. Interleukin-10 and the Interleukin-10 Receptor. Annu. Rev. Immunol.; 2001; 19, pp. 683-765. [DOI: https://dx.doi.org/10.1146/annurev.immunol.19.1.683]
92. Kotenko, S.V. The family of IL-10-related cytokines and their receptors: Related, but to what extent?. Cytokine Growth Factor Rev.; 2002; 13, pp. 223-240. [DOI: https://dx.doi.org/10.1016/S1359-6101(02)00012-6]
93. Liu, Y.; Yang, J.Y.; Guo, Z.J.; Li, Q.Z.; Zhang, L.D.; Zhao, L.X.; Zhou, X.W. Immunomodulatory Effect of Cordyceps militaris Polysaccharide on RAW 264.7 Macrophages by Regulating MAPK Signaling Pathways. Molecules; 2024; 29, 3408. [DOI: https://dx.doi.org/10.3390/molecules29143408]
94. Liu, Q.M.; Xu, S.S.; Li, L.; Pan, T.M.; Shi, C.L.; Liu, H.; Cao, M.J.; Su, W.J.; Liu, G.M. In vitro and in vivo immunomodulatory activity of sulfated polysaccharide from Porphyra haitanensis. Carbohydr. Polym.; 2017; 165, pp. 189-196. [DOI: https://dx.doi.org/10.1016/j.carbpol.2017.02.032]
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Details
; Liang, Hualiang 3
; Zhang, Lu 2 ; Teng, Tao 2 ; Yin, Heng 2 1 Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China;
2 Tongwei Agricultural Development Co. Ltd., Key Laboratory of Nutrition and Healthy Culture of Aquatic, Livestock and Poultry, Ministry of Agriculture and Rural Affairs, Healthy Aquaculture Key Laboratory of Sichuan Province, Chengdu 610093, China;
3 Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China;
4 Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China;