Introduction
Malaria continues to threaten global human health, with approximately 249 million cases and 608,000 deaths worldwide in 2022 [1]. During experimental blood-stage Plasmodium infection, antigen-specific CD4+ T cells orchestrate cellular and humoral immune responses through various T helper (Th) cell types [2,3]. T helper 1 (Th1) cells are protective likely due to production of pro-inflammatory cytokines interferon gamma (IFN-γ) and tumor necrosis factor alpha (TNF-α), which may limit parasite growth via phagocyte activation [4,5]. T-follicular helper (Tfh) cells support the production of high-affinity Plasmodium-specific antibodies in germinal centres [6,7]. Regulation of inflammatory responses can occur through IL-10-producing Type I regulatory T cells (Tr1), although this response can also restrict parasite-killing [8–12]. Thus, protective immunity to malaria relies on a balanced response by effector CD4+ T cells.
Discovery of new genes that control CD4+ T cell responses may provide opportunities to improve immunity to malaria. Advancements in single-cell RNA sequencing (scRNA-seq) and utilization of TCR-transgenic CD4+ T (PbTII) cells specific for Plasmodium Heat Shock Protein 90 previously enabled us to map transcriptional dynamics accompanying CD4+ effector T cell differentiation, transition to memory, and recall during re-infection in mice [11,13–15]. For instance, Maf, which promotes Tfh cell differentiation in vivo during immunization [16,17], is up-regulated during both Th1 and Tfh cell differentiation in experimental malaria. In this study, based on our existing scRNA-seq data [11,13–15], we focussed on two genes previously unstudied in CD4+ T cells: long-tailed unconventional myosin 1f (Myo1f) and proline-rich 13/taxanes-resistance 1 (Prr13/Txr1).
Myosins are actin-dependent motor proteins, comprising at least 18 distinct classes [18,19]. Class I myosins are the largest group, with six genes encoding short-tailed forms (Myosin 1a, -b, -c, -d, -g, and -h) and two encoding unconventional long-tailed forms (Myo1e and Myo1f), in mice and humans [20]. Recent studies report roles for Myo1e and Myo1f, in various cellular processes such as migration, adhesion, endocytosis, exocytosis, and phagocytosis [20–22]. Myo1f expression occurs in many tissues including spleen, lymph nodes, thymus, and lung, particularly by natural killer (NK) cells, neutrophils, macrophages, and dendritic cells within lymphoid tissues [23]. Myo1f-deficiency impacted the adhesion and migration of neutrophils, mast cells, and γδT intraepithelial lymphocytes [23–26]. Additionally, Myo1f was reported to contribute to several cellular processes, including granule exocytosis in neutrophils, IgE-dependent mast cell degranulation, and macrophage-mediated phagocytosis [23,27,28]. These processes, along with the actions of Myo1e, are regulated by controlling actin dynamics at the cell membrane [28,29]. These studies highlight that Myo1f plays a crucial role in innate immune cell migration and function. However, potential roles in adaptive immune cells remain largely unexplored.
Prr13/Txr1 encodes for a nuclear protein and likely transcriptional regulators, whose up-regulation in cancer is reported to promote resistance to chemotherapy drugs known as taxanes [30–34]. Prr13/Txr1 appears to induce taxane resistance through its association with thrombospondin-1 (TSP-1/THBS-1) and CD47 within cells [34,35]. It has been shown that Prr13 upregulation in certain cancer cells leads to a significant downregulation of TSP-1, a protein known for its anti-angiogenic and pro-apoptotic properties, which binds to cell surface receptor CD47 and triggering caspase-independent apoptosis of cancer cells [34,36,37]. This inverse relationship between Prr13 and TSP-1 suggests that high levels of Prr13 reduce the apoptotic response to taxane treatments by decreasing TSP-1 levels. A role for Prr13 in adaptive immune cells has yet to be examined.
In this study, we utilised existing scRNA-seq data from a mouse model of blood-stage malaria to hypothesise possible roles for Myo1f and Prr13 in CD4+ T cells. We next established a method to test for T-cell intrinsic gene function in Plasmodium-specific TCR transgenic CD4+ T cells during infection, using the transcription factor, Maf, as a test case. Finally, we tested whether Myo1f or Prr13 are required during effector or memory CD4+ T cell responses in vivo.
Results
Myo1f and Prr13 are transcriptionally upregulated in Plasmodium-specific CD4+ T cells during experimental malaria
Firstly, we mined existing scRNA-seq datasets of splenic TCR transgenic PbTIIs, and CD11ahi CXCR3+ polyclonal CD4+ T cells during primary and secondary P. chabaudi chabaudi AS (PcAS) infection in mice. We aimed to identify novel genes whose expression dynamics suggested possible function in effector and/or memory CD4+ T cells [11,14,38]. Here, we observed that Myo1f was not expressed in naïve PbTIIs, but was upregulated during Th1 effector and memory differentiation, less so for Tfh-differentiation (Fig 1Ai-iii). This was corroborated by assessment of polyclonal CD11ahi CXCR3+ CD4+ T cells at 7-days post-infection (Fig 1Bi-ii). Given prior evidence of Myo1f’s role in regulating movement and granule exocytosis in innate immune cells, particularly neutrophils [21,24–27], we hypothesized that this myosin protein might also control T cell migration and function during infection. Prr13 was modestly expressed in naïve PbTIIs, and strongly upregulated by all PbTIIs and polyclonal counter parts (Fig 1Ai-iii and 1Bi-ii), with the magnitude and frequency of expression largely maintained by PbTIIs until day 28 post-infection and treatment (Fig 1Aii-iii). After re-infection, expression of Myo1f and Prr13 was retained, without evidence of further up-regulation in PbTIIs (Fig 1Ci-ii) or polyclonal cells (Fig 1Di-ii). Given sequence predictions and prior studies suggesting that Prr13 may encode a DNA-binding protein localized in the nucleus and function as a transcriptional regulator [31,33–35], we surmised that this protein could act as a transcription factor in T cells, controlling differentiation and cellular maintenance processes. Taken together, our analysis revealed Myo1f and Prr13 expression were upregulated and maintained in specific effector and memory CD4+ T cell subsets during experimental malaria.
[Figure omitted. See PDF.]
+ T cells during experimental malaria. (Ai) Trajectories and gene-expression dynamics of PbTII cells during blood-stage malaria infection in mice. (Aii & Aiii) UMAP and Violin plot of PbTII cells expressing Myo1f and Prr13 at 0, 7, 14, and 28 d.p.i. UMAP obtained from Graphical User Interface (https://haquelab.mdhs.unimelb.edu.au/cd4_memory/). (Bi & Bii) UMAP of polyclonal CD4+ T cells expressing Myo1f and Prr13 at 7 d.p.i. obtained from the study by Williams et al [38]. (Ci & Cii) UMAP of antigen-experienced PbTII expressing Myo1f and Prr13 prior to (D28+ 0) and 24h, 48h, and 72h (D28+ 1, D28+ 2, and D28+ 3, respectively) after Plasmodium re-infection. (Di & Dii) UMAP of polyclonal CD4+ T cells expressing Myo1f and Prr13 prior to and 3 days after re-infection at 28 d.p.i. (C & D) UMAP obtained from Graphical User Interface (https://haquelab.mdhs.unimelb.edu.au/cd4_re-infection/). (A-D) Reprinted from [11].
