1. Introduction
Human cytomegalovirus (CMV), called HCMV, is an important human herpesvirus that causes common congenital infections in neonates [1,2] and severe complications in immunocompromised patients such as HIV-positive individuals [3,4]. HCMV affects 1 in 200 of all live-born infants in high-income countries and 1 in 71 in low- and middle-income countries [5,6]. The development of effective vaccines against human CMV infection and disease is a high priority and significant efforts on this front are needed [7]. There is currently no FDA-approved anti-HCMV vaccine available.
HCMV is species-specific in its host range and only replicates and propagates in human cells but not in non-human cells [3]. The infections of animals by related cytomegaloviruses, such as the infection of mice by murine cytomegalovirus (MCMV) and the infection of non-human primates by rhesus CMV, serve as excellent models for studies of the immunology and pathogenesis of HCMV infection and for anti-CMV vaccine development [8]. Vaccines being explored against CMV include conventional inactivated whole-viral antigen vaccines, recombinant protein vaccines, virus-like particle (VLP) vaccines, DNA vaccines, and vaccines based on live attenuated virus vectors [7]. Using the MCMV infection of mice as the model, some constructed vaccines, when expressing different viral antigens, have elicited strong and effective immune responses against MCMV infection in mice [9,10,11,12,13]. The continued development of a novel and effective anti-CMV vaccine is crucial for the control and prevention of HCMV infection and its associated diseases.
Oral vaccines represent an excellent choice for mass vaccination because they eliminate the requirement for the use of needles and syringes. Vaccine vectors based on attenuated Salmonella strains have been used to deliver nucleic acid-based vaccines orally [14,15,16]. Constructed Salmonella mutants carry plasmid constructs containing transgenes and release the plasmid DNA in infected cells, leading to transgene expression [17,18]. Further studies have shown that the intracellular survival and replication of Salmonella requires the expression of the components of the type III secretion system (T3SS) of Salmonella pathogenicity island 2 (SPI-2) [19,20]. The inactivation of these genes increases bacterial lysis and improves gene transfer [17,21].
Here, we report the construction of a new attenuated Salmonella strain, SL416, with a deletion in the ssrA/B gene, which plays a key role in regulating the expression of many SPI-2 genes [22]. We generated a functional SL416-based vaccine, v-M78, that expressed the MCMV M78 protein. M78 and its HCMV counterpart, UL78, encode G protein-coupled receptor (GCR) homologs that are found in both virions and infected cells [23]. Previous studies have suggested the role of M78 in viral gene expression and pathogenesis. M78 functions to facilitate viral IE mRNA expression and down-regulates MHC II expression, while viral mutants inactivating M78 are attenuated in viral production in macrophages and defective in MCMV colonization in the salivary gland in mice [24,25]. Because they are virion proteins, M78 and UL78 are considered potential vaccine candidates against CMV infection. However, it has not been reported whether M78 or UL78 can serve as an antigen for vaccine development.
In this study, we show that the generated Salmonella-based vaccine, v-M78, which contained an M78 expression construct, carried out gene transfer efficiently for M78 expression and demonstrated little ability to kill mice in vivo. In orally vaccinated mice, v-M78 induced anti-MCMV serum IgG and mucosal IgA responses and elicited anti-MCMV T cell responses. Furthermore, the mice immunized with v-M78 were protected from intraperitoneal and intranasal challenges with MCMV. Our study demonstrates the potential of using Salmonella-based oral vaccines against CMV infection.
2. Materials and Methods
2.1. Virus Strains, Antibodies, and Expression Constructs
Mouse NIH 3T3 cells and J774 macrophages and the wildtype MCMV Smith strain were obtained from the American Type Culture Collection (Manassas, VA, USA) [26,27]. The cells were maintained in Dulbecco’s modified Eagle medium (DMEM) (Thermo Fisher, Waltham, MA, USA) supplemented with 10% NuSerum (Becton Dickinson, San Jose, CA, USA). The Smith strain and mutant m-M78 were propagated in NIH 3T3 cells [26,27]. Mutant m-M78, which contained a deletion of the M78 open reading frame (coordinates of 110989–112401) [28], was constructed using the BAC-mid method as previously described [24,25,29,30]. The M78 deletion in m-M78 was confirmed through Southern blot and sequencing analyses. The polyclonal rabbit anti-M78 antibody was generated using M78 peptides (Promab, Inc., Richmond, CA, USA) and the anti-actin antibody was from Sigma (St. Louis, MO, USA) [25,31]. To generate the expression construct peM78, the M78 encoding sequence was amplified from purified MCMV (Smith) viral DNA through PCR using the primers 5M78 (5′-GGGAATTCCATATGAAGATCTCTCCGACTTCATCGTGCGCCGT-3′) and 3M78 (5′-CCGGAATTCGGTACCTCAGACAACAGAGGAGGAGGTA-3′). The PCR product was digested with restriction enzymes and cloned into the eukaryotic expression vector peVAX, which was derived from the construct pVAX1 (Invitrogen, Carlsbad, CA, USA) with additional cloning sites, to generate the expression construct peM78.
2.2. Salmonella Strains
Using the λ red recombinase-based approach [32], we constructed strain SL416 from Salmonella typhimurium aroA strain SL7207 (a gift from Bruce A. D. Stocker, Stanford University, Stanford, CA, USA) by removing a part of the SsrA/B coding sequence [33]. Using pKan-clone7 as the template, PCR was performed with the primers ssrAB5 (5′-TGTACTGCGATAGTGATCAAGTGCCAAAGATTTTGCAACAGGCAACTGGAGGGAAGCATTCATATGAATATCCTCCTTAGTTC-3′) and ssrAB3 (5′-CTGCGTGGCGTAAGGCTCATCAAAATATGACCAATGCTTAATACCATCGGACGCCCCTGGTGTGTAGGCTGGAGCTGCT T-3′). We transformed the PCR products into SL7207 and constructed the ssrA/B deletion mutant using the λ red recombinase method [32] as described previously [34,35]. We selected the nonpolar strain SL416 based on its sensitivity to kanamycin and sequencing analysis. We performed the growth of the Salmonella typhimurium clinical strain ST14028s and other Salmonella strains in LB following published procedures [34,35].