An in vivo approach for testing gene function in Plasmodium-specific CD4+ T cells
To test for cell-intrinsic gene function in Plasmodium-specific CD4+ T cells, we developed an adoptive transfer system. In this system, donor PbTIIs were obtained either from knockout (KO) mouse, which constitutively express Cre-recombinase (driven by the CD4-promoter) and harbor homozygous alleles for a target gene with essential exons flanked by loxP sites (denoted as (f/f) here), or from wild-type (WT) mouse with the (f/f) alleles but without Cre expression. These donor cells were then adoptively transferred into congenic recipient mice infected with PcAS. We tested our approach on Maf, a gene that promotes Tfh-differentiation during immunization [16,17], and IL-10 production in malaria [12,39], but whose role in Tfh-differentiation during Plasmodium infection remains to be formally demonstrated. We examined PbTII cells at 7-days post-infection, the peak of parasitemia, when Th1 and Tfh differentiation was readily detectable, as previously demonstrated [14].
Firstly, our scRNA-seq data confirmed strong Maf upregulation by PbTII Th1 and Tfh cells during PcAS infection (Fig 2Ai-ii). We transferred into congenic recipients either CD4-Cre Maf (f/f) PbTIIs (KO), or WT control PbTIIs from Maf (f/f) PbTII littermates, examining splenic responses 7-days post-infection (Fig 2B). Firstly, we observed no up-regulation of cMaf in Maf-deficient PbTIIs, confirming this method of gene depletion using our adoptive transfer system (Fig 2C and D). PbTIIs Maf-deficient PbTIIs displayed no defect in clonal expansion compared to wild-type controls (Fig 2E), nor in the upregulation of the Th1-associated chemokine receptor CXCR6 (Fig 2F). In stark contrast, Maf-deficient PbTIIs exhibited a profound defect in upregulation of Tfh-associated chemokine receptor, CXCR5, compared to Maf-sufficient controls (Fig 2Fi-ii). This defect was absent as expected amongst WT endogenous polyclonal CD4+ T cells in recipient mice (Fig 2Fi-ii), confirming a cell-intrinsic requirement for Maf in promoting CXCR5 expression in PbTIIs. Similar patterns were observed for intracellular expression of Th1/Tfh-associated master transcription factors, Tbet and Bcl6, with Maf being essential for Bcl6 upregulation but not Tbet expression (Fig 2Gi-ii). Collectively, these data demonstrated, firstly, the utility of our approach for examining cell-intrinsic gene function in Plasmodium-specific CD4+ T cells in vivo, and secondly that cMaf is essential for Tfh differentiation in experimental malaria.
[Figure omitted. See PDF.]
+ T cells. (Ai) Trajectories and gene-expression dynamics of PbTII cells during blood-stage malaria infection in mice. (Aii) UMAP of PbTII cells expressing Maf over the corse of infection. UMAP obtained from Graphical User Interface (https://haquelab.mdhs.unimelb.edu.au/cd4_memory/). (B) Schematic of experiment: Congenically marked (CD45.2+) Maf (f/f) wild-type PbTIIs (WT) or CD4-Cre Maf (f/f) PbTIIs (KO) were adoptively transferred into Ly5.1 (CD45.1+) recipient mice infected with PcAS infection a day 0. Splenocytes were analysed on day 7 p.i. Created with Biorender.com. (C) The gating strategy for congenically marked (CD45.2+) Plasmodium-specific CD4+ TCR transgenic (PbTII) in Ly5.1 (CD45.2-) recipient mouse. Representative FACS plots of PbTIIs (CD45.2+ Va2+ CD4+ TCRβ+) and polyclonal CD4+ T cells (CD45.2- CD4+ TCRβ+) gated on Live/Lymphocytes/Singlets. (D) Histogram of cMaf expression in Naïve, WT, and KO PbTIIs at day 7 p.i. n = 5 per group, data are generated from one experiment. (E) Total number of PbTIIs per spleen at day 7 p.i. (Fi) Representative FACS plots of CXCR5 and CXCR6 expression. (Fii) Bar graphs showing frequencies of CXCR5+ and/or CXCR6+ PbTIIs and polyclonal CD4+ T cells in the WT or KO group in the spleen at day 7 p.i. (Gi) Representative FASC plots of direct ex vivo Bcl6 and Tbet expression. (Gii) Bar graphs showing frequencies of Bcl6+ or Tbet+ PbTIIs and polyclonal CD4+ T cells in WT or KO group in the spleen at day 7 p.i. Cells were treated with Brefeldin A (BFA) for 3 hours at 37°C, 5% CO2. (E-G) n = 5 per group, data are representative of two independent experiments. Statistical tests performed using unpaired, non-parametric Mann-Whitney t test; **p < 0.01.
Generation of Myo1f- and Prr13-deficient mice
Next, we generated mice in which Myo1f or Prr13 were deleted in CD4+ TCR transgenic (PbTII) cells (Fig 3A and B). C57BL/6 mice expressing Cre recombinase under the control of the CD4 promoter were crossed with a strain harbouring loxP sites flanking exon 2 and 4 of the Myo1f gene or flanking exon 3 and 4 of the Prr13 gene (Fig 3A). In parallel, gene-targeted strains were also crossed with PbTII TCR-transgenic mice (Fig 3B). Offspring was further mated to generate Myo1f-deficient (CD4-Cre Myo1f(f/f)) PbTII mice, or Prr13-deficient (CD4-Cre Prr13(f/f)) PbTII mice. Expression of loxP sites and Cre-mediated excision was confirmed by polymerase chain reaction (PCR) (Fig 3Ci-iii). Myo1f-sufficient (Myo1f(f/f)) or Prr13-sufficient (Prr13(f/f)) PbTII littermates mice were used as WT PbTII donors in this study (Fig 3A-C).
[Figure omitted. See PDF.]
(A) Scheme of the floxed Myo1f and Prr13 locus with Cre recombination. (B) The breeding strategy of generation of target-gene floxed (Flox/Fox) mouse expressing Cre (Cre/+) and Plasmodium antigen-specific transgene (Tg/+). (A & B) Created with Biorender.com. (Ci-iii) Intact gel bands and confirmation of expression of flox and Cre by polymerase chain reaction (PCR). Myo1f-sufficient (Myo1f (f/f)) PbTII, Myo1f-deficient (CD4-Cre Myo1f (f/f)) PbTII, Prr13-sufficient (Prr13 (f/f)) PbTII, and Prr13-deficient (CD4-Cre Prr13 (f/f)) PbTII mouse were used in the study. The expression of Lox 1 (L1), Lox 2 (L2), and Cre recombinase in the individual Myo1f or Prr13 conditional knockout mouse. (Ci & Ciii) The mouse 3 as Myo1f-deficient (CD4-Cre Myo1f (f/f)) PbTII mouse and mouse 4 as Myo1f-sufficient (Myo1f (f/f)) PbTII mouse were used in the study. (Cii & Ciii) The mouse 1 as Prr13-deficient (CD4-Cre Prr13 (f/f)) PbTII mouse and mouse 8 as Prr13-sufficient (Prr13 (f/f)) PbTII were used in the study. Positive control (PC) and negative control (NC) were also assessed together. The original gel results are provided in the Supporting information.
Prr13 is not required for effector or memory CD4+ T cell responses during experimental malaria
As a DNA-binding protein with transcriptional regulatory potential [30–35], we next hypothesized Prr13 promoted Th1/Tfh differentiation and transition to memory during PcAS infection. To test this, we transferred Prr13-deficient (CD4-Cre Prr13(f/f)) or Prr13-sufficient (Prr13(f/f)) PbTII cells into congenic recipient mice, and assessed splenic and hepatic responses at 7- and 28-days post-infection with anti-malarial drug treatment from day 7 p.i. to better facilitate memory transition over T-cell exhaustion (Fig 4A). Prr13-deficiency exerted no effect on the number of PbTIIs recovered from spleen or liver at either timepoint (Fig 4Bi-ii), nor in their expression of Th1/Tfh-associated chemokine receptors, CXCR6 and CXCR5 (Fig 4Ci-ii). Moreover, Prr13 was not required either for direct ex vivo expression of Th1-associated IFNγ or CCL5, or an in vitro restimulated Tr1 phenotype, assessed by co-expression of IFNγ and IL-10 (Fig 4Di-ii). Taken together, our data indicated that Prr13 is not necessary for Th1/Tfh/Tr1 differentiation during PcAS infection. By 4-weeks post-infection and treatment, PbTII cells and polyclonal CD4+ T cells exhibit GC Tfh (PD1hi CXCR5hi), Tfh/TCM-like (CXCR5+ PD1lo) or Th1-TEM (CXCR5lo CXCR6+) memory phenotypes in the spleen (Fig 1A) [11,15]. We noted Prr13 was required neither for the development of any of these cell-types (Fig 5Ai-ii), nor their capacity in the spleen or liver to produce IFNγ upon in vitro re-stimulation (Fig 5Bi-ii).These findings indicated that despite clear transcriptional up-regulation, Prr13 was not required for any aspect of the Plasmodium-specific CD4+ T cell response in this study.
[Figure omitted. See PDF.]
+ T cell responses during experimental malaria. (A) Schematic of experiment: congenically marked (CD45.2+) Prr13 (f/f) wild-type PbTIIs (WT) or CD4-Cre Prr13 (f/f) PbTIIs (KO) were adoptively transferred into Ly5.1 (CD45.1+) recipient mice at day -1 and infected with PcAS infection at day 0. Splenocytes and hepatocytes were analysed on day 7 and day 28 p.i. Mice underwent anti-malarial drug treatment from day 7 p.i. Created with Biorender.com. (Bi & Bii) Total number of PbTIIs per spleen and liver at day 7 and day 28 p.i. (Ci) Representative FACS plots of CXCR5 and CXCR6 expression. (Cii) Bar graphs showing frequencies of CXCR5+ and/or CXCR6+ PbTII and polyclonal CD4+ T cells in the WT and group in the spleen and liver at day 7 p.i. (Di) Representative FACS plots of direct ex vivo IFN-γ and CCL5 expression and of ex vivo stimulation-induced IFN-γ and IL-10 expression. (Dii) Bar graphs showing frequencies and/or the total number of IFN-γ+, IFN-γ+ CCL5+ , or IFN-γ+ IL-10+ Tr1 PbTII and polyclonal CD4+ T cells in WT and KO PbTII cells in the spleen and liver at day 7 p.i. Direct ex vivo was performed with intracellular staining with Brefeldin A (BFA), whereas ex vivo stimulation was conducted with the intracellular staining with BFA, PMA and ionomycin. (B-D) n = 5 per group, data are representative of two independent experiments. Statistical tests performed using unpaired, non-parametric Mann-Whitney t test; * p < 0.05.
[Figure omitted. See PDF.]
(A & B) Splenocytes and hepatocytes were analysed at day 28 p.i. from the same experiment in Fig 4A. (Ai) Representative FACS plots of direct ex vivo CXCR5 and PD-1 expression gating CXCR5+ PD-1+ GC Tfh and CXCR5+ Tfh/TCM in PbTII and polyclonal CD4+ T cells in the Prr13 (f/f) wild-type PbTIIs (WT) or CD4-Cre Prr13 (f/f) PbTIIs (KO) group in the spleen at 28 d.p.i. The population of CXCR5- cells were further gated into CXCR3 and CXCR6 expression to define CXCR5-CXCR3+ CXCR6+ Th1/TEM cells. (Aii) Bar graphs showing frequencies of CXCR5+ PD-1+ GC Tfh, CXCR5+ Tfh/TCM, and CXCR5-CXCR3+ CXCR6+ Th1/TEM cells. (Bi) Representative FACS plots of ex vivo stimulation-induced IFN-γ and CXCR6. (Bii) Bar graphs showing frequencies of IFN-γ+ or IFN-γ+ CXCR6+ PbTII and polyclonal CD4+ T cells in the WT and KO PbTII cells in the spleen and liver at day 28 p.i. (A & B) n = 5 per group, data are representative of two independent experiments. Statistical tests performed using unpaired, non-parametric Mann-Whitney t test; * p < 0.05.
Myo1f is not required for effector or memory CD4+ T cell responses during experimental malaria
Although Myo1f has been studied in innate immune cells [23–28], its function in conventional T cells remains unknown. Given its strong transcriptional upregulation in Th1 cells during both primary and secondary PcAS infection (Fig 1A-D), we next hypothesized that Myo1f controlled Th1 differentiation. To test this, congenic mice received Myo1f-deficient (CD4-Cre Myo1f (f/f)) or Myo1f-sufficient (Myo1f (f/f)) PbTII cells, were infected with PcAS, and assessed 7 days later for splenic and hepatic responses (Fig 6A). As for Prr13, we noted that Myo1f was not required for clonal expansion of PbTIIs (Fig 6Bi-ii), nor the upregulation of CXCR5/CXCR6 (Fig 6Ci-ii), nor direct ex vivo expression of Th1-associated IFNγ or Tbet (Fig 6Di-ii). Furthermore, Myo1f was not essential for in vitro Tr1 responses in the spleen or liver (Fig 6Ei-ii). Finally, given evidence Myo1f expression during secondary infection (Fig 1C and D), we tested for a role for this gene in Th1-recall 3-days after re-infection (Fig 7A). Although, PbTIIs had increased in number in the spleen, there was no evidence of a requirement for Myo1f in this process in spleen or liver (Fig 7Bi-ii). Similarly, upregulation of IFNγ or CXCR6 upon re-infection proceeded normally in the absence of Myo1f (Fig 7Ci-ii). Together, our data demonstrated that Myo1f is not required for Th1 differentiation or memory recall in experimental malaria.
[Figure omitted. See PDF.]
+ T cells. (A) Schematic of experiment: Congenically marked (CD45.2+) Myo1f (f/f) wild-type PbTIIs (WT) or CD4-Cre Myo1f (f/f) PbTIIs (KO) were adoptively transferred into Ly5.1 (CD45.1+) recipient mice infected with PcAS infection a day 0. Splenocytes and liver cells were analysed on day 7 p.i. Created with Biorender.com. (Bi & Bii) Total number of PbTII cells per spleen and liver at day 7 p.i. (Ci) Representative FACS plots of CXCR5 and CXCR6 expression. (Cii) Bar graphs showing frequencies of CXCR5+ and/or CXCR6+ PbTII and polyclonal CD4+ T cells in the WT or KO group in the spleen and liver at day 7 p.i. (Di) Representative FASC plots of direct ex vivo IFN-γ and Tbet expression. (Dii) Bar graphs showing frequencies of IFN-γ+ or IFN-γ+ Tbet+ PbTII and polyclonal CD4+ T cells in WT or KO group in the spleen and liver at day 7 p.i. (Ei) Representative FACS plots of IFN-γ and IL-10 expression. (Eii) Bar graphs showing frequencies of IFN-γ+ IL-10+ Tr1 PbTII and polyclonal CD4+ T cells in the WT or KO group in the spleen and liver at day 7 p.i. Cells were stimulated with PMA/Ionomycin/Brefeldin A (BFA) for 3 hours at 37°C, 5% CO2. (B-E) n = 5 per group, data are representative of two independent experiments. Statistical tests performed using unpaired, non-parametric Mann-Whitney t test; * p < 0.05.
[Figure omitted. See PDF.]