2.3. M78 Expression Through Salmonella-Mediated Delivery in Cultured Cells
The Salmonella-based vaccines v-M78 and v-C were produced by transforming SL416 with peM78 and the empty vector peVAX, respectively. We cultured J774 cells (1 × 106 cells) in the presence of IFN-γ (150 U/mL) (R&D Systems Inc., Minneapolis, MN, USA) and then infected them with Salmonella and harvested the infected cells at 72 h postinfection. We conducted Northern and Western blot analyses as described previously [17,34]. The protein samples were separated on SDS-containing gels and reacted with anti-M78 and anti-actin antibodies and imaged with a STORM840 Phosphorimager [17,34].
2.4. Oral Immunization of Mice
Four-week-old male BALB/c mice (5–10 mice per group) (Jackson Laboratory, Bar Harbor, ME, USA) were immunized on days 0, 14, and 28. We anesthetized the animals with isoflurane. Using a gavage needle, we then intragastrically inoculated the animals with phosphate-buffered saline (PBS) containing no Salmonella or 1 × 109 cfu v-M78 or v-C [34,35]. Two trials were conducted with a total of 60 animals and each trial included 30 animals (10 mice per group).
2.5. MCMV-Infected Cell Lysate ELISA
Sera and mucosal samples were drawn from mice at indicated time points, following the procedures described previously [36,37]. Blood was collected and transferred to microtainer tubes (Becton Dickinson, San Jose, CA, USA) based on the manufacturer’s recommendations. Nasal wash samples were collected and prepared as described previously [38]. The serum anti-MCMV IgG and IgA antibody reactivity was measured against cell lysates infected with the wildtype MCMV Smith strain or mutant m-M78. To prepare the cell lysates, NIH3T3 cells were infected with the Smith strain or mutant m-M78 (MOI = 1). After 4 days, these cells were harvested and subjected to three freeze/thaw cycles, quantified by measuring the absorbance at 280 nm in a spectrophotometer, and stored at −80 °C, following the procedures described [26,27].
We conducted ELISAs using Medisorp plates (Thermo Fisher, Waltham, MA, USA), following the manufacturer’s recommendation. The plates were first incubated with the cell lysate (50 µg/mL) and then reacted with 100 µL per well of the serum or mucosal nasal wash samples diluted in an ELISA dilution buffer (PBS containing 5% Bovine Serum Albumin). After the antiserum incubation, the plate was then incubated with goat anti-mouse IgG (H+L) AP or anti-mouse IgA AP secondary antibodies (Cell Signaling Technologies, Danvers, MA, USA), then reacted with a chemiluminescent TMB substrate (BioLegend, California, San Diego, CA, USA) and analyzed in a plate reader (Molecular Devices, San Jose, CA, USA). The assays were performed in duplicate, and the experiments were repeated three times. The values obtained were the averages from these experiments.
2.6. T Cell ELISPOT Assay
We employed the mouse IFN-γ ELISPOT kit (U-Cytech biosciences, Utrecht, The Netherlands) to quantify IFN-γ-expressing T cells, following the manufacturer’s recommendations [39]. The ELISPOT plates containing mouse splenocytes (n = 1 × 106 cells) were incubated in the absence and presence of m-M78- or Smith-infected cell lysates (150 µg/well). We then treated the plates with an anti-mouse IFN-γ antibody and analyzed the plates with a video camera [39]. Phytohemagglutinin (PHA, 4 µg/mL, Sigma–Aldrich, St. Louis, MO, USA) served as the positive control. We conducted the experiments in duplicate and repeated them three times.
2.7. Studies of Immunized Mice Challenged with MCMV
Ten mice per group were infected intraperitoneally or intranasally with 100 µL PBS containing 1 × 106 PFU of the salivary gland-passaged MCMV Smith strain (for a lethal dosage challenge) or 5 × 104 PFU of the cultured cell-passaged MCMV Smith strain two weeks after the final vaccination [26,27]. Survival studies were conducted as described previously [26,27], with the animals monitored daily for 16 days.
To quantify the level of MCMV in various organs of the infected animals, we collected the spleens, livers, lungs, and salivary glands at 5 days postinfection [26,27]. We titered these virus samples in NIH 3T3 cells in the presence of fresh DMEM (Thermo Fisher, Waltham, MA, USA) containing 1% low-melting agarose (Catalog Number: A9045-5G) (Sigma–Aldrich, St. Louis, MO, USA) and counted the plaques, following the previously described procedures [26,27]. We titered each sample in duplicate and repeated them three times.
2.8. Statistical Analysis
All the assays were performed in duplicate and repeated three times. We analyzed the findings with the analysis of variance (ANOVA) (GraphPad Prism software, version 10). We considered a p-value of <0.05 as statistically significant.
3. Results
3.1. Generation of Salmonella-Based Vaccine
We previously used Salmonella-based vectors to express therapeutic ribozymes or RNAs in cultured cells and in mice [17,40]. In this study, we generated an attenuated Salmonella strain, SL416, from Salmonella typhimurium strain SL7207 [33] with a deletion of part of the SsrA/B coding sequence. Previous studies have shown that SL7207 is an attenuated strain with gene delivery activity for the expression of ribozymes and small therapeutic RNAs [17,40]. The ssrA/B protein regulates the expression of many SPI-2 encoded genes important for the intracellular survival and virulence of Salmonella in vivo [22,41]. To generate a Salmonella vaccine expressing the MCMV antigen M78, SL416 was transformed with the plasmid construct peM78, which contained the M78 encoding sequence under the control of a eukaryotic expression promoter. We generated two vaccines for the study. The functional vaccine v-M78 contained strain SL416 with the construct peM78. The control vaccine v-C contained SL416 with an empty vector construct without any MCMV sequences and was used as a negative control.
3.2. The Characterization of the Constructed Salmonella-Based Vaccines for Their Growth and Gene Delivery Ability in Cultured Cells and in Mice
Three series of experiments were performed to characterize the constructed Salmonella-based vaccines. First, in vitro experiments showed that v-M78 and v-C grew in LB broth as well as the Salmonella clinical strains ST14028s and SL416 without any constructs (Figure 1A). Thus, the M78 sequence and vector construct did not impair the viability of the bacterial carrier.
Second, we examined the virulence of these constructed Salmonella-based vaccines in mice in vivo. Our results showed that SL416 carrying no construct, v-C, and v-M78 showed little virulence in killing mice compared to the clinical strain ST14028s. No death was recorded for mice infected with SL416, v-M78, and v-C (1 × 109 cfu/mouse) even at 60 days postinoculation (Figure 1B). On the contrary, mice with a lower dose of ST14028s (2 × 103 cfu/mouse) died within 7 days (Figure 1B). Thus, the constructed SL416-based vaccines were severely attenuated in mice and showed little ability to kill the mice.
Third, we determined if v-M78 exhibited an efficient gene delivery ability for M78 expression in cultured cells and in mice. In Northern blot analyses, neither the M78 RNA transcript nor the M78 protein was detected in v-M78 when grown in LB in vitro, indicating that M78, which was under the control of a eukaryotic expression cassette, was not expressed when the SL416-based vaccine grew outside of mammalian cells.
To determine whether v-M78 could deliver the M78 sequence into mammalian cells, mouse J774 macrophages were infected with v-M78 and v-C. At 72 h postinfection, the M78 protein expression was assayed in Western blot experiments using actin as the loading control (Figure 2). The control vaccine, v-C, in which SL416 carried an empty vector, showed no M78 expression (Figure 2, lanes 5). The M78 (~52 KD) protein was detected in cells infected with the functional Salmonella-based vaccine, v-M78, in which SL416 carried the construct peM78 (lane 6).
To investigate the SL416-mediated gene delivery for M78 expression in vivo, we intragastrically inoculated BALB/c mice with the vaccines v-M78 and v-C. We detected the M78 protein in the spleens and cecums of the v-M78-treated mice (Figure 2, lanes 7–12). In sum, these results indicated that v-M78 carried out gene transfer for M78 expression and showed little virulence and pathogenicity in mice.
3.3. Humoral Responses Elicited by Salmonella-Based Vaccines
The animals were either intragastrically treated with phosphate-buffered saline (PBS) (as the negative controls) or vaccinated with v-M78 and v-C at days 0, 14, and 28. Two trials were conducted with a total of 60 animals, and each trial included 30 animals (10 mice per group). No animal death was recorded at day 42 post immunization (i.e., two weeks after the final immunization), consistent with our results (Figure 1B) showing that v-M78 and v-C exhibited little capability to kill mice in vivo.
We performed an ELISA to assess the levels of serum antibodies at 0, 16, 32, and 42 days after immunization (Figure 3). The functional activities of the sera from the vaccinated mice were investigated by comparing the antibody titers against lysates from cells infected with the MCMV Smith strain with those against lysates from cells infected with the MCMV mutant m-M78, which was derived from the MCMV Smith strain and contained a deletion of the M78 open reading frame. MCMV mutants inactivating M78 replicated efficiently in NIH 3T3 cells in vitro but were attenuated in growth in mice [24,25].
Sera obtained from mice immunized with v-M78 exhibited at least 250 times higher antibody titers against MCMV Smith-infected cell lysates than those with the control vaccine v-C (Figure 3A). However, the sera from both mice immunized with v-C and v-M78 displayed low antibody titers against the m-M78-infected cell lysates (Figure 3B). These results suggest that the IgG humoral responses elicited by v-M78 were specifically against M78.
To investigate the mucosal antibody responses elicited by the vaccines, we also examined the anti-MCMV IgA levels in the nasal wash at 0, 16, 32, and 42 days after immunization. At 42 days post immunization, mice immunized with the vaccine v-M78 displayed more than 60 times higher IgA levels against Smith-infected cell lysates compared to those immunized with the control v-C (Figure 3C). In contrast, the mucosal washes from both mice immunized with v-C and v-M78 displayed low IgA antibody titers against the m-M78-infected cell lysates (Figure 3D). These results suggest that v-M78 elicited both M78-specific serum IgG and mucosal IgA responses.
3.4. T Cell Responses Elicited by Salmonella-Based Vaccines
We harvested splenocytes (n = 1 × 106 cells) from animals 42 days after oral administration and stimulated them with the lysates of cells infected with the Smith strain or m-M78 mutant. The functional vaccine v-M78 induced about 100 times higher anti-MCMV IFN-γ-producing T cell responses against the Smith-infected cell lysates than the control vaccine v-C (Figure 4A). In contrast, mice immunized with v-C and v-M78 displayed low anti-MCMV T cell responses against the m-M78-infected cell lysates (Figure 4B). Thus, v-M78 appeared to elicit M78-specific T cell responses.
3.5. Salmonella Vaccine-Elicited Immune Protection of Mice from Intraperitoneal MCMV Challenge
To study if v-M78 elicited immune protection against a systemic MCMV challenge, mice were vaccinated with v-M78 and v-C at days 0, 14, and 28 and then intraperitoneally challenged with a lethal dose of salivary gland-passaged highly pathogenic MCMV at day 42 (i.e., two weeks after the final immunization). Mice vaccinated with the functional vaccine v-M78 showed 100% protection against the MCMV challenge after 14 days post challenge, while mice administered with the control vaccine v-C or PBS exhibited no protection against the MCMV challenge as all these animals died within 7 days post challenge (Figure 5A).
To further investigate the immune protection elicited by v-M78, we measured virus loads in different organs of the immunized mice after the MCMV challenge. Mice were vaccinated with v-M78 and v-C at days 0, 14, and 28 and then intraperitoneally challenged with sub-lethal MCMV doses at day 42. Mouse organs were harvested at day 5 post challenge, and viral titers in these organs were quantified. The virus titers in the spleens, livers, lungs, and salivary glands in v-M78-vaccinated mice were about 600-, 500-, 700-, and 1000-fold lower than those in PBS-treated mice, respectively (Figure 6). In contrast, virus titers in these organs from animals vaccinated with the control vaccine v-C exhibited no significant difference compared to those from the PBS-treated animals (Figure 6A–D). These results suggest that the functional vaccine v-M78 provides immune protection against MCMV and reduces the infection from and replication of the challenged MCMV in mice.