+T cells duringPcAS rechallenge. (A) Schematic of experiment: congenically marked (CD45.2+) Myo1f (f/f) wild-type PbTIIs (WT) or CD4-Cre Myo1f (f/f) PbTIIs (KO) were adoptively transferred into Ly5.1 (CD45.1+) recipient mice infected with PcAS infection a day 0. Mice were under the anti-malaria drug treatment from day 7 p.i. Mice were either rechallenged or non-rechallenged at day 28 p.i. 3 days later, the spleen and liver were harvested from rechallenge mice (Day 28+ 3) and non-rechallenge mice (Day 31). Created with Biorender.com. (Bi & Bii) Total number of PbTIIs per spleen and liver at day 28+ 3/day 31 p.i. (Ci) Representative FACS plots of direct ex vivo IFN-γ and CXCR6. (Cii) Bar graphs showing frequencies of IFN-γ+ or IFN-γ+ CXCR6+ in WT or KO PbTII cells in the spleen and liver at day 28+ 3/day 31 p.i. (B & C) n = 5-7 per group, data are pooled from two independent experiments. Statistical test performed using paired two-way ANOVA with Tukey’s multiple comparison test; * p < 0.05.
Discussion
In this study we mined existing scRNA-seq datasets derived from Plasmodium-specific TCR transgenic and polyclonal CD4+ T cells during experimental malaria for novel genes that might control effector and memory differentiation. Myo1f was chosen for further investigation due to its reported role in controlling motility and granule exocytosis in innate immune cells [23–28]. Prr13 was prioritized based on its reported role as transcriptional regulator [30–35]. To test these, we generated cell-specific gene-targeted mice and examined their gene function in vivo. Conclusions from our experiments are that neither of these genes, though strongly upregulated transcriptionally at various phases of effector and memory differentiation, play any role in CD4+ T cells during infection with blood-stage Plasmodium parasites. This contrasts with Maf, which we formally demonstrate here plays a critical role in Tfh differentiation in experimental malaria, consistent with observations in other experimental models.
In interpreting our negative results, a central issue is whether our gene targeting approach for Myo1f and Prr13 was performed correctly, since we were unable to screen for evidence of protein expression. PCR of genomic DNA from CD4-Cre Myo1f (f/f) or CD4-Cre Prr13 (f/f) indicated that exon excision had successfully occurred. However, whether unanticipated, truncated versions of these proteins retained some function remains untested. A further limitation of this study is that WT and KO PbTII cells could not be co-transferred into the same recipient mouse, as both cell types expressed CD45.2. Experiments were thus performed in separate small cohorts, which reduced statistical power. Future studies using congenic markers could enable direct comparisons within greater numbers of the same recipient mice.
Targeting Maf served two purposes in our study. Firstly, it allowed us to validate our approach for Plasmodium-specific CD4+ T cells. The approach was powerful since all other components of the immune system were left intact, allowing us to test for cell-intrinsic roles for Maf, Myo1f and Prr13. A caveat of our system was that functional consequences of Maf-deficiency on antibody production or infection outcome could not be tested. Moreover, our system lacked any capacity for time-dependent gene-deletion. In the future, inducible Cre systems could be employed, for example, to determine the role of Maf solely during the later stages of infection or during secondary infection. A second outcome of studying Maf is new information on the function of this cMaf in experimental malaria. A previous study had shown that Maf is required for Tr1 cells to express the immune-suppressive cytokine, interleukin-10, in malaria [39]. In addition, we had previously confirmed PbTIIs express cMaf protein during peak PcAS infection and retain this during transit to memory [11]. Given the dynamics of Maf expression in our model, along both Th1 and Tfh differentiation pathways, the emerging model is that cMaf is required for both Tfh and Tr1 differentiation in malaria. Future experiments are needed to determine possible roles for cMaf during repeated infections, which may be of importance given the frequency of infections experienced by children living in high transmission zones.
A broader question is why did predictions from transcriptional studies of Myo1f and Prr13 not hold true when tested in vivo. The fact that mRNA species are variously subjected to post-transcriptional regulation, and may not necessarily lead to protein production offers one likely explanation. Nevertheless, the power of transcriptomic studies remains not only that they provide a broad overview of cellular processes, but ultimately, that assist in hypothesis generation. Recently, based on the same scRNA-seq data, we hypothesized and validated roles for IL-2 signalling and the chemokine receptor, CCR5, in balancing Thf/Tfh differentiation in malaria [38]. Hence it is clear that some upregulated genes function in CD4+ T cells, while others do not; empiricism continues to be required to determine this on a case by case basis. Thus, in summary, we have discovered that cMaf is critical in experimental malaria for the early differentiation of Tfh cells, while Myo1f and Prr13 play no role in the biology of Plasmodium-specific CD4+ T cells during blood-stage infection.
Methods
Mice, genotyping, and phenotyping
Mice.
cMaf-sufficient (Maf (f/f)) PbTII and cMaf-deficient (CD4-Cre Maf (f/f)) PbTII mice were generated, and protein expression of cMaf was confirmed by flow cytometry (Fig 2D). To obtain mice harbouring a PbTII cells-specific conditional knockout of either Prr13 or Myo1f driven by CD4Cre recombinase, Prr13- and Myo1f-deficient PbTII strain were generated as illustrated in Fig 3A-C. Prr3 flox mouse with loxP sites flanking exon 3 and 4 of the Prr13 gene and Myo1f flox mouse with loxP sites flanking exon 2 and 4 of the Myo1f gene (Fig 3A) were generated and purchased from Walter+Eliza Hall Institute of Medical Research (Melbourne, Victoria, Australia). Both CD4Cre and PbTII mouse were bred in-house. To generate knockout mice, PbTII mice and Prr13 or Myo1f flox mice were crossed in-house. Alongside, Prr13 or Myo1f flox mice and CD4Cre mice were crossed. Their offspring were further crossed to generate Myo1f-sufficient (Myo1f (f/f)) PbTII, Myo1f-deficient (CD4-Cre Myo1f (f/f)) PbTII, Prr13-sufficient (Prr13 (f/f)) PbTII, and Prr13-deficient (CD4-Cre Prr13 (f/f)) PbTII mice. For donor mice, Ly5.1 (CD45.1) wild-type C57BL/6J mice were obtained from Ozgene/Animal Resources Centre (Western Australia). All animal experiments were conducted on female mice, aged 6-10 weeks, maintained under specific pathogen-free conditions at the Biological Research Facility of the Doherty Institute for Infection and Immunity (Melbourne, Victoria, Australia). Mice were monitored daily with criteria for humane euthanasia included severe weight loss (≥15% of initial body weight) and inability to eat or drink. Since anesthesia or analgesia was not required for our experimental protocol, all procedures were conducted to ensure minimal distress to the mice. All mice were euthanized via CO2 exposure at day 7 or day 31 post-infection for tissue collection. The animal experiments, handling, and procedures were approved by the University of Melbourne Animal Ethics Committee (Ethics numbers: SLA-1: 1915018 & 10376).
Genotyping.
Genotyping was performed from a small tissue biopsy of the ear using PCRs specific for the Cre transgene or the floxed region within the Prr13 and Myo1f gene. The following primers were used to detect Cre-wild type (wt) and transgene (Tg). Cre_wt_Fwd: CTAGGCCACAGAATTGAAAGATCT, Cre_wt_Rev: GTAGGTGGAAATTCTAGCATCATCC, Cre_Tg_Fwd: GCGGTCTGGCAGTAAAAACTATC, and Cre_Tg_Rev: GTGAAACAGCATTGCTGTCACTT. The thermocycler for the Cre detection by PCR was performed by initial denaturation at 94°C for 2 minutes, annealing with 35 cycles of 94°C for 30 seconds, 55°C for 15 seconds, 72°C for 1 minute and finally extension at 72°C for 5 minutes.