3.6. Salmonella Vaccine-Elicited Immune Protection of Mice from Intranasal MCMV Challenge
Attenuated Salmonella strains can induce strong mucosal immune responses due to their infection and colonization in the gut. Our results also indicated the v-M78-mediated induction of anti-MCMV IgA in the mucosal nasal wash (Figure 3C,D). Thus, it is reasonable to suggest that intragastrical vaccination with v-M78 may elicit mucosal immune responses against an intranasal MCMV challenge. To determine if this was the case, two series of experiments were carried out. In the first series of experiments, mice were vaccinated with v-M78 and v-C at days 0, 14, and 28, then intranasally challenged with lethal doses of salivary gland-passaged highly pathogenic MCMV at day 42, and finally closely monitored for survival for 14 days post challenge. All mice administered with v-C or PBS exhibited no protection against the MCMV challenge and died within 6 days post challenge (Figure 5B). In contrast, 90% of the mice vaccinated with v-M78 remained alive and healthy after 14 days post challenge (Figure 5B).
The second series of experiments was to measure virus loads in different organs of the immunized mice after the intranasal MCMV challenge. Mice were vaccinated with v-M78 and v-C at days 0, 14, and 28 and then intranasally challenged with sub-lethal MCMV doses at day 42. At day 5 post challenge, organs were collected and viral titers were quantified. The virus titers in the spleens, livers, lungs, and salivary glands in v-M78-vaccinated mice were about 500-, 500-, 1000-, and 1000-fold lower than those in PBS-treated mice, respectively (Figure 7). In contrast, virus titers in these organs from animals vaccinated with the control vaccine v-C exhibited no significant difference compared to those from the PBS-treated animals (Figure 7A–D). These results suggest that the functional vaccine v-M78 induces mucosal immune protection against intranasal MCMV infection.
4. Discussion
Human CMV continues to pose a significant public health concern as the leading viral cause of congenital infections resulting in intellectual disability and hearing loss [1,5,6]. There is currently an urgent need to develop effective vaccines against HCMV infection and its associated human diseases. Oral anti-CMV vaccines may represent attractive candidates because they are cost-effective and administered easily. In the current report, we described how we generated a new attenuated S. typhimurium strain, SL416, that acts as a gene transfer vector to express the MCMV M78 protein. The Salmonella-based vaccine v-M78 induced anti-MCMV humoral and T cell responses and elicited effective immune protection against an MCMV challenge in mice. These results provide the first direct evidence that a Salmonella (ssrA/B−)-based vaccine, v-M78, is effective against MCMV infection in mice.
Attenuated Salmonella represent unique and promising oral vaccine vectors against pathogens [16]. For example, the vaccine against typhoid fever is derived from an attenuated Salmonella strain [42,43]. However, Salmonella-based oral vaccines have not been reported against CMV infection and its associated diseases. In our study, the attenuated Salmonella strain SL416 was derived from the auxotrophic strain SL7207 [33] and contained a deletion of part of ssrA/B. SsrA/B is required for the expression of many Salmonella pathogenicity island 2 (SPI-2) genes [22]. Thus, SL416, with a deletion in ssrA/B, should have little capability to kill mice and cause substantial pathological effects in vivo (Figure 1). Moreover, SL416 exhibited excellent gene transfer activity. The M78 protein was detected in cells and in mice treated with v-M78 (Figure 2). In mice, v-M78 induced strong anti-MCMV humoral and T cell immune responses and elicited effective immune protection against MCMV infection (Figure 3, Figure 4, Figure 5, Figure 6 and Figure 7). Therefore, strain SL416 represents a new and promising oral vaccine vector against CMV infection.
One of the most important issues related to the use of live bacteria as a vaccine is the safety of these vaccines and their potential pathogenesis in vaccinated individuals. Previous studies showed that a vaccine against typhoid fever was derived from an attenuated Salmonella strain [42,43], demonstrating that attenuated Salmonella is safe for the vaccination of humans. Another issue is related to the turnover/clearance of the bacteria cells post vaccination. The construction of bacterial mutants with the inactivation of virulence factors important for virulence/pathogenesis and immune evasion should reduce their ability to cause pathological effects and increase their clearance/turnover by the immune system. Little is currently known about the turnover/clearance of our constructed vaccines, v-C and v-M78, in the vaccinated mice. Different approaches, such as qPCR to measure the bacterial DNA and numerous imaging methods to visualize the bacteria, can be performed to study this issue. In our experiments, a high dose of Salmonella was introduced to the animals, yielding a satisfactory protection and survival rate. It is important to use fewer bacteria to minimize potential safety issues associated with live Salmonella. Further studies can be carried out to address this issue with the improved design and construction of Salmonella strains exhibiting higher immunogenicity and expressing higher levels of the antigen. These studies will facilitate the development of attenuated Salmonella as vaccine vectors for clinical applications.
It is currently not completely understood how attenuated Salmonella strains carry out gene transfer in infected mammalian cells. In the delivery system reported here, we constructed the attenuated Salmonella strain SL416 and generated v-M78 by introducing peM78 into SL418. In Salmonella-infected cells, the bacteria release transgene expression constructs (i.e., peM78), which enter the nuclei, resulting in transgene expression [17,18]. Additional studies on understanding SL416-induced gene transfer for M78 expression will facilitate the development of better Salmonella-based vectors for the construction of oral vaccines against human diseases.