For the detection of floxed regions of Prr13 and Myo1f, the following primers were used. Prr13_flox1_Fwd: CAGGGAGAGGGAAATGAGACTT, Prr13_flox1_Rev: TTTTCTTTCCCGCATCCTCA, Prr13_flox2_Fwd: GTAACTTCCCTCACCCACCC, and Prr13_flox2_Rev: GGGCCATATGACCACTCAGT. Myo1f_flox1_Fwd: GGCCAAACTGACCTAGAGAG, Myo1f_flox1_Rev: TGAGTGCTGGGGTTAAAGGC, Myo1f_flox2_Fwd: ACCTGTAACTCTAGCATTGGGG, and Myo1f_flox2_Rev: CTGCCTTATTCCTTTGAGACAGG. The thermocycler for the Prr13 and Myo1f flox regions by PCR was performed by initial denaturation at 95°C for 2 minutes, annealing with 35 cycles of 95°C for 30 seconds, 58°C for Prr13 floxed or 60°C for Myo1f floxed for 15 seconds, 72°C for 30 seconds and finally extension at 72°C for 5 minutes. All primers were purchased from Sigma-Aldrich.
Phenotyping.
To determine PbTII cell phenotype from the mice, the expression of CD4, TCRVα2, TCRVβ12 were analysed by flow cytometry. The drops of blood from the mice were lysed with Pharm Lyse (BD) and washed twice with PBS. Subsequently, cells were stained with the antibody cocktail constraining anti-CD4, anti-TCRVα2, and anti-TCRVβ12 antibody for 30 minutes on ice in the dark. Following cell wash twice with PBS, the phenotype of cells was checked using Fortessa cytometer (BD). Data was analysed using FlowJo software (v.10.10).
PbTII cell adoptive transfer, infection, and anti-malaria drug treatment
PbTII cell adoptive transfer.
Naïve spleens from cMaf-sufficient (Maf (f/f)) PbTII, cMaf-deficient (CD4-Cre Maf (f/f)) PbTII, Myo1f-deficient (CD4-Cre Myo1f (f/f)) PbTII, Prr13-sufficient (Prr13 (f/f)) PbTII, Prr13-deficient (CD4-Cre Prr13 (f/f)) PbTII mouse were harvested and homogenised through 70-100 µm cell strainers. The red blood cells (RBCs) were lysed using Pharm Lyse (BD) and CD4+ PbTII cells were enriched using CD4 microbeads (L3T4, Miltenyi Biotec). The puritywas determined by flow cytometry and ranged between 85% and 90%. Each donor mouse received 104 PbTII cells via lateral tail vein injection.
Infection.
Thawed PcAS infected blood from our biobank were used to infect C57BL/6J passage mice. PcAS-infected RBCs (pRBCs) were obtained from the passage mice and processed to infect recipient mouse via lateral tail vein injection. 105 pRBCs were injected for primary infection, whereas 107 pRBCs were injected for re-infection.
Parasitemia assessment.
A drop of blood was collected from the tail vein of mice into RPMI containing 5 U/mL of heparin. Diluted blood samples were stained with Hoechst 33342 (10 µg/mL; Sigma-Aldrich) and Syto84 (5 µ M; Life Technologies) for 30 minutes at room temperature in the dark. The staining was quenched with 10 times the initial volume using cold RPMI. Immediately, the percentage of Syto84+ Hoechst33342+ RBCs was determined using Fortessa cytometer (BD Biosciences).
Anti-malaria drug treatment.
Artesunate (Guilin Pharmaceutical, generously provided by J. Mohrle) was dissolved in a 5% sodium bicarbonate solution at a concentration of 50 mg/mL to create sodium artesunate and then diluted in 0.9% saline (Baxter) to reach a final concentration of 5 mg/mL. Mice were administered intraperitoneal injections of 1 mg of sodium artesunate twice daily from day 7 to day 9, once daily from day 10 to day 16, and twice weekly from day 17 to day 24 post-infection. Additionally, mice received pyrimethamine in their drinking water (70 mg/L, Sigma Aldrich) from day 7 until day 24 post-infection.
Flow cytometry
Spleens were harvested into ice-cold RPMI and homogenized through 70/100µm cell strainers to create single-cell suspensions, followed by RBC lysis using Pharm Lyse (BD). Cells were then stained with Zombie Yellow viability dye (Biolegend) diluted in PBS, followed by Fc receptor block (BD). Finally, cells were stained with titrated panels of surface monoclonal antibodies (Table 1) diluted in PBS containing 2% FCS and 2 mM EDTA, where samples were incubated for 20 minutes on ice in the dark.
[Figure omitted. See PDF.]
For intracellular staining, cells were incubated with brefeldin-A (10 mg/mL; Sigma) with or without PMA (1 mg/mL; Sigma) and ionomycin (1 mg/mL; Sigma) at 37°C for 3h. After incubation, Foxp3/ Transcription Factor Staining Buffer Set (eBiosciences) or BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD) was used to fix and permeabilise cells prior to staining with panels of monoclonal antibodies (Table 1) for 30-90 minutes on ice in the dark. Finally, cells were washed and acquired on Fortessa cytometer (BD). The gating strategy was indicated in Fig 2C, and all data was analysed using FlowJo (v.10.10).
Statistical analysis
Statistical analyses were performed using Prism (v10.2.3 GraphPad Software, Boston, Massachusetts, USA) and tests were performed using either an unpaired, non-parametric Mann-Whitney t test or paired two-way ANOVA with Tukey’s multiple comparison test. P value < 0.05 was considered significant.
Supporting information
S1 Fig. Raw gel images.
https://doi.org/10.1371/journal.pone.0320375.s001
(TIF)
References
1. 1. WHO. World malaria report 2023, in WHO. 2023.
2. 2. da Silva HB, Fonseca R, Cassado ADA, de Salles ÉM, de Menezes MN, Langhorne J, et al. In vivo approaches reveal a key role for DCs in CD4+ T cell activation and parasite clearance during the acute phase of experimental blood-stage malaria. PLoS Pathog. 2015;11(2):e1004598. pmid:25658925
* View Article
* PubMed/NCBI
* Google Scholar
3. 3. Kurup SP, Butler NS, Harty JT. T cell-mediated immunity to malaria. Nat Rev Immunol. 2019;19(7):457–71. pmid:30940932
* View Article
* PubMed/NCBI
* Google Scholar
4. 4. Su Z, Stevenson MM. Central role of endogenous gamma interferon in protective immunity against blood-stage plasmodium chabaudi AS infection. Infect Immun. 2000;68(8):4399–406. pmid:10899836
* View Article
* PubMed/NCBI
* Google Scholar
5. 5. Jacobs P, Radzioch D, Stevenson MM. In vivo regulation of nitric oxide production by tumor necrosis factor alpha and gamma interferon, but not by interleukin-4, during blood stage malaria in mice. Infect Immun. 1996;64(1):44–9. pmid:8557372
* View Article
* PubMed/NCBI
* Google Scholar
6. 6. Pérez-Mazliah D, Nguyen MP, Hosking C, McLaughlin S, Lewis MD, Tumwine I, et al. Follicular helper T cells are essential for the elimination of plasmodium infection. EBioMedicine. 2017;24:216–30. pmid:28888925
* View Article
* PubMed/NCBI
* Google Scholar
7. 7. Figueiredo MM, Costa PAC, Diniz SQ, Henriques PM, Kano FS, Tada MS, et al. T follicular helper cells regulate the activation of B lymphocytes and antibody production during plasmodium vivax infection. PLoS Pathog. 2017;13(7):e1006484. pmid:28700710
* View Article
* PubMed/NCBI
* Google Scholar
8. 8. Roncarolo MG, Gregori S, Bacchetta R, Battaglia M, Gagliani N. The biology of T regulatory type 1 cells and their therapeutic application in immune-mediated diseases. Immunity. 2018;49(6):1004–19. pmid:30566879
* View Article
* PubMed/NCBI
* Google Scholar
9. 9. Montes de Oca M, Kumar R, de Labastida Rivera F, Amante FH, Sheel M, Faleiro RJ, et al. Blimp-1-dependent IL-10 production by Tr1 cells regulates TNF-mediated tissue pathology. PLoS Pathog. 2016;12(1):e1005398. pmid:26765224
* View Article
* PubMed/NCBI
* Google Scholar
10. 10. Couper KN, Blount DG, Wilson MS, Hafalla JC, Belkaid Y, Kamanaka M, et al. IL-10 from CD4CD25Foxp3CD127 adaptive regulatory T cells modulates parasite clearance and pathology during malaria infection. PLoS Pathog. 2008;4(2):e1000004. pmid:18401464
* View Article
* PubMed/NCBI
* Google Scholar
11. 11. Soon MSF, et al. Transcriptome dynamics of CD4(+) T cells during malaria maps gradual transit from effector to memory. Nature Immunology. 2020;21(12):1597–610.
* View Article
* Google Scholar
12. 12. Edwards CL, et al. IL-10-producing Th1 cells possess a distinct molecular signature in malaria. J Clin Invest. 2023;133(1).
* View Article
* Google Scholar
13. 13. Enders MH, et al. Plasmodium berghei Hsp90 contains a natural immunogenic I-A(b)-restricted antigen common to rodent and human plasmodium species. Curr Res Immunol.2021;2:79–92.
* View Article
* Google Scholar
14. 14. Lönnberg T, Svensson V, James KR, Fernandez-Ruiz D, Sebina I, Montandon R, et al. Single-cell RNA-seq and computational analysis using temporal mixture modelling resolves Th1/Tfh fate bifurcation in malaria. Sci Immunol. 2017;2(9):eaal2192. pmid:28345074
* View Article
* PubMed/NCBI
* Google Scholar
15. 15. Lee HJ, Moreira ML, Li S, Asatsuma T, Williams CG, Skinner OP, et al. CD4+ T cells display a spectrum of recall dynamics during re-infection with malaria parasites. Nat Commun. 2024;15(1):5497. pmid:38944658
* View Article
* PubMed/NCBI
* Google Scholar
16. 16. Andris F, Denanglaire S, Anciaux M, Hercor M, Hussein H, Leo O. The transcription factor c-Maf promotes the differentiation of follicular helper T cells. Front Immunol. 2017;8:480. pmid:28496444
* View Article
* PubMed/NCBI
* Google Scholar
17. 17. Bauquet AT, Jin H, Paterson AM, Mitsdoerffer M, Ho I-C, Sharpe AH, et al. The costimulatory molecule ICOS regulates the expression of c-Maf and IL-21 in the development of follicular T helper cells and TH-17 cells. Nat Immunol. 2009;10(2):167–75. pmid:19098919
* View Article
* PubMed/NCBI
* Google Scholar
18. 18. Minozzo F, Rassier DE, Myosin Family Classification, in Encyclopedia of Biophysics, Roberts GCK, Editor. Springer Berlin Heidelberg: Berlin, Heidelberg. 2013, p. 1658–63.
19. 19. Foth BJ, Goedecke MC, Soldati D. New insights into myosin evolution and classification. Proc Natl Acad Sci U S A. 2006;103(10):3681–6. pmid:16505385
* View Article
* PubMed/NCBI
* Google Scholar
20. 20. Navinés-Ferrer A, Martín M. Long-tailed unconventional class I myosins in health and disease. Int J Mol Sci. 2020;21(7):2555. pmid:32272642
* View Article
* PubMed/NCBI
* Google Scholar
21. 21. Vadillo E, et al. Intermittent rolling is a defect of the extravasation cascade caused by myosin1e-deficiency in neutrophils. Proc Natl Acad Sci U S A. 2019;116(52):26752–8.
* View Article
* Google Scholar
22. 22. Sun W, et al. MYO1F regulates antifungal immunity by regulating acetylation of microtubules. Proc Natl Acad Sci U S A. 2021;118(30):e2101238118.
* View Article
* Google Scholar
23. 23. Kim SV, Mehal WZ, Dong X, Heinrich V, Pypaert M, Mellman I, et al. Modulation of cell adhesion and motility in the immune system by Myo1f. Science. 2006;314(5796):136–9. pmid:17023661
* View Article
* PubMed/NCBI
* Google Scholar
24. 24. Salvermoser M, Pick R, Weckbach LT, Zehrer A, Löhr P, Drechsler M, et al. Myosin 1f is specifically required for neutrophil migration in 3D environments during acute inflammation. Blood. 2018;131(17):1887–98. pmid:29487067
* View Article
* PubMed/NCBI
* Google Scholar
25. 25. Navinés-Ferrer A, et al. Myo1f, an unconventional long-tailed myosin, is a new partner for the adaptor 3BP2 involved in mast cell migration. Front Immuno. 2019;10(1058).
* View Article
* Google Scholar
26. 26. Martínez-Vargas IU, Sánchez-Bello ME, Miguel-Rodríguez CE, Hernández-Cázares F, Santos-Argumedo L, Talamás-Rohana P. Myo1f has an essential role in γδT intraepithelial lymphocyte adhesion and migration. Front Immunol. 2023;14:1041079. pmid:37207213
* View Article
* PubMed/NCBI
* Google Scholar
27. 27. Navinés-Ferrer A, Ainsua-Enrich E, Serrano-Candelas E, Proaño-Pérez E, Muñoz-Cano R, Gastaminza G, et al. Myo1f regulates IgE and MRGPRX2-dependent mast cell exocytosis. J Immunol. 2021;206(10):2277–89. pmid:33941653
* View Article
* PubMed/NCBI
* Google Scholar
28. 28. Barger SR, Reilly NS, Shutova MS, Li Q, Maiuri P, Heddleston JM, et al. Membrane-cytoskeletal crosstalk mediated by myosin-I regulates adhesion turnover during phagocytosis. Nat Commun. 2019;10(1):1249. pmid:30890704
* View Article
* PubMed/NCBI
* Google Scholar
29. 29. McConnell RE, Tyska MJ. Leveraging the membrane – Cytoskeleton interface with myosin-1. Trends Cell Biol. 2010;20(7):418–26. pmid:20471271
* View Article
* PubMed/NCBI
* Google Scholar
30. 30. Pontikakis S, Papadaki C, Tzardi M, Trypaki M, Sfakianaki M, Koinis F, et al. Predictive value of ATP7b, BRCA1, BRCA2, PARP1, UIMC1 (RAP80), HOXA9, DAXX, TXN (TRX1), THBS1 (TSP1) and PRR13 (TXR1) genes in patients with epithelial ovarian cancer who received platinum-taxane first-line therapy. Pharmacogenomics J. 2017;17(6):506–14. pmid:27779244
* View Article
* PubMed/NCBI
* Google Scholar
31. 31. Papadaki C, Mavroudis D, Trypaki M, Koutsopoulos A, Stathopoulos E, Hatzidaki D, et al. Tumoral expression of TXR1 and TSP1 predicts overall survival of patients with lung adenocarcinoma treated with first-line docetaxel-gemcitabine regimen. Clin Cancer Res. 2009;15(11):3827–33. pmid:19435835
* View Article
* PubMed/NCBI
* Google Scholar
32. 32. Bi J, Bai Z, Ma X, Song J, Guo Y, Zhao J, et al. Txr1: An important factor in oxaliplatin resistance in gastric cancer. Med Oncol. 2014;31(2):807. pmid:24362794
* View Article
* PubMed/NCBI
* Google Scholar
33. 33. Papadaki C, Tsaroucha E, Kaklamanis L, Lagoudaki E, Trypaki M, Tryfonidis K, et al. Correlation of BRCA1, TXR1 and TSP1 mRNA expression with treatment outcome to docetaxel-based first-line chemotherapy in patients with advanced/metastatic non-small-cell lung cancer. Br J Cancer. 2011;104(2):316–23. pmid:21157449
* View Article
* PubMed/NCBI
* Google Scholar
34. 34. Lih C-J, Wei W, Cohen SN. Txr1: A transcriptional regulator of thrombospondin-1 that modulates cellular sensitivity to taxanes. Genes Dev. 2006;20(15):2082–95. pmid:16847352
* View Article
* PubMed/NCBI
* Google Scholar
35. 35. van Amerongen R, Berns A. TXR1-mediated thrombospondin repression: A novel mechanism of resistance to taxanes?. Genes Dev. 2006;20(15):1975–81. pmid:16882973
* View Article
* PubMed/NCBI
* Google Scholar
36. 36. Mateo V, Lagneaux L, Bron D, Biron G, Armant M, Delespesse G, et al. CD47 ligation induces caspase-independent cell death in chronic lymphocytic leukemia. Nat Med. 1999;5(11):1277–84. pmid:10545994
* View Article
* PubMed/NCBI
* Google Scholar
37. 37. Saumet A, Slimane MB, Lanotte M, Lawler J, Dubernard V. Type 3 repeat/C-terminal domain of thrombospondin-1 triggers caspase-independent cell death through CD47/alphavbeta3 in promyelocytic leukemia NB4 cells. Blood. 2005;106(2):658–67. pmid:15784731
* View Article
* PubMed/NCBI
* Google Scholar
38. 38. Williams CG. Plasmodium infection induces phenotypic, clonal, and spatial diversity among differentiating CD4(+) T cells. Cell Rep, 2024. 43(6):114317.