Vaccines being explored against CMV include conventional inactivated whole-viral antigen vaccines, recombinant protein vaccines, virus-like particle (VLP) vaccines, DNA vaccines, and vaccines based on live attenuated virus vectors [7]. However, there are currently no FDA-approved anti-CMV vaccines available. The MCMV infection of mice represents an excellent model for studies of the immune responses to CMV infection and anti-CMV vaccine development. For example, DNA-based and viral vector-based vaccines expressing different MCMV antigens elicited strong antiviral humoral and T cell responses and inhibited viral infection and protected mice from a MCMV challenge [9,10,11,12,13]. However, it has not been reported whether M78 or its HCMV homolog, UL78, can serve as an antigen for vaccine development. Previous studies have implicated the important roles of the M78 and UL78 proteins in viral infection and pathogenesis. The M78 and UL78 proteins function as G protein-coupled receptor (GCR) homologs and are expressed in both virions and infected cells [23]. M78 regulates viral IE mRNA expression during viral replication and down-regulates MHC II expression during viral salivary gland colonization [24,25]. Because they are virion components, M78 and UL78 are considered potential vaccine candidates against CMV infections. However, whether M78 or UL78 functions as an anti-CMV immunogen has not been reported. Our results imply that M78 and UL78 may be promising antigens for anti-CMV vaccine development. Further studies on these issues will facilitate the development of novel vaccines against CMV infections and their associated diseases.
It should be noted that the immune responses observed in a mouse model may not reflect those in humans [3,8]. We need to carry out additional investigations to understand the immune responses to Salmonella-based CMV vaccines in humans. These studies will provide insight into our understanding of the use of Salmonella-based vaccines against CMV and associated diseases.
5. Conclusions
Human CMV is the most common cause of viral congenital infections worldwide. The development of effective vaccines against human CMV infection and disease is a high priority. In this study, an attenuated Salmonella strain was generated as an oral vaccine vector for the delivery and expression of the M78 protein of murine cytomegalovirus (MCMV). Using the MCMV infection of mice as the CMV infection model, we characterized the immune responses and protection induced by the constructed Salmonella-based vaccine. Our results provide the first direct evidence that a Salmonella-based vaccine expressing M78 elicits strong humoral and cellular immune responses and induces immune protection against MCMV infection. Furthermore, our study demonstrates the potential of using Salmonella-based oral vaccines against CMV infection.
Conceptualization, Y.L., H.G., J.Z. and F.L.; methodology, Y.L., H.G., J.Z. and F.L.; validation, Y.L., H.G., J.Z. and F.L.; formal analysis, Y.L., H.G., J.Z. and F.L.; investigation, Y.L., H.G., J.Z. and F.L.; data curation, Y.L., H.G., J.Z. and F.L.; writing, Y.L., H.G., J.Z. and F.L.; supervision, F.L.; project administration, F.L.; funding acquisition, F.L. All authors have read and agreed to the published version of the manuscript.
We performed this study in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the National Research Council. The animal experiment protocol was approved by the Animal Care and Use Committee of the University of California, Berkeley (Protocol #R240, approved on 7 December 2022). We made all efforts to minimize the suffering of experimental animals.
Not applicable.
The dataset is available on request from the authors.
We are grateful to Eduardo Lujan, Andrea Garon, and Cristian Pagtalunan for their critical comments, the reagents, and their technical assistance.
The authors declare no conflicts of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1. (A) Growth of Salmonella clinical strain ST14028s, mutant SL416, and SL416 with empty vector peVAX (v-C) and construct peM78 (v-M78) in LB broth. (B) Survival of BALB/c mice infected with Salmonella strains. Mice (5 animals per group) were inoculated intragastrically with ST14028 (2 × 103 CFU) and SL416 (1 × 109 CFU) without any construct or with empty vector and construct peM78. Experimental details can be found in Materials and Methods.
Figure 2. Western blot detection of MCMV M78 in cells and mice treated with phosphate-buffered saline (PBS) only (lanes 1, 4, 7, and 10), v-C (lane 2, 5, 8, and 11), and v-M78 (lanes 3, 6, 9, and 12). Cells were collected at 72 h post treatment, while spleens and cecums were isolated from animals intragastrically inoculated with PBS, v-C, or v-M78 4 days after inoculation. Protein samples (30 μg) were separated on denaturing gels and stained with anti-actin (lanes 1–3) and anti-M78 antibodies (lanes 4–12).
Figure 3. Humoral responses in mice treated with PBS, control vaccine v-C, and functional vaccine v-M78. We used ELISA to assay titers of serum IgG against lysates of cells infected with MCMV Smith (A) and mutant m-M78 (B) and titers of mucosal IgA against lysates of cells infected with MCMV Smith (C) and mutant m-M78 (D) in immunized mice at 42 days post immunization. We treated animals intragastrically with PBS only, v-C, and v-M78 at days 0, 14, and 28. Pooled serum or mucosal wash samples from mice were analyzed. ** p [less than] 0.05. NS, not significant. Error bars indicate standard deviation. Two trials were conducted with total of 60 animals, and each trial included 30 animals (10 mice per group). Experiments were conducted in duplicate and repeated three times.
Figure 4. T cell responses in mice treated with PBS, the control vaccine v-C, and the functional vaccine v-M78. We treated animals intragastrically with PBS only, v-C, and v-M78 at days 0, 14, and 28. Splenocytes (n = 5) were isolated at 42 days post immunization and stimulated with Smith-infected (A) and m-M78-infected cellular lysates (B) for 48 h. We assayed the T cell responses with an ELISPOT analysis of the IFN-γ production by the cells. The results were expressed as spot-forming cells (SFCs) per million cells. ** p [less than] 0.05. NS, not significant. Error bars indicate the standard deviation. Two trials were conducted with a total of 60 animals, and each trial included 30 animals (10 mice per group). Experiments were conducted in duplicate and repeated three times.
Figure 5. Immune protection of mice from MCMV challenge. Groups of mice (10 mice per group) were intragastrically immunized three times at days 0, 14, and 28 with PBS only, control vaccine v-C (v-C), and functional vaccine (v-M78) and then challenged intraperitoneally (A) or intranasally (B) with salivary gland-passaged MCMV Smith (1 × 106 PFU) at 42 days post initial immunization. Mice were monitored for survival, and results are presented in terms of percent survival.
Figure 6. Virus titers in the spleens (A), livers (B), lungs (C), and salivary glands (D) of mice after the intraperitoneal MCMV challenge. We treated mice intragastrically with PBS, v-C, and v-M78 at days 0, 14, and 28 and then challenged them intraperitoneally with MCMV Smith (5 × 104 PFU) two weeks after the final immunization. Viral titers were assayed from organs collected 5 days post challenge. The limit of detection was 10 PFU/mL. ** p [less than] 0.05. NS, not significant. Error bars indicate the standard deviation. Two trials were conducted with a total of 60 animals, and each trial included 30 animals (10 mice per group). Experiments were conducted in duplicate and repeated three times.