* View Article
* Google Scholar
39. 39. Gabryšová L, Alvarez-Martinez M, Luisier R, Cox LS, Sodenkamp J, Hosking C, et al. c-Maf controls immune responses by regulating disease-specific gene networks and repressing IL-2 in CD4+ T cells. Nat Immunol. 2018;19(5):497–507. pmid:29662170
* View Article
* PubMed/NCBI
* Google Scholar
Citation: Asatsuma T, Moreira ML, Lee HJ, Wanrooy BJ, Skinner OP, Li S, et al. (2025) Myosin 1f and Proline-rich 13 are transcriptionally upregulated yet functionally redundant in CD4+ T cells during blood-stage Plasmodium infection. PLoS ONE 20(3): e0320375. https://doi.org/10.1371/journal.pone.0320375
About the Authors:
Takahiro Asatsuma
Roles: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Validation, Visualization, Writing – original draft
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Marcela L. Moreira
Roles: Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Project administration, Writing – original draft
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Hyun J. Lee
Roles: Formal analysis, Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Brooke J. Wanrooy
Roles: Writing – review & editing
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Oliver P. Skinner
Roles: Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Shihan Li
Roles: Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Ivana Rea
Roles: Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Taidhgin Harkin
Roles: Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Saba Asad
Roles: Investigation
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Cameron G. Williams
Roles: Formal analysis
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Lynette Beattie
Roles: Supervision
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
Ashraful Haque
Roles: Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review & editing
E-mail: [email protected]
Affiliation: Department of Microbiology and Immunology, University of Melbourne, The Peter Doherty Institute for Infection and Immunity, Parkville, Victoria, Australia
ORICD: https://orcid.org/0000-0003-2260-0026
[/RAW_REF_TEXT]
[/RAW_REF_TEXT]
1. WHO. World malaria report 2023, in WHO. 2023.
2. da Silva HB, Fonseca R, Cassado ADA, de Salles ÉM, de Menezes MN, Langhorne J, et al. In vivo approaches reveal a key role for DCs in CD4+ T cell activation and parasite clearance during the acute phase of experimental blood-stage malaria. PLoS Pathog. 2015;11(2):e1004598. pmid:25658925
3. Kurup SP, Butler NS, Harty JT. T cell-mediated immunity to malaria. Nat Rev Immunol. 2019;19(7):457–71. pmid:30940932
4. Su Z, Stevenson MM. Central role of endogenous gamma interferon in protective immunity against blood-stage plasmodium chabaudi AS infection. Infect Immun. 2000;68(8):4399–406. pmid:10899836
5. Jacobs P, Radzioch D, Stevenson MM. In vivo regulation of nitric oxide production by tumor necrosis factor alpha and gamma interferon, but not by interleukin-4, during blood stage malaria in mice. Infect Immun. 1996;64(1):44–9. pmid:8557372
6. Pérez-Mazliah D, Nguyen MP, Hosking C, McLaughlin S, Lewis MD, Tumwine I, et al. Follicular helper T cells are essential for the elimination of plasmodium infection. EBioMedicine. 2017;24:216–30. pmid:28888925
7. Figueiredo MM, Costa PAC, Diniz SQ, Henriques PM, Kano FS, Tada MS, et al. T follicular helper cells regulate the activation of B lymphocytes and antibody production during plasmodium vivax infection. PLoS Pathog. 2017;13(7):e1006484. pmid:28700710
8. Roncarolo MG, Gregori S, Bacchetta R, Battaglia M, Gagliani N. The biology of T regulatory type 1 cells and their therapeutic application in immune-mediated diseases. Immunity. 2018;49(6):1004–19. pmid:30566879
9. Montes de Oca M, Kumar R, de Labastida Rivera F, Amante FH, Sheel M, Faleiro RJ, et al. Blimp-1-dependent IL-10 production by Tr1 cells regulates TNF-mediated tissue pathology. PLoS Pathog. 2016;12(1):e1005398. pmid:26765224
10. Couper KN, Blount DG, Wilson MS, Hafalla JC, Belkaid Y, Kamanaka M, et al. IL-10 from CD4CD25Foxp3CD127 adaptive regulatory T cells modulates parasite clearance and pathology during malaria infection. PLoS Pathog. 2008;4(2):e1000004. pmid:18401464
11. Soon MSF, et al. Transcriptome dynamics of CD4(+) T cells during malaria maps gradual transit from effector to memory. Nature Immunology. 2020;21(12):1597–610.
12. Edwards CL, et al. IL-10-producing Th1 cells possess a distinct molecular signature in malaria. J Clin Invest. 2023;133(1).
13. Enders MH, et al. Plasmodium berghei Hsp90 contains a natural immunogenic I-A(b)-restricted antigen common to rodent and human plasmodium species. Curr Res Immunol.2021;2:79–92.
14. Lönnberg T, Svensson V, James KR, Fernandez-Ruiz D, Sebina I, Montandon R, et al. Single-cell RNA-seq and computational analysis using temporal mixture modelling resolves Th1/Tfh fate bifurcation in malaria. Sci Immunol. 2017;2(9):eaal2192. pmid:28345074
15. Lee HJ, Moreira ML, Li S, Asatsuma T, Williams CG, Skinner OP, et al. CD4+ T cells display a spectrum of recall dynamics during re-infection with malaria parasites. Nat Commun. 2024;15(1):5497. pmid:38944658
16. Andris F, Denanglaire S, Anciaux M, Hercor M, Hussein H, Leo O. The transcription factor c-Maf promotes the differentiation of follicular helper T cells. Front Immunol. 2017;8:480. pmid:28496444
17. Bauquet AT, Jin H, Paterson AM, Mitsdoerffer M, Ho I-C, Sharpe AH, et al. The costimulatory molecule ICOS regulates the expression of c-Maf and IL-21 in the development of follicular T helper cells and TH-17 cells. Nat Immunol. 2009;10(2):167–75. pmid:19098919
18. Minozzo F, Rassier DE, Myosin Family Classification, in Encyclopedia of Biophysics, Roberts GCK, Editor. Springer Berlin Heidelberg: Berlin, Heidelberg. 2013, p. 1658–63.