Figure 7. Virus titers in the spleens (A), livers (B), lungs (C), and salivary glands (D) of mice after the intranasal MCMV challenge. We treated mice intragastrically with PBS, v-C, and v-M78 at days 0, 14, and 28 and then challenged them intranasally with MCMV Smith (5 × 104 PFU) two weeks after the final immunization. Viral titers were assayed from organs collected 5 days post challenge. The limit of detection was 10 PFU/mL. ** p [less than] 0.05. NS, not significant. Error bars indicate the standard deviation. Two trials were conducted with a total of 60 animals, and each trial included 30 animals (10 mice per group). Experiments were conducted in duplicate and repeated three times.
References
1. Fowler, K.B.; Stagno, S.; Pass, R.F. Maternal immunity and prevention of congenital cytomegalovirus infection. JAMA; 2003; 289, pp. 1008-1011. [DOI: https://dx.doi.org/10.1001/jama.289.8.1008] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/12597753]
2. Ssentongo, P.; Hehnly, C.; Birungi, P.; Roach, M.A.; Spady, J.; Fronterre, C.; Wang, M.; Murray-Kolb, L.E.; Al-Shaar, L.; Chinchilli, V.M. et al. Congenital Cytomegalovirus Infection Burden and Epidemiologic Risk Factors in Countries With Universal Screening: A Systematic Review and Meta-analysis. JAMA Netw. Open; 2021; 4, e2120736. [DOI: https://dx.doi.org/10.1001/jamanetworkopen.2021.20736] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34424308]
3. Goodrum, F.; Britt, W.; Mocarski, E.S. Cytomegalovirus. Fields Virology: DNA Viruses; 7th ed. Knipe, D.M.; Howley, P. Wolters Kluwer Health, Lippincott and Williams & Wilkins: Philadelphia, PA, USA, 2021; Volume 1, pp. 389-444.
4. Krug, L.T.; Pellett, P.E. The Family Herpesviridae: A Brief Introduction. Fields Virology: DNA Viruses; 7th ed. Knipe, D.M.; Howley, P. Wolters Kluwer Health, Lippincott and Williams & Wilkins: Philadelphia, PA, USA, 2021; Volume 1, pp. 212-234.
5. Boppana, S.B.; Rivera, L.B.; Fowler, K.B.; Mach, M.; Britt, W.J. Intrauterine transmission of cytomegalovirus to infants of women with preconceptional immunity. N. Engl. J. Med.; 2001; 344, pp. 1366-1371. [DOI: https://dx.doi.org/10.1056/NEJM200105033441804] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11333993]
6. Khalil, A.; Heath, P.T.; Jones, C.E.; Soe, A.; Ville, Y.G. Royal College of Obstetricians and Gynaecologists. Congenital Cytomegalovirus Infection: Update on Screening, Diagnosis and Treatment: Scientific Impact Paper No. 56. BJOG; 2025; 132, pp. e42-e52. [DOI: https://dx.doi.org/10.1111/1471-0528.17966]
7. Plotkin, S.A.; Wang, D.; Oualim, A.; Diamond, D.J.; Kotton, C.N.; Mossman, S.; Carfi, A.; Anderson, D.; Dormitzer, P.R. The Status of Vaccine Development Against the Human Cytomegalovirus. J. Infect. Dis.; 2020; 221, (Suppl. 1), pp. S113-S122. [DOI: https://dx.doi.org/10.1093/infdis/jiz447]
8. Bruce, K.; Ma, J.; Lawler, C.; Xie, W.; Stevenson, P.G.; Farrell, H.E. Recent Advancements in Understanding Primary Cytomegalovirus Infection in a Mouse Model. Viruses; 2022; 14, 1934. [DOI: https://dx.doi.org/10.3390/v14091934]
9. Farrell, H.E.; Bruce, K.; Stevenson, P.G. A Live Olfactory Mouse Cytomegalovirus Vaccine, Attenuated for Systemic Spread, Protects against Superinfection. J. Virol.; 2021; 95, e0126421. [DOI: https://dx.doi.org/10.1128/JVI.01264-21]
10. Huang, C.; Wang, H.; Wu, S.; Chang, H.; Liu, L.; Peng, B.; Fang, F.; Chen, Z. Comparison of multiple DNA vaccines for protection against cytomegalovirus infection in BALB/c mice. Virol. J.; 2014; 11, 104. [DOI: https://dx.doi.org/10.1186/1743-422X-11-104]
11. Morello, C.S.; Cranmer, L.D.; Spector, D.H. Suppression of murine cytomegalovirus (MCMV) replication with a DNA vaccine encoding MCMV M84 (a homolog of human cytomegalovirus pp65). J. Virol.; 2000; 74, pp. 3696-3708. [DOI: https://dx.doi.org/10.1128/JVI.74.8.3696-3708.2000]
12. Morello, C.S.; Ye, M.; Hung, S.; Kelley, L.A.; Spector, D.H. Systemic priming-boosting immunization with a trivalent plasmid DNA and inactivated murine cytomegalovirus (MCMV) vaccine provides long-term protection against viral replication following systemic or mucosal MCMV challenge. J. Virol.; 2005; 79, pp. 159-175. [DOI: https://dx.doi.org/10.1128/JVI.79.1.159-175.2005]
13. Wang, H.; Huang, C.; Dong, J.; Yao, Y.; Xie, Z.; Liu, X.; Zhang, W.; Fang, F.; Chen, Z. Complete protection of mice against lethal murine cytomegalovirus challenge by immunization with DNA vaccines encoding envelope glycoprotein complex III antigens gH, gL and gO. PLoS ONE; 2015; 10, e0119964. [DOI: https://dx.doi.org/10.1371/journal.pone.0119964] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25803721]
14. Cardenas, L.; Clements, J.D. Oral immunization using live attenuated Salmonella spp. as carriers of foreign antigens. Clin. Microbiol. Rev.; 1992; 5, pp. 328-342. [DOI: https://dx.doi.org/10.1128/CMR.5.3.328] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/1498769]
15. Cheminay, C.; Hensel, M. Rational design of Salmonella recombinant vaccines. Int. J. Med. Microbiol.; 2008; 298, pp. 87-98. [DOI: https://dx.doi.org/10.1016/j.ijmm.2007.08.006] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17888730]
16. Clark-Curtiss, J.E.; Curtiss, R., 3rd. Salmonella Vaccines: Conduits for Protective Antigens. J. Immunol.; 2018; 200, pp. 39-48. [DOI: https://dx.doi.org/10.4049/jimmunol.1600608]
17. Jiang, X.; Gong, H.; Chen, Y.C.; Vu, G.P.; Trang, P.; Zhang, C.Y.; Lu, S.; Liu, F. Effective inhibition of cytomegalovirus infection by external guide sequences in mice. Proc. Natl. Acad. Sci. USA; 2012; 109, pp. 13070-13075. [DOI: https://dx.doi.org/10.1073/pnas.1201620109]
18. Loessner, H.; Endmann, A.; Rohde, M.; Curtiss, R., 3rd; Weiss, S. Differential effect of auxotrophies on the release of macromolecules by Salmonella enterica vaccine strains. FEMS Microbiol. Lett.; 2006; 265, pp. 81-88. [DOI: https://dx.doi.org/10.1111/j.1574-6968.2006.00470.x]
19. Abrahams, G.L.; Hensel, M. Manipulating cellular transport and immune responses: Dynamic interactions between intracellular Salmonella enterica and its host cells. Cell Microbiol.; 2006; 8, pp. 728-737. [DOI: https://dx.doi.org/10.1111/j.1462-5822.2006.00706.x]
20. Waterman, S.R.; Holden, D.W. Functions and effectors of the Salmonella pathogenicity island 2 type III secretion system. Cell. Microbiol.; 2003; 5, pp. 501-511. [DOI: https://dx.doi.org/10.1046/j.1462-5822.2003.00294.x]
21. Kong, W.; Brovold, M.; Koeneman, B.A.; Clark-Curtiss, J.; Curtiss, R., 3rd. Turning self-destructing Salmonella into a universal DNA vaccine delivery platform. Proc. Natl. Acad. Sci. USA; 2012; 109, pp. 19414-19419. [DOI: https://dx.doi.org/10.1073/pnas.1217554109]
22. Bijlsma, J.J.; Groisman, E.A. The PhoP/PhoQ system controls the intramacrophage type three secretion system of Salmonella enterica. Mol. Microbiol.; 2005; 57, pp. 85-96. [DOI: https://dx.doi.org/10.1111/j.1365-2958.2005.04668.x]
23. Rosenkilde, M.M.; Tsutsumi, N.; Knerr, J.M.; Kildedal, D.F.; Garcia, K.C. Viral G Protein-Coupled Receptors Encoded by beta- and gamma-Herpesviruses. Annu. Rev. Virol.; 2022; 9, pp. 329-351. [DOI: https://dx.doi.org/10.1146/annurev-virology-100220-113942] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35671566]
24. Oliveira, S.A.; Shenk, T.E. Murine cytomegalovirus M78 protein, a G protein-coupled receptor homologue, is a constituent of the virion and facilitates accumulation of immediate-early viral mRNA. Proc. Natl. Acad. Sci. USA; 2001; 98, pp. 3237-3242. [DOI: https://dx.doi.org/10.1073/pnas.051629898] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/11248062]
25. Yunis, J.; Farrell, H.E.; Bruce, K.; Lawler, C.; Sidenius, S.; Wyer, O.; Davis-Poynter, N.; Stevenson, P.G. Murine cytomegalovirus degrades MHC class II to colonize the salivary glands. PLoS Pathog.; 2018; 14, e1006905. [DOI: https://dx.doi.org/10.1371/journal.ppat.1006905] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29447285]
26. Abenes, G.; Chan, K.; Lee, M.; Haghjoo, E.; Zhu, J.; Zhou, T.; Zhan, X.; Liu, F. Murine cytomegalovirus with a transposon insertional mutation at open reading frame m155 is deficient in growth and virulence in mice. J. Virol.; 2004; 78, pp. 6891-6899. [DOI: https://dx.doi.org/10.1128/JVI.78.13.6891-6899.2004]
27. Xiao, J.; Tong, T.; Zhan, X.; Haghjoo, E.; Liu, F. In vitro and in vivo characterization of a murine cytomegalovirus with a transposon insertional mutation at open reading frame M43. J. Virol.; 2000; 74, pp. 9488-9497. [DOI: https://dx.doi.org/10.1128/JVI.74.20.9488-9497.2000]
28. Rawlinson, W.D.; Farrell, H.E.; Barrell, B.G. Analysis of the complete DNA sequence of murine cytomegalovirus. J. Virol.; 1996; 70, pp. 8833-8849. [DOI: https://dx.doi.org/10.1128/jvi.70.12.8833-8849.1996]
29. Dunn, W.; Chou, C.; Li, H.; Hai, R.; Patterson, D.; Stolc, V.; Zhu, H.; Liu, F. Functional profiling of human cytomegalovirus genome. Proc. Natl. Acad. Sci. USA; 2003; 100, pp. 14223-14228. [DOI: https://dx.doi.org/10.1073/pnas.2334032100]
30. Wagner, M.; Jonjic, S.; Koszinowski, U.H.; Messerle, M. Systematic excision of vector sequences from the BAC-cloned herpesvirus genome during virus reconstitution. J. Virol.; 1999; 73, pp. 7056-7060. [DOI: https://dx.doi.org/10.1128/JVI.73.8.7056-7060.1999]
31. Sharp, E.L.; Davis-Poynter, N.J.; Farrell, H.E. Analysis of the subcellular trafficking properties of murine cytomegalovirus M78, a 7 transmembrane receptor homologue. J. Gen. Virol.; 2009; 90, Pt 1, pp. 59-68. [DOI: https://dx.doi.org/10.1099/vir.0.004853-0]
32. Datsenko, K.A.; Wanner, B.L. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA; 2000; 97, pp. 6640-6645. [DOI: https://dx.doi.org/10.1073/pnas.120163297]
33. Hoiseth, S.K.; Stocker, B.A. Aromatic-dependent Salmonella typhimurium are non-virulent and effective as live vaccines. Nature; 1981; 291, pp. 238-239. [DOI: https://dx.doi.org/10.1038/291238a0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/7015147]
34. Gong, H.; Vu, G.; Bai, Y.; Chan, E.; Wu, R.; Yang, E.; Liu, F.; Lu, S. A Salmonella small non-coding RNA facilitates bacterial invasion and intracellular replication by modulating the expression of virulence factors. PLoS Pathog.; 2011; 7, e1002120. [DOI: https://dx.doi.org/10.1371/journal.ppat.1002120] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21949647]
35. Lu, S.; Killoran, P.B.; Fang, F.C.; Riley, L.W. The global regulator ArcA controls resistance to reactive nitrogen and oxygen intermediates in Salmonella enterica serovar Enteritidis. Infect. Immun.; 2002; 70, pp. 451-461. [DOI: https://dx.doi.org/10.1128/IAI.70.2.451-461.2002]
36. Hai, R.; Garcia-Sastre, A.; Swayne, D.E.; Palese, P. A reassortment-incompetent live attenuated influenza virus vaccine for protection against pandemic virus strains. J. Virol.; 2011; 85, pp. 6832-6843. [DOI: https://dx.doi.org/10.1128/JVI.00609-11]
37. Price, G.E.; Lo, C.Y.; Misplon, J.A.; Epstein, S.L. Reduction of Influenza A Virus Transmission in Mice by a Universal Intranasal Vaccine Candidate is Long-Lasting and Does Not Require Antibodies. J. Virol.; 2022; 96, e0032022. [DOI: https://dx.doi.org/10.1128/jvi.00320-22]
38. Price, G.E.; Lo, C.Y.; Misplon, J.A.; Epstein, S.L. Mucosal immunization with a candidate universal influenza vaccine reduces virus transmission in a mouse model. J. Virol.; 2014; 88, pp. 6019-6030. [DOI: https://dx.doi.org/10.1128/JVI.03101-13]
39. Luo, M.; Qu, X.; Pan, R.; Zhu, D.; Zhang, Y.; Wu, J.; Pan, Z. The virus-induced signaling adaptor molecule enhances DNA-raised immune protection against H5N1 influenza virus infection in mice. Vaccine; 2011; 29, pp. 2561-2567. [DOI: https://dx.doi.org/10.1016/j.vaccine.2011.01.060]
40. Bai, Y.; Li, H.; Vu, G.; Gong, H.; Umamoto, S.; Zhou, T.; Lu, S.; Liu, F. Salmonella-mediated delivery of RNase P ribozymes for inhibition of viral gene expression and replication in human cells. Proc. Natl. Acad. Sci. USA; 2010; 107, pp. 7269-7274. [DOI: https://dx.doi.org/10.1073/pnas.0912813107]
41. Walthers, D.; Carroll, R.K.; Navarre, W.W.; Libby, S.J.; Fang, F.C.; Kenney, L.J. The response regulator SsrB activates expression of diverse Salmonella pathogenicity island 2 promoters and counters silencing by the nucleoid-associated protein H-NS. Mol. Microbiol.; 2007; 65, pp. 477-493. [DOI: https://dx.doi.org/10.1111/j.1365-2958.2007.05800.x]
42. Clairmont, C.; Lee, K.C.; Pike, J.; Ittensohn, M.; Low, K.B.; Pawelek, J.; Bermudes, D.; Brecher, S.M.; Margitich, D.; Turnier, J. et al. Biodistribution and genetic stability of the novel antitumor agent VNP20009, a genetically modified strain of Salmonella typhimurium. J. Infect. Dis.; 2000; 181, pp. 1996-2002. [DOI: https://dx.doi.org/10.1086/315497]
43. Levine, M.M.; Herrington, D.; Murphy, J.R.; Morris, J.G.; Losonsky, G.; Tall, B.; Lindberg, A.A.; Svenson, S.; Baqar, S.; Edwards, M.F. et al. Safety, infectivity, immunogenicity, and in vivo stability of two attenuated auxotrophic mutant strains of Salmonella typhi, 541Ty and 543Ty, as live oral vaccines in humans. J. Clin. Investig.; 1987; 79, pp. 888-902. [DOI: https://dx.doi.org/10.1172/JCI112899] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/3818953]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background: Human cytomegalovirus (CMV) is the most common cause of viral congenital infections worldwide. The development of effective vaccines against human CMV infection and disease is a high priority. Attenuated Salmonella are attractive oral vaccine vectors against human diseases because they can be administrated orally. Methods: In this study, an attenuated Salmonella strain was generated as an oral vaccine vector for the delivery and expression of the M78 protein of murine cytomegalovirus (MCMV). Using the MCMV infection of mice as the CMV infection model, we characterized the immune responses and protection induced by the constructed Salmonella-based vaccine. Results: The generated Salmonella-based vaccine, v-M78, which contained an M78 expression plasmid construct, carried out gene transfer efficiently for M78 expression and showed little pathogenicity and virulence in mice. In orally vaccinated mice, v-M78 induced anti-MCMV serum IgG and mucosal IgA responses and also elicited anti-MCMV T cell responses. Furthermore, mice immunized with v-M78 were protected from intraperitoneal and intranasal challenges with MCMV. The v-M78 vaccination reduced the titers of the challenged viruses in spleens, livers, lungs, and salivary glands. Conclusions: These results provide the first direct evidence that a Salmonella-based vaccine expressing M78 elicits strong humoral and cellular immune responses and induces immune protection against MCMV infection. Furthermore, our study demonstrates the potential of using Salmonella-based oral vaccines against CMV infection.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
Details
1 School of Public Health, University of California, Berkeley, CA 94720, USA
2 School of Public Health, University of California, Berkeley, CA 94720, USA; Program in Comparative Biochemistry, University of California, Berkeley, CA 94720, USA