19. Foth BJ, Goedecke MC, Soldati D. New insights into myosin evolution and classification. Proc Natl Acad Sci U S A. 2006;103(10):3681–6. pmid:16505385
20. Navinés-Ferrer A, Martín M. Long-tailed unconventional class I myosins in health and disease. Int J Mol Sci. 2020;21(7):2555. pmid:32272642
21. Vadillo E, et al. Intermittent rolling is a defect of the extravasation cascade caused by myosin1e-deficiency in neutrophils. Proc Natl Acad Sci U S A. 2019;116(52):26752–8.
22. Sun W, et al. MYO1F regulates antifungal immunity by regulating acetylation of microtubules. Proc Natl Acad Sci U S A. 2021;118(30):e2101238118.
23. Kim SV, Mehal WZ, Dong X, Heinrich V, Pypaert M, Mellman I, et al. Modulation of cell adhesion and motility in the immune system by Myo1f. Science. 2006;314(5796):136–9. pmid:17023661
24. Salvermoser M, Pick R, Weckbach LT, Zehrer A, Löhr P, Drechsler M, et al. Myosin 1f is specifically required for neutrophil migration in 3D environments during acute inflammation. Blood. 2018;131(17):1887–98. pmid:29487067
25. Navinés-Ferrer A, et al. Myo1f, an unconventional long-tailed myosin, is a new partner for the adaptor 3BP2 involved in mast cell migration. Front Immuno. 2019;10(1058).
26. Martínez-Vargas IU, Sánchez-Bello ME, Miguel-Rodríguez CE, Hernández-Cázares F, Santos-Argumedo L, Talamás-Rohana P. Myo1f has an essential role in γδT intraepithelial lymphocyte adhesion and migration. Front Immunol. 2023;14:1041079. pmid:37207213
27. Navinés-Ferrer A, Ainsua-Enrich E, Serrano-Candelas E, Proaño-Pérez E, Muñoz-Cano R, Gastaminza G, et al. Myo1f regulates IgE and MRGPRX2-dependent mast cell exocytosis. J Immunol. 2021;206(10):2277–89. pmid:33941653
28. Barger SR, Reilly NS, Shutova MS, Li Q, Maiuri P, Heddleston JM, et al. Membrane-cytoskeletal crosstalk mediated by myosin-I regulates adhesion turnover during phagocytosis. Nat Commun. 2019;10(1):1249. pmid:30890704
29. McConnell RE, Tyska MJ. Leveraging the membrane – Cytoskeleton interface with myosin-1. Trends Cell Biol. 2010;20(7):418–26. pmid:20471271
30. Pontikakis S, Papadaki C, Tzardi M, Trypaki M, Sfakianaki M, Koinis F, et al. Predictive value of ATP7b, BRCA1, BRCA2, PARP1, UIMC1 (RAP80), HOXA9, DAXX, TXN (TRX1), THBS1 (TSP1) and PRR13 (TXR1) genes in patients with epithelial ovarian cancer who received platinum-taxane first-line therapy. Pharmacogenomics J. 2017;17(6):506–14. pmid:27779244
31. Papadaki C, Mavroudis D, Trypaki M, Koutsopoulos A, Stathopoulos E, Hatzidaki D, et al. Tumoral expression of TXR1 and TSP1 predicts overall survival of patients with lung adenocarcinoma treated with first-line docetaxel-gemcitabine regimen. Clin Cancer Res. 2009;15(11):3827–33. pmid:19435835
32. Bi J, Bai Z, Ma X, Song J, Guo Y, Zhao J, et al. Txr1: An important factor in oxaliplatin resistance in gastric cancer. Med Oncol. 2014;31(2):807. pmid:24362794
33. Papadaki C, Tsaroucha E, Kaklamanis L, Lagoudaki E, Trypaki M, Tryfonidis K, et al. Correlation of BRCA1, TXR1 and TSP1 mRNA expression with treatment outcome to docetaxel-based first-line chemotherapy in patients with advanced/metastatic non-small-cell lung cancer. Br J Cancer. 2011;104(2):316–23. pmid:21157449
34. Lih C-J, Wei W, Cohen SN. Txr1: A transcriptional regulator of thrombospondin-1 that modulates cellular sensitivity to taxanes. Genes Dev. 2006;20(15):2082–95. pmid:16847352
35. van Amerongen R, Berns A. TXR1-mediated thrombospondin repression: A novel mechanism of resistance to taxanes?. Genes Dev. 2006;20(15):1975–81. pmid:16882973
36. Mateo V, Lagneaux L, Bron D, Biron G, Armant M, Delespesse G, et al. CD47 ligation induces caspase-independent cell death in chronic lymphocytic leukemia. Nat Med. 1999;5(11):1277–84. pmid:10545994
37. Saumet A, Slimane MB, Lanotte M, Lawler J, Dubernard V. Type 3 repeat/C-terminal domain of thrombospondin-1 triggers caspase-independent cell death through CD47/alphavbeta3 in promyelocytic leukemia NB4 cells. Blood. 2005;106(2):658–67. pmid:15784731
38. Williams CG. Plasmodium infection induces phenotypic, clonal, and spatial diversity among differentiating CD4(+) T cells. Cell Rep, 2024. 43(6):114317.
39. Gabryšová L, Alvarez-Martinez M, Luisier R, Cox LS, Sodenkamp J, Hosking C, et al. c-Maf controls immune responses by regulating disease-specific gene networks and repressing IL-2 in CD4+ T cells. Nat Immunol. 2018;19(5):497–507. pmid:29662170
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2025 Asatsuma et al. This is an open access article distributed under the terms of the Creative Commons Attribution License: http://creativecommons.org/licenses/by/4.0/ (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Plasmodium-specific CD4+ T cells differentiate into effector and memory subsets during experimental malaria, via mechanisms that remain incompletely characterised. By mining scRNA-seq data of CD4+ T cells during Plasmodium chabaudi chabaudi AS infection in mice, we identified two genes previously uncharacterised in T helper cells, long-tailed unconventional myosin 1f (Myo1f) and proline-rich13/taxanes-resistance 1 (Prr13/Txr1), which were upregulated during effector and memory differentiation. Myo1f is reported to regulate motility and granule exocytosis in myeloid and γδ T cells. Prr13/Txr1 is reported to transcriptionally regulate sensitivity to anti-cancer drugs. To test for cell-intrinsic gene function, we generated Plasmodium-specific TCR transgenic, PbTII cells harbouring CD4-promoter driven Cre recombinase and target genes with loxP-flanked essential exons. We validated our approach for the transcription factor Maf, formally demonstrating here that cMaf is essential for T follicular helper (Tfh) cell differentiation in experimental malaria. Next, having generated conditional knockout lines for Myo1f and Prr13, we observed that deficiency in Myo1f or Prr13 had no impact on either clonal expansion, Th1/Tfh differentiation or transit to memory. Additionally, despite continued expression during re-infection, Myo1f was unnecessary for Th1 recall in vivo. Thus, while cMaf is critical for Tfh differentiation in experimental malaria, Myo1f and Prr13, although transcriptionally upregulated, are unnecessary for effector or memory CD4+ T cell responses.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer