Identification and Validation of Genus/Species-Specific Short InDels in Dairy Ruminants

Abstract

Background

Over the past thirty years, the identification of species-specific molecular markers has significantly advanced our understanding of genetic diversity in both plants and animals. Among these, short InDels have emerged as vital genomic features, contributing more to sequence divergence than single nucleotide polymorphisms do in closely related species. This study aimed to identify specific InDels for Bos taurus, Bubalus bubalis, Capra hircus, and Ovis aries via an in silico approach and validated them in 400 individuals (100 for each species).

Results

We identified and characterized short, specific InDels in the sequences of the CSN1S1, CSN1S2, MSTN, and PRLR genes, which can be used for species identification of Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively. We developed a Tetraplex Specific PCR assay to enable efficient discrimination among these species.

Conclusions

This study highlights the utility of InDels as biallelic, codominant markers that are cost-effective and easy to analyse, providing valuable tools for genetic diversity analysis and species identification.

Introduction

In the past three decades, a wide range of molecular markers have been successfully developed for both plants and animals. Among these, the most common include Short Tandem Repeat Polymorphisms (STRP), Variable Number Tandem Repeats (VNTR), Restriction Fragment Length Polymorphism (RFLPs) or Amplified Fragment Length Polymorphisms (AFLPs), Randomly Amplified Polymorphic DNAs (RAPDs) or Inter-simple sequence repeats (ISSRs) and Inter-retrotransposon Amplified Polymorphisms (IRAPs), Allele Specific Associated Primers (ASAPs), Single Nucleotide Polymorphisms (SNPs), and polymorphic INsertions and DELetions (InDels). The last ones are gain or loss of nucleotides in a single locus and are the most frequent polymorphisms in mammalian genomes after SNPs [1]. They are classified as short InDels when fewer than 50 nucleotides are involved and long InDels when more than 50 nucleotides are involved [2]. In humans, it is estimated that there is one short InDel every eight nucleotides [1]. However, InDels contribute more to sequence divergence than do SNPs in terms of base differences [2]. With respect to selective pressures on InDels, deletions consistently segregate at lower frequencies than insertions do, both within genes and across the genome. This has been interpreted as evidence of a stronger purifying selection acting on deletions. A possible mechanistic explanation is that deletions have two breakpoints, rather than just one for insertions, making them more likely to disrupt important motifs [2].

Short InDels have been implicated in various genomic evolutionary processes, such as the evolution of genome size, and may play a key role in maintaining optimal intron size [2]. Furthermore, short InDels are more strongly affected by purifying selection and less affected by positive selection than are SNPs. No significant differences have been observed in the impact of balancing or divergent selection between short InDels and SNPs, as both are similarly distributed across the genome and likely respond to indirect selection in the same way. However, a few genomic regions affected by divergent selection were detected by InDels but not by SNPs [3]. In recent years, interest in identifying, mapping, and functionally analysing InDels has increased, as they are useful for studying evolutionary processes, detecting genomic signatures of selection, serving as genetic markers for quantitative trait loci (QTL) mapping, for association studies with economically important traits (Marker-Assisted Selection, MAS), and for disease studies [4, 5]. In most cases, these markers are dimorphic intraspecies InDels (Non-Species-Specific indels, NSS) and are mainly used in association studies with traits of interest [6,7,8,9,10,11,12,13,14]. In contrast, species-specific InDels in ruminants (Target Species-Specific InDels, TSS), have rarely been identified [15], likely due to difficulties in sequence allignment.

This study aimed to (a) identify specific InDels for domestic cattle (Bos taurus), river buffalo (Bubalus bubalis), goats (Capra hircus), and sheep (Ovis aries) using an in silico approach and develop polymerase chain reaction (PCR)-based InDel markers; (b) validate the species specificity of the identified InDel markers; and (c) set up a Tetraplex Specific PCR (TetraS-PCR) assay for the discrimination of these four species in biological samples.

Materials and methods

Samples

DNA from 400 individuals representing four species from four different genera: Bubalus, Bos, Ovis, and Capra has been analysed. The samples were distributed as follows: 100 samples from Bubalus bubalis (Mediterranean Italian River Buffalo breed), 100 from Bos taurus (30 Agerolese 20 Piemontese, 25 Podolica, and 25 Bruna cattle), 100 from Capra hircus (25 Napoletana, 20 Sarda, 20 Garganica, 20 Alpine, and 15 Maltese goats), and 100 from Ovis aries (30 Laticauda, 30 Sarda, and 40 Bagnolese sheep). All the animals were reared in Italy.

The DNA concentration and optical density (260/280 ratio) of each sample were estimated via a Nanodrop ND-2000C Spectrophotometer (Thermo Scientific, Waltham, MA, USA). The A260/A280 ratios for all the DNA samples ranged between 1.8 and 1.96.

Bioinformatics, sequence analysis and multiple sequence alignment

To identify specific InDels the genomic sequences of all Artiodactyla and Perissodactyla species available in GenBank were aligned for genes associated with milk and meat traits which are highly conserved across species due to their fundamental role. Homology searches, comparisons of nucleotide sequences among genes, and multiple alignments for InDels discovery were accomplished via NCBI-BLASTN version 2.2.5 [16]. Finally, an extensive literature review was conducted.

Allele-specific (AS) primer design and single AS‒PCR amplification conditions for InDels identification

αS1-casein (CSN1S1), αS2-casein (CSN1S2), Myostatin (MSTN) and Prolactin receptor (PRLR) were selected as target genes for Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively.

An AS‒PCR mixture with a final volume of 25 μL was prepared for each gene (MSTN, CSN1S1, and CSN1S2) by mixing 100 ng of genomic DNA, 1 × Green GoTaq1 Flexi Buffer, 1.5 mM MgCl2, 200 μM each dNTP, 10 pmol of each primer, and 1 U of GoTaq® G2 Flexi DNA Polymerase (Promega–Madison, Fitchburg, WI, USA). The thermal protocol included a first cycle of denaturation at 97 °C for 2 min, annealing at 58 °C (59 °C for the Ovis aries CSN1S1-specific amplification) for 45 s and extension at 72 °C for 1 min. This was followed by 35 cycles of denaturation at 97 °C for 45 s, annealing at 58 °C (59 °C) for 45 s, and extension at 72 °C for 1 min. A final cycle was performed at 97 °C for 45 s and 58 °C (59 °C) for 45 and 72 °C for 5 min to complete the reaction.

InDel detection at the PRLR locus was carried out according to Cosenza et al. [15]. For the other genes, target InDel regions were selected on the basis of the inclusion or exclusion of species-specific short InDels in the reverse primer sequences (Additional file 1).

The primers used were designed via DNASIS-Pro software (Hitachi, Tokyo, Japan) and purchased from Eurofins (Eurofins Genomics, Germany).

Ten percent of the PCR products for each species were Sanger sequenced, for a total of 160 sequences, at CEINGE-Biotecnologie Avanzate (Naples, Italy).

TetraS-PCR assay

The primers used for TetraS-PCR were the same as those used for AS-PCR, with the exception of those for PRLR amplification in Bubalus bubalis and the forward primer used for CSN1S2 amplification in Ovis aries, which were redesigned (Additional file 2).

To set up the TetraS-PCR, three DNA sample combinations were prepared: a) Bos taurus and Bubalus bubalis, b) Capra hircus and Ovis aries, and c) a mixture of Bos taurus, Bubalus bubalis, Capra hircus and Ovis aries, with equal quantities of reference DNA from each species included in each sample. TetraS-PCR was carried out by adding all four primer pairs (10 pM of each primer) and 100 ng of DNA to the reaction mix (see the previous section).

The thermal profile was the same as that used for AS‒PCR. All the PCR products were analysed directly by electrophoresis on a 3.0% Tris–borate-ethylenediaminetetraacetic acid (TBE) agarose gel (Bio-Rad, Hercules, CA, USA) in 0.5 × TBE buffer and stained with SYBR green nucleic acid stain (Lonza Rockland, Inc., Rockland, ME, USA).

Results

In silico species-specific InDels identification

The comparison of available gene sequences in NCBI database for Artiodactyla and Perissodactyla species led to the identification of specific InDels at the CSN1S1, CSN1S2, MSTN and PRLR loci for Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively.

A comparative analysis of the CSN1S1 gene sequences available in the databases for different mammals revealed a specific 28 bp insertion (KC951931.1:g.1989–2016insTGTACAATGCCATTAATATATTGTACAA) in the proximal promoter region of this gene in the genus Capra. This insertion is localized between two elements of retroposonic origin (full-length Bov-tA elements) [17]. Interestingly, the first 20 nucleotides, which are almost perfectly duplicated, are absent in all species from the Artiodactyl and Perissodactyl orders (X59856.2:g.9508-9509delTGTACAATGCCATTAATATA). The only exceptions are species that are members of the genus Ovis (such as Ovis aries and Ovis ammon), which instead show a deletion of the second of three repetitions, TGTACAA, found in goats (JN701803.1:g.91–92delTGTACAA) (Additional files 3 and 4).

Similarly, the comparison of all sequences of the CSN1S2 gene, encoding αs2-casein for major ruminant species available in public databases, revealed a 14 bp deletion in intron 1, which is unique to the genus Ovis (KT283354.1:g.643-644delAGAAATCAAATCTT) (Additional file 5). Notably, the absence of this sequence might represent the ancestral condition of the gene, as it is almost conserved in all species belonging to the Artiodactyla and Perissodactyla orders (Additional file 6). The only exceptions are the species from the Tilopoda suborder, which have a deletion in the same region of intron 1 of the CSN1S2 gene (GenBank nos. OQ730238 and OQ730239) [18].

In the case of the MSTN gene, both literature and in silico (GenBank) evaluations have shown that Bos taurus is characterized by the deletion of a 16 bp DNA fragment in intron 1 (AB076403.1:g.1207-1208delGAGTAGGTTATGGCTT). In contrast, all species belonging to the Artiodactyla and Perissodactyla orders, including other species within the Bos genus (such as Bos grunniens, Bos mutus, Bos frontalis, Bos javanicus, Bos gaurus, and Bos indicus), carry the insertion (Additional files 7 and 8).

Finally, a comparison of PRLR gene sequences available in the database for the main ruminant species revealed a deletion of the heptamer CACTACC located between nucleotides 1102 and 1103 of exon 10 (3’-UTR) in all species of the genus Bubalus. In contrast, this heptamer is highly conserved across all species belonging to the Artiodactyla and Perissodactyla orders [15] (Additional files 9 and 10). Through genotyping via an AS‒PCR-based method, the authors confirmed the specificity of this genetic marker for bubaline species.

InDels detection via AS‒PCR

To verify the species specificity of the genetic markers at the CSN1S1, CSN1S2, and MSTN loci, three novel allele-specific PCR methods were developed. Moreover, the method proposed by [15] was adopted for PRLR.

To validate and confirm the specific amplification of DNA and the homozygous conditions for each species-specific marker, ten per cent of the PCR products for each species was Sanger sequenced, for a total of 160 sequences, at CEINGE-Biotecnologie Avanzate (Naples, Italy).

Identification by AS‒PCR of carriers of short InDels at the CSN1S1 5’UTR

To identify carriers of the 28 bp insertion (KC951931.1:g.1989–2016insTGTACAATGCCATTAATATATATTGTACAA), the 20 bp deletion (X59856.2:g.9508–9509delTGTACAATGCCATTAATATA), and the 7 bp deletion (JN701803.1:g.91–92delTGTACAA) in the proximal promoter region of the CSN1S1 gene, AS‒PCR protocols were developed. Using these methods, samples homozygous for the specific InDels in the CSN1S1 gene were successfully amplified via PCR with only the reverse primers for the 28 bp “insertion”, the 20 bp “deletion”, or the 7 bp “deletion”.

In particular, the AS-PCR reaction mix with the reverse primer specific for the 28 bp insertion (CSN1S1ins28) (Additional file 1) amplified only samples with DNA from Capra hircus (183 bp). Conversely, the AS‒PCR mix with the reverse primer for the 20 bp deletion (CSN1S1del20) amplified only DNA from Bos taurus and Bubalus bubalis (162 bp), whereas the mix with the reverse primer for the 7 bp deletion (CSN1S1del7) amplified only DNA from Ovis aries (183 bp) (Fig. 1).

[IMAGE OMITTED: SEE PDF]

Identification by AS‒PCR of carriers of the short InDel at CSN1S2 intron 1

Two allele-specific reverse primers, differing in the presence or absence of the 14 bp sequence (AGAAATCAAATCTT), were designed to verify the species specificity of the genetic marker at intron 1 of the CSN1S2 locus.

When the primer pair (F/R) CSN1S2/CSN1S2ins14 was used, only samples homozygous for 14 bp insertion in the CSN1S2 gene were successfully amplified via PCR (86 bp). In contrast, when the primer pair (F/R) CSN1S2/CSN1S2del14 was used, only samples homozygous for the ‘non-insertion’ allele (76 bp) were successfully amplified.

Genotyping of the four species from different randomly chosen breeds and genetic types confirmed that only Ovis aries samples were characterized by the absence of the 14 bp sequence (Fig. 2).

[IMAGE OMITTED: SEE PDF]

Identification by AS‒PCR of carriers of short InDel at MSTN intron 1

The species specificity of 16 bp short InDels at intron 1 of the MSTN gene was validated via allele-specific primers designed on the basis of the presence or absence of the mutational event.

Specifically, the AS-PCR mixture with the reverse primer MSTNdel16 was successfully amplified exclusively for Bos taurus DNA samples (211 bp). Conversely, when the primer specific for the presence of the insertion (MSTNins16) was used, amplification was achieved only for DNA samples from Bubalus bubalis (203 bp), Capra hircus (209 bp), and Ovis aries (209 bp) (Fig. 3).

[IMAGE OMITTED: SEE PDF]

Identification by AS‒PCR of InDel carriers at PRLR exon 10

To confirm the species specificity of the CACTACC heptamer deletion at exon 10 of the PRLR gene for bubaline species, the method proposed by [15] was used.

Genotyping of the 400 DNA samples validated the specificity of this InDel for the bubaline species, thus confirming the findings from the in silico analyses and the literature [15].

TetraS-PCR assay

To set up the TetraS-PCR assay, new primer pairs (forward and reverse) were designed for the specific amplification of the PRLR gene in Bubalus bubalis. Additionally, a new forward primer was designed for the specific amplification of Ovis aries CSN1S2 (Additional file 2).

Initially, simplex PCR analyses of reference DNAs of each species were carried out and revealed that each new primer pair generated species-specific amplification, with no false positives observed in related species. Specifically, the Bubalus bubalis-specific primers (PRLRF and PRLRRdel7) (Additional file 2) amplified a 144 bp fragment from Bubalus bubalis DNA, with no amplification of Bos taurus, Ovis aries, or Capra hircus DNA. Similarly, the desired amplification (amplicon size of 162 bp) was obtained with only Ovis aries DNA when Ovis aries-specific primers (CSN1S2F and 3 CSN1S2del14) were used.

For the amplification of Capra hircus at the CSN1S1 locus and Bos taurus at the MSTN locus, the primer pairs developed for AS-PCR amplification were used (CSN1S1/CSN1S1ins28–183 bp and MSTN/MSTNdel16–211 bp, respectively) (Additional file 2).

Figure 4 shows the electrophoretic patterns of single species-specific amplification via the new primer pairs and the previously designed primers for CSN1S1 and MSTN.

[IMAGE OMITTED: SEE PDF]

To develop and validate the TetraS-PCR, a mixture of the four primer pairs (Additional file 2) and a mixture of reference DNA from different species were prepared. Briefly, the mixture of the four primer pairs was initially tested on reference DNA from each species and subsequently on 60 DNA mixtures each of two species (30 Capra hircus/Ovis aries and 30 Bubalus bubalis/Bos taurus) and 30 DNA mixtures each with all the investigated species.

The results of the TetraS-PCR assays revealed coamplification of specific fragments in a single PCR, with the sizes of the amplified products being consistent with those of the simplex PCR products. No non-specific bands were observed (Fig. 5).

[IMAGE OMITTED: SEE PDF]

Limit of detection (LOD)

The sensitivity of the method for detecting DNA from each species in a mixture was evaluated. Briefly, a mixture of DNA from Capra hircus, Ovis aries, Bubalus bubalis, and Bos taurus was serially diluted to the same concentrations (0.1, 0.25, 0.5, 1, 5, 10, and 100 ng/μL) and analysed via multiplex SS‒PCR to determine the sensitivity of the multiplex PCR. The results revealed that the limit of DNA detection was 0.25 ng/μL. The same limit was reported by [19] for the identification of ruminant species in dairy products using PCR assays.

Discussion

InDels, like other genetic markers such as SNPs, are biallelic, codominant, abundant, and randomly distributed across genomes. When located in functional sequences, InDels are generally subject to stronger purifying selection than are SNPs. Long InDels and those affecting multiple functionally constrained nucleotides undergo stronger purifying selection [1]. One key advantage of InDels over SNPs is their lower likelihood of multiple mutations of the same length occurring at the same genomic position, making them useful for studying genetic relationships. Shared InDels represent identity by descent [20] and can serve as ancestry-informative markers, aiding in the study of population substructure, genetic diversity, phylogenetic relationships, genome evolution, and functional divergence [21].

Compared with SNPs, InDels contribute more significantly to sequence divergence, especially among closely related species [22, 23]. They are useful markers for population genetics, taxon diagnoses, forensic genetics, genetic mapping, association studies, and species identification [24,25,26,27].

Despite the advantages and broad applications of these markers, InDel studies remain underrepresented in the literature. Specifically, to our knowledge, no short genus- or species-specific short InDels have been identified in livestock ruminants to date. The only exception is the PRLR gene, which encodes the prolactin receptor, a member of the growth hormone/prolactin receptor gene family involved in various endocrine and reproductive functions [15].

The PRLR gene has been mapped to chromosome 19 in Bubalus bubalis (NC_059175.1 from 38,740,723 to 38,937,314), chromosome 20 in Bos taurus (NC_037347.1 from 38,915,987 to 39,108,971) and Capra hircus (NC_030827.1 from 38,891,738 to 39,090,307), and chromosome 16 in Ovis aries (NC_056069.1 from 39,248,092 to 39,250,921). It consists of 10 exons, with exons 1 and 2 being non-coding [15, 28, 29]. Two distinct PRLR isoforms are produced through alternative splicing of exon 10 of the primary transcript.

This last DNA coding region has been observed to accumulate a significant number of inter- and intraspecies polymorphisms across the different species investigated. Notably, a deletion of a CACTACC heptamer between nucleotides 1102 and 1103 of exon 10 has been identified as a genus-specific DNA marker for the genus Bubalus [15].

Since no short InDels specific to other widely distributed ruminant genera, such as Bos, Ovis, and Capra, have been reported, we conducted an extensive bibliographic review and comparative analysis of gene sequences from various mammalian species, focusing on key traits such as meat and milk production, which are highly conserved across species due to their fundamental role.

For instance, milk and mammary genes are highly conserved across all mammals, evolving more slowly along the lineage and subject to stronger selective constraints than most other genes in the genome. These genes have been shown to experience significant negative selection compared with the rest of the genome [30].

Among them, genes encoding the αs1 and αs2 casein fractions (CSN1S1 and CSN1S2, respectively) are known to influence both the qualitative and quantitative properties of milk in major ruminant and non-ruminant species of zootechnical interest. Due to their functional importance, structure, and variability, these genes serve as powerful molecular models for evolutionary research. They also provide insights into the genetic architecture of lesser-studied species and the phylogenetic relationships among mammalian species and domestic animals [18, 31,32,33,34,35,36]. Both genes have been annotated in nearly all species (https://www.ncbi.nlm.nih.gov/gene) and are particularly well characterized in Capra hircus, Bos taurus, Ovis aries and Bubalus bubalis. These genes share a similar organization among ruminants, although there are differences in intron size, mainly due to the varying distributions of artiodactyl retroposons located in introns and regulatory regions [17, 31, 32, 36,37,38,39,40,41]. The CSN1S1 and CSN1S2 genes are clustered with the β and k casein encoding genes (CSN2 and CSN3, respectively) in a 250 kb (kilobase) region on chromosome 6 in Capra hircus, Ovis aries and Bos taurus and on chromosome 7 in Bubalus bubalis [32]. An exception to this organization is found in certain mammals, such as donkeys, horses, rabbits, and rodents, which have an extra copy of the CSN1S2 gene, indicative of a recent paralogous gene duplication event [34, 42, 43].

The MSTN gene encodes myostatin, also known as growth differentiation factor 8 (GDF8), a negative regulator of skeletal muscle growth and size; therefore, its role in meat production is highly interesting. Mutations at this locus result in muscular hypertrophy and reduced fat, a phenomenon observed in ‘double muscled’ breeds of cattle and in several livestock and model species [44, 45]. The MSTN gene has been mapped to chromosome 2 in Bos taurus (NC_037329.1 from 6,278,864 to 6,285,491), Capra hircus (NC_030809.1 from 130,227,819 to 130,232,923, complement), Bubalus bubalis (NC_059158.1 from 58,423,897 to 58,428,995), and Ovis aries (NC_056055.1 from 119,285,858 to 119,292,614). This gene consists of three exons and two introns, and its sequence has been highly conserved across vertebrate species throughout evolution [46,47,48].

The deletion of a 16 bp DNA fragment at intron 1 of the MSTN gene identified in this study appears to be specific to Bos taurus compared to other species within the Bos genus (Bos grunniens, mutus, gaurus, frontalis and javanicus), as well as to species in the genera Bubalus, Capra, and Ovis (Additional file 7). In some Bos indicus breeds, such as Guanling, Weizhou, Weining, Lincanggaofeng, Brahman (an American zebuine × taurine hybrid beef cattle breed), and Qinchuan cattle [49, 50], comparative analysis revealed sequences with and without mutations from data available in GenBank. Furthermore, for the indicine Nelore and Gir cattle breeds, only one genomic sequence is available, and both lack the insertion. A single sequence containing the 16 bp DNA insertion is reported for Yunling cattle (Additional file 7).

All these variations could be due to the hybrid origin of these breeds [51,52,53,54,55,56,57,58,59,60]. Cattle are generally categorized into two major types: zebu (humped) and taurine (without humps), which are often classified as distinct species (Bos taurus indicus and Bos taurus taurus). However, due to their complete interfertility, they are frequently considered subspecies [61]. Genetic introgression (from Bos indicus to Bos taurus, but not the reverse) has been widely used to create new composite cattle populations, combining the climatic resilience of Bos taurus indicus with the relatively high dairy and meat productivity of Bos taurus taurus [62, 63].

For example, Chinese cattle are categorized into three groups on the basis of geographic distribution: southern, central and northern. The southern and northern groups primarily descend from Bos indicus and Bos taurus, respectively, whereas the central group originates from both [54]. Similarly, in Brazil, one of the world’s leading beef exporters, nearly 80% of the cattle herd is believed to have some degree of Bos indicus influence [64].

To further support the specificity of the InDel at the MSTN locus, a study on 722 Bos taurus cattle from ten different breeds (Hereford, Angus, South Devon, Composite, Charolais, Red Poll, Shorthorn, Simmental, Murray Grey) and cross-bred (Holstein–Friesian x Jersey) did not detect the insertion [65]. However, it was observed exclusively in the homozygous state by [66] in four different breeds of Bos indicus raised in India (Rathi, Deoni, Idduki and Vatakara).

Based on the findings from this study, the available data in GenBank, and the literature, the short InDels identified and characterized at the MSTN locus serve as effective markers for discriminating between Bos taurus and other species within the Bos genus.

In contrast, it is possible that the short InDels detected at the PRLR, CSN1S1, and CSN1S2 loci can serve as valid markers for discriminating between the genera Bubalus, Capra, and Ovis, respectively (Additional files 4, 5, and 10).

Among the various potential applications of genus- or species-specific InDels, one of the most practical is the development of protocols for the traceability of animal-derived products. Food adulteration, involving the admixture or substitution of high-value species-specific ingredients with less expensive, lower-quality ingredients, is an increasingly common issue. The inclusion of undeclared species in food ingredients can also trigger allergic reactions, posing a significant health risk to consumers [67, 68].

Currently, several analytical methods have been developed for food traceability [69, 70], but molecular analyses (DNA-based assays), due to their sensitivity, accuracy, and reproducibility, offer particularly valid tools [70, 71].

Only a few examples in the literature report the use of short and long interspersed repetitive elements as markers for DNA-based species identification [19, 72].

The genotyping of short InDel markers has several advantages. They are easier to analyse than SNPs, require less expensive procedures, and rely on equipment readly available in most laboratories [70].

Moreover, InDel markers are well suited for establishing protocols to identify hybrids through direct size separation of DNA fragments and are effective in amplifying and typing mixed or highly degraded DNA samples.

To identify genus/species-specific short Indels for ruminants, a TetraS-PCR assay was developed, employing four primer pairs, each designed to target distinct genes within a single reaction. A critical aspect of the setup of the TetraS-PCR system is the design of primers tailored to be species specific.

An undeniable advantage of this approach is the higher annealing efficiency of primers, stemming from their design based on species-specific InDel sequences. The selection of target regions containing InDels followed two main criteria: (a) short amplicon size to overcome amplification issues due to fragmented DNA in processed products and (b) significant yet comparable size differences among species-specific amplicons to allow clear and unambiguous separation via electrophoresis.

The proposed method, which is based on the detection of short InDels, allows for the simultaneous discrimination of Bubalus bubalis, Bos taurus, Capra hircus, and Ovis aries in animal-derived products or forensic samples.

Specifically, this method could be useful for discriminating between taurine and indicine meat, as well as identifying meats derived from various genetic combinations. Bos indicus beef is generally leaner, tougher, and of lower quality than Bos taurus [73]. As a result, some labelling systems exclude zebu meat from their certified brands, making robust species discrimination methods essential for maintaining consumer trust and product authenticity. Consequently, due to the increasing meat imports from countries where crossbreeding is widely practiced, it becomes crucial to have adequate tools to ensure the origin and quality of the meat.

Additionally, the proposed method can be a useful tool for detecting the adulteration of sheep milk with goat milk or the inclusion of cow milk in both. Fraudulent practices such as the adulteration of goat and sheep milk with cow milk are common. According to EU Directive No. 273/2008, the addition of cow milk to goat and sheep milk products is regulated, with a permissible limit set at 0.5%. Beyond the economic implications stemming from the high cost of sheep and goat milk, the primary risk for consumers lies in the unintentional consumption of proteins with high allergenic potential, such as bovine αs1 casein and β-lactoglobulin [74].

The relatively high cost and seasonal availability of buffalo milk are the main factors responsible for the well-known fraud related to “Mozzarella di Bufala Campana”, a typical Italian product certified by the European Protected Designation of Origin (PDO) (EC Regulation No. 1107/96 of 12 June 1996). Buffalo milk is characterized by a higher fat content (on average 8.0%) and casein concentration (averaging 36.7 mg/ml) than milk from other ruminants [75, 76]. Since the composition of milk from different species significantly influences cheese yield, flavour and sensory properties, adulterating the milk used in mozzarella production compromises the quality and sensory attributes of the final product, resulting in outcomes that are below consumer expectations.

Other potential applications of the proposed method include the detection of ruminant milk components in commercial milk from minor dairy species, such as equids (donkeys or horses) or camelids (dromedary and bactrian camels). These species produce milk that is nutritionally beneficial for human health, leading to a growing international interest in their health-promoting properties, including antibacterial and antiviral effects, as well as the diverse range of foods derived from their milk [34, 77]. As with the examples previously mentioned, the adulteration of such milk is often economically motivated, driven primarily by low milk production and the significant price difference between their milk and that of more common species, which may have a similar appearance and taste [78, 79].

The need for robust and reliable methods in animal forensic genetics is becoming increasingly critical due to the growing role of non-human DNA evidence in investigative contexts. The use of InDel markers can significantly contribute to forensic scenarios requiring species identification, including linking suspects, victims, and crime scenes; investigating animal attack; protecting wildlife; and combating illegal trade [80]. Moreover, differentiating between closely related species, such as Bos and Bubalus, especially in degraded samples, is also essential for advancing zooarchaeological studies [81].

In conclusion, this study provides new insights into the genetic differentiation among diverse group combinations, an area that remains underexplored. Finally, for the first time, a single genetic marker was identified and characterized, enabling the reliable distinction between taurine and zebu cattle at the DNA level.

Data availability

In this study no new DNA sequences and polymorphisms have been generated. The datasets used and analysed for in silico analyses were retrieved from the public repository https://www.ncbi.nlm.nih.gov/nuccore/?term= . The authors are available for any clarifications on the protocols developed.

Abbreviations

AS‒PCR:

Allele-specific PCR

CSN1S1 :

αS1-casein (gene)

CSN1S2 :

αS2-casein (gene)

CSN2 :

β Casein (gene)

InDels:

INsertions and DELetions

MSTN :

Myostatin (gene)

PCR:

Polymerase chain reaction

PRLR :

Prolactin receptor (gene)

SNPs:

Single Nucleotide Polymorphisms

TetraS-PCR:

Tetraplex-Specific PCR

TSS:

Target Species-Specific

References

Montgomery SB, Goode DL, Kvikstad E, Albers CA, Zhang ZD, Mu XJ, et al. The origin, evolution, and functional impact of short insertion-deletion variants identified in 179 human genomes. Genome Res. 2013;23:749–61. https://doi.org/10.1101/gr.148718.112.

Barton HJ, Zeng K. The impact of natural selection on short insertion and deletion variation in the great Tit genome. GBE. 2019;11(6):1514–24. https://doi.org/10.1093/gbe/evz068.

Perini S, Johannesson K, Butlin R, Westram AM. Short INDELs and SNPs as markers of evolutionary processes in hybrid zones. J Evol Biol. 2025;38(3):367–78. https://doi.org/10.1093/jeb/voaf002.

Mullaney JM, Mills RE, Pittard WS, Devine SE. Small insertions and deletions (INDELs) in human genomes. Hum Mol Genet. 2010;19(R2):R131–6. https://doi.org/10.1093/hmg/ddq400.

Yang SL, Lin RY, Xu LX, Cheng L. Analysis of polymorphisms of mitochondrial DNA D-loop and Mc1R gene in Chinese Wuchuan Black cattle. J Appl Anim Res. 2014;42(4):487–91. https://doi.org/10.1080/09712119.2013.875917.

Crespo-Piazuelo D, Criado-Mesas L, Revilla M, Castellò A, Fernàndez AI, Folch JM, et al. Indel detection from Whole Genome Sequencing data and association with lipid metabolism in pigs. PLoS ONE. 2019;14(6): e0218862. https://doi.org/10.1371/journal.pone.0218862.

Jiang J, Gao Y, Hou Y, Li W, Zhang S, Zhang Q, Sun D. Whole-genome resequencing of Holstein bulls for indel discovery and identification of genes associated with milk composition traits in dairy cattle. PLoS ONE. 2016;11(12): e0168946. https://doi.org/10.1371/journal.pone.0168946.

Jiang J, Liu L, Gao Y, Shi L, Li Y, Liang W, Sun D. Determination of genetic associations between indels in 11 candidate genes and milk composition traits in Chinese Holstein Population. BMC Genet. 2019;20:48. https://doi.org/10.1186/s12863-019-0751-y.

Ju X, Huang X, Zhang M, Lan X, Wang D, Wei C, et al. Effects of eight InDel variants in FHIT on milk traits in Xinjiang brown cattle. Anim Biotechnol. 2020;32(4):486–94. https://doi.org/10.1080/10495398.2020.1724124.

Liu X, Fan X, Yan J, Zhang L, Wang L, Calnan H, et al. An InDel in the promoter of ribosomal protein S27-like gene regulates skeletal muscle growth in pigs. J Integr Agric. 2024. https://doi.org/10.1016/j.jia.2024.05.005.

Ramunno L, Cosenza G, Pappalardo M, Pastore N, Gallo D, Di Gregorio P, et al. Identification of the goat CSN1S1F allele by means of PCR-RFLP method. Anim Genet. 2000;31(5):342–3. https://doi.org/10.1046/j.1365-2052.2001.00054.x. Erratum. Anim Genet. 2000;32(1):54–54.

Ren T, Yang Y, LinW Li W, Xian M, Fu R, et al. A 31-bp indel in the 5’ UTR region of GNB1L is significantly associated with chicken body weight and carcass traits. BMC Genet. 2020;21(1):91. https://doi.org/10.1186/s12863-020-00900-z.

Strychalski J, Czarnik U, Pierzchała M, Pareek CS. Relationship between the insertion/deletion polymorphism within the promoter and the intron 1 sequence of the PRNP gene and milk performance traits in cattle. Czech J Anim Sci. 2011;56(4):151–6. https://doi.org/10.17221/1436-CJAS.

Wang K, Yan H, Xu H, Yang Q, Zhang S, Pan C, et al. A novel indel within goat casein alpha S1 gene is significantly associated with litter size. Gene. 2018;671:161–9. https://doi.org/10.1016/j.gene.2018.05.119.

Cosenza G, Iannaccone M, Auzino B, Macciotta NPP, Kovitvadhi A, Nicolae I, Pauciullo A. Remarkable genetic diversity detected at river buffalo Prolactin Receptor (PRLR) gene and association studies with milk fatty acid composition. Anim Genet. 2018;49(3):159–68. https://doi.org/10.1111/age.12645.

Basic local alignment search tool. https://blast.ncbi.nlm.nih.gov/Blast.cgi. Accessed 14 Jan 2025.

Ramunno L, Cosenza G, Rando A, Illario R, Gallo D, Di Berardino D, Masina P. The goat αs1-casein gene: gene structure and promoter analysis. Gene. 2004;334:105–11. https://doi.org/10.1016/j.gene.2004.03.006.

Pauciullo A, Versace C, Gaspa G, Letaief N, Bedhiaf-Romdhani S, Fulgione A, et al. Sequencing and characterization of αs2-Casein gene (CSN1S2) in the old-world camels have proven genetic variations useful for the understanding of species diversification. Animals. 2023;13(17): 2805. https://doi.org/10.3390/ani13172805.

Cosenza G, Iannaccone M, Gallo D, Pauciullo A. A fast and reliable polymerase chain reaction method based on short interspersed nuclear elements detection for the discrimination of buffalo, cattle, goat, and sheep species in dairy products. AJAS. 2019;32(6):891–5. https://doi.org/10.5713/ajas.18.0459.

Kim JY, Hwang JE, Eo SH, Kang SG, Moon JC, Kim JA, et al. Development of InDel markers for interspecific hybridization between hill pigeons and feral pigeons based on whole-genome re-sequencing. Sci Rep. 2022;12(1):22618. https://doi.org/10.1038/s41598-022-27147-1.

Luan PT, Ryder OA, Davis H, Zhang YP, Yu L. Incorporating indels as phylogenetic characters: impact for interfamilial relationships within Arctoidea (Mammalia: Carnivora). Mol Phylogenet Evol. 2013;66(3):748–56. https://doi.org/10.1016/j.ympev.2012.10.023.

Britten RJ. Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. PNAS. 2002;99(21):13633–5. https://doi.org/10.1073/pnas.172510699.

Britten RJ, Rowen L, Williams J, Cameron RA. Majority of divergence between closely related DNA samples is due to indels. PNAS. 2003;100(8):4661–5. https://doi.org/10.1073/pnas.0330964100.

Almheiri M, Sanqoor S, Haidar M, Nazir M, Vijayan R. Study of insertion-deletion polymorphisms (indels) in the UAE population. Forensic Sci Int Genet. 2019;7(1):561–3. https://doi.org/10.1016/j.fsigss.2019.10.090.

Chen FC, Chen CJ, Chuang TJ. INDELSCAN: a web server for comparative identification of species-specific and non-species-specific insertion/deletion events. Nucleic Acids Res. 2007;35(2):W633-638. https://doi.org/10.1093/nar/gkm350.

Martín P, García O, Heinrichs B, Yurrebaso I, Aguirre A, Alonso A. Population genetic data of 30 autosomal indels in Central Spain and the Basque Country populations. Forensic Sci Int Genet. 2013;7(2):e27-30. https://doi.org/10.1016/j.fsigen.2012.10.003.

Väli U, Brandström M, Johansson M, Ellegren H. Insertion-deletion polymorphisms (indels) as genetic markers in natural populations. BMC Genet. 2008;9: 8. https://doi.org/10.1186/1471-2156-9-8.

El-Magd MA, Fathy A, Kahilo KA, Saleh AA, El Sheikh AI, Al-Shami S, El-Komy SM. Polymorphisms of the PRLR gene and their association with milk production traits in Egyptian buffaloes. Animals. 2021;11(5): 1237. https://doi.org/10.3390/ani11051237.

Hayes H, Le CC, Goubin G, Mercier D, Payen EJ, Bignon C, et al. Localization of ZNF164, ZNF146, GGTA1, SOX2, PRLR and EEF2 on homeologous cattle, sheep, and goat chromosomes by fluorescent in situ hybridization and comparison with human gene map. Cytogen Cell Genet. 1996;72:342–6. https://doi.org/10.1159/000134218.

Lemay DG, Lynn DJ, Martin WF, Neville MC, Casey TM, Rincon G, et al. The bovine lactation genome: insights into the evolution of mammalian milk. Genome Biol. 2009;10(4): R43. https://doi.org/10.1186/gb-2009-10-4-r43.

Cosenza G, Pauciullo A, Macciotta NPP, Apicella E, Steri R, La Battaglia A, et al. Mediterranean River Buffalo CSN1S1 gene: search for polymorphisms and association studies. Anim Prod Sci. 2015;55(5):654–60. https://doi.org/10.1071/AN13438.

Cosenza G, Gallo D, Auzino B, Gaspa G, Pauciullo A. Complete CSN1S2 characterization, novel alleles identification and association with milk fatty acids composition in river buffalo. Front Genet. 2021;11: 622494. https://doi.org/10.3389/fgene.2020.622494.

Kawasaki K, Lafont AG, Sire JY. The evolution of milk casein genes from tooth genes before the origin of mammals. MBE. 2011;28:2053–61. https://doi.org/10.1093/molbev/msr020.

Cosenza G, Pauciullo A. A comprehensive analysis of CSN1S2 I and II transcripts reveals significant genetic diversity and allele-specific exon skipping in Ragusana and Amiatina Donkeys. Animals. 2024;14(20): 2918. https://doi.org/10.3390/ani14202918.

Rahmatalla SA, Arends D, Brockmann GA. Review: genetic and protein variants of milk caseins in goats. Front genet. 2022;13: 995349. https://doi.org/10.3389/fgene.2022.995349.

Rehman SU, Feng T, Wu S, Luo X, Lei A, Luobu B, Hassan FU, Liu Q. Comparative genomics, evolutionary and gene regulatory regions analysis of Casein Gene Family in Bubalus bubalis. Front genet. 2021;12: 662609. https://doi.org/10.3389/fgene.2021.662609.

Calvo JH, Dervishi E, Sarto P, González-Calvo L, Berzal-Herranz B, Molino F, Serrano M, et al. Structural and functional characterisation of the αS1-casein (CSN1S1) gene and association studies with milk traits in Assaf sheep breed. Livest Sci. 2013;157:1–8. https://doi.org/10.1016/j.livsci.2013.06.014.

Groenen M, Dijkhof R, Verstege A, Van der Poel J. The complete sequence of the gene encoding bovine α2-casein. Gene. 1993;123(2):187–93. https://doi.org/10.1016/0378-1119(93)90123-k.

Koczan D, Hobom G, Seyfert HM. Genomic organization of the bovine alpha-S1 casein gene. Nucleic Acids Res. 1991;19:5591–6. https://doi.org/10.1093/nar/19.20.5591.

Rijnkels M. Multispecie comparison of the casein gene loci and evolution of casein gene family. J Mammary Gland Biol Neoplasia. 2002;7:327–45. https://doi.org/10.1023/a:1022808918013.

Stafuzza NB, Naressi BCM, Amaral-Trusty MEJ. Sequence analysis of the alpha-s1 casein gene in Murrah buffalo. 52a Reunião Anual da Sociedade Brasileira de Zootecnia. Belo Horizonte. 2015. Available from: https://www.researchgate.net/publication/319143582_Sequence_analysis_of_the_alpha-s1_casein_gene_in_Murrah_buffalo.

Auzino B, Miranda G, Henry C, Krupova Z, Martini M, Salari F, et al. Top-Down proteomics based on LC-MS combined with cDNA sequencing to characterize multiple proteoforms of Amiata donkey milk proteins. Food Res Int. 2022;160: 111611. https://doi.org/10.1016/j.foodres.2022.111611.

Cosenza G, Pauciullo A, Annunziata AL, Rando A, Chianese L, Marletta D, et al. Identification and characterization of the donkey CSN1S2 I and II cDNAs. Ita J Anim Sci. 2010;9(e40):206–11. https://doi.org/10.4081/ijas.2010.e40.

Kocamis H, Killefer J. Myostatin expression and possible functions in animal muscle growth. Domest Anim Endocrinol. 2002;23:447–54. https://doi.org/10.1016/s0739-7240(02)00178-9.

Baig MH, Ahmad K, Moon JS, Park SY, Ho Lim J, Chun HJ, et al. Myostatin and its regulation: a comprehensive review of myostatin inhibiting strategies. Front Physiol. 2022;13: 876078. https://doi.org/10.3389/fphys.2022.876078.

Abdel-Aziem SH, Mahrous KF, Abd El-Hafez MAM, Abdel MM. Genetic variability of myostatin and prolactin genes in popular goat breeds in Egypt. JGEB. 2018;16(1):89–97. https://doi.org/10.1016/j.jgeb.2017.10.005.

Grobet L, Martin LJ, Poncelet D, Pirottin D, Brouwers B, Riquet J, et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet. 1997;17(1):71–4. https://doi.org/10.1038/ng0997-71.

Osman NM, Shafey HI, Abdelhafez MA, Sallam AM, Mahrous KF. Genetic variations in the Myostatin gene affecting growth traits in sheep. Vet World. 2021;14(2):475–82. https://doi.org/10.14202/vetworld.2021.475-482.

He YL, Wu Y, Lan Z, Liu Y, Zhang Y. Molecular analysis of the first intron in the bovine myostatin gene. Mol Biol Rep. 2011;38(7):4643–9. https://doi.org/10.1007/s11033-010-0598-9.

He YL, Wu YH, Quan FS, Liu YG, Zhang Y. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle. GMR. 2013;12(3):3398–406. https://doi.org/10.4238/2013.

Liu RY, Xia XL, Lei CZ, Zhang MZ, Chen H, Yang GS. Genetic diversity of mitochondrial DNA D-loop sequences in cattle breeds in Guizhou. Hereditas. 2006;28:279–84.

O’Brien AMP, Höller D, Boison SA, Milanesi M, Bomba L, Utsunomiya YT, et al. Low levels of taurine introgression in the current Brazilian Nelore and Gir indicine cattle populations. GSE. 2015;47:31. https://doi.org/10.1186/s12711-015-0109-5.

Koufariotis L, Hayes BJ, Kelly M, Burns BM, Lyons R, Stothard P, et al. Sequencing the mosaic genome of Brahman cattle identifies historic and recent introgression including polled. Sci Rep. 2018;8(1):17761. https://doi.org/10.1038/s41598-018-35698-5.

Chen N, Huang J, Zulfiqar A, Li R, Xi Y, Zhang M, et al. Population structure and ancestry of Qinchuan cattle. Anim Genet. 2018;49(3):246–8. https://doi.org/10.1111/age.12658.

Amancio AP, Duarte SSM, Silva RC, da Cruz AS, Silva DC, da Silva CC, da Cruz AD. Banded karyotype of Nelore cattle (Bos taurus indicus Linnaeus, 1758). Comp Cytogenet. 2019;13(3):265–75. https://doi.org/10.3897/CompCytogen.v13i3.36449.

Xia X, Qu K, Li F, Jia P, Chen Q, Chen N, et al. Abundant genetic diversity of Yunling Cattle based on mitochondrial genome. Animals. 2019;9(9): 641. https://doi.org/10.3390/ani9090641.

Wang X, Ju Z, Jiang Q, Zhong J, Liu C, Wang J, et al. Introgression, admixture, and selection facilitate genetic adaptation to high-altitude environments in cattle. Genomics. 2021;113(3):1491–503. https://doi.org/10.1016/j.ygeno.2021.03.023.

Liu Y, Cheng H, Wang S, Luo X, Ma X, Sun L, et al. Genomic diversity and selection signatures for Weining cattle on the border of Yunnan-Guizhou. Front Genet. 2022;13: 848951. https://doi.org/10.3389/fgene.2022.848951.

Milanesi M, Obrien AMP, Utsunomiya AT, Feres LF, Sonstegard TS, Garcia JF. Genomic breed composition of pure registered Brazilian Gir. Trop Anim Health Prod. 2022;54(5):310. https://doi.org/10.1007/s11250-022-03299-0.

Dai X, Bian P, Hu D, Luo F, Huang Y, Jiao S, et al. A Chinese indicine pangenome reveals a wealth of novel structural variants introgressed from other Bos species. Genome Res. 2023;33(8):1284–98. https://doi.org/10.1101/gr.277481.122.

Loftus RT, MacHugh DE, Bradley DG, Sharp PM, Cunningham P. Evidence for two independent domestications of cattle. PNAS. 1994;91(7):2757–61. https://doi.org/10.1073/pnas.91.7.2757.

Vahedi SM, Salek Ardestani S, Pahlevan Afshari K, Ghoreishifar SM, Moghaddaszadeh-Ahrabi S, Banabazi MH, et al. Genome-wide selection signatures and human-mediated introgression events in Bos taurus indicus-influenced composite beef cattle. Front Genet. 2022;13: 844653. https://doi.org/10.3389/fgene.2022.844653.

Zhang Q, Schönherz AA, Lund MS, Guldbrandtsen B. Positive selection and adaptive introgression of haplotypes from Bos indicus improve the modern Bos taurus cattle. Agriculture. 2022;12: 844. https://doi.org/10.3390/agriculture12060844.

Bressan MC, Rodrigues EC, Rossato LV, Neto-Fonseca I, Alves SP, Bessa RJB, et al. Discrimination of meat produced by Bos taurus and Bos indicus finished under an intensive or extensive system. Animals (Basel). 2020;10(10): 1737. https://doi.org/10.3390/ani10101737.

Haruna IL, Ekegbu UJ, Ullah F, Amirpour-Najafabadi H, Zhou H, Hickford JGH. Genetic variations and haplotypic diversity in the Myostatin gene of New Zealand cattle breeds. Gene. 2020;740: 144400. https://doi.org/10.1016/j.gene.2020.144400.

Tantia MS, Vijh RK, Kumar ST, Mishra B, Reecy JM. Comparative analysis of GDF 8 (myostatin) in Bos indicus and Bos taurus. DNA Seq. 2006;17(4):311–3. https://doi.org/10.1080/10425170600807603.

Chaudhary V, Kajla P, Dewan A, Pandiselvam R, Socol CT, Maerescu CM. Spectroscopic techniques for authentication of animal origin foods. Front nutr. 2022;9: 979205. https://doi.org/10.3389/fnut.2022.979205.

Zhou S, Zhong G, Zhou H, Zhang X, Zeng X, Wu Z, et al. A heptaplex PCR Assay for molecular traceability of species origin with high efficiency and practicality in both raw and heat processing meat materials. Front nutr. 2022;23(9): 890537. https://doi.org/10.3389/fnut.2022.890537.

Danezis GP, Tsagkaris AS, Camin F, Brusic V, Georgiou CA. Food authentication: techniques, trends and emerging approaches. Trends Anal Chem. 2016;85:123–32. https://doi.org/10.1016/j.trac.2016.02.026.

Mafra I, Honrado M, Amaral JS. Animal species authentication in dairy products. Foods. 2022;11(1124):10.3390/foods11081124.

Lo YT, Shaw PC. DNA-based techniques for authentication of processed food and food supplements. Food Chem. 2018;240:767–74. https://doi.org/10.1016/j.foodchem.2017.08.022.

Tajima K, Enishi O, Amari M, Mitsumori M, Kajikawa H, Kurihara M, et al. PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements. Biosci Biotechnol Biochem. 2002;66(10):2247–50. https://doi.org/10.1271/bbb.66.2247.

Rodrigues RT, Chizzotti ML, Vital CE, Baracat-Pereira MC, Barros E, Busato KC, et al. Differences in Beef Quality between Angus (Bos taurus taurus) and Nellore (Bos taurus indicus) cattle through a proteomic and phosphoproteomic approach. PLoS ONE. 2017;12(1): e0170294. https://doi.org/10.1371/journal.pone.0170294.

Calvano CD, De Ceglie C, Monopoli A, Zambonin CG. Detection of sheep and goat milk adulterations by direct MALDI-TOF MS analysis of milk tryptic digests. J Mass Spectrom. 2012;47(9):1141–9. https://doi.org/10.1002/jms.2995.

Correddu F, Serdino J, Manca MG, Cosenza G, Pauciullo A, Ramunno L, et al. Use of multivariate factor analysis to characterize the fatty acid profile of buffalo milk. J Food Compos Anal. 2017;60:25–31. https://doi.org/10.1016/j.jfca.2017.03.008.

Cosenza G, Mauriello R, Garro G, Auzino B, Iannaccone M, Costanzo A, et al. Casein composition and differential translational efficiency of casein transcripts in donkey’s milk. Res J Dairy Sci. 2019;86(2):201–7. https://doi.org/10.1017/S0022029920000035. Erratum 2020: Res J Dairy Sci. 2020;87(1):141.

Vincenzetti S, Cammertoni N, Rapaccetti R, Santini G, Klimanova Y, Zhang JJ, Polidori P. Nutraceutical and functional properties of Camelids’ milk. Beverages. 2022;8: 12. https://doi.org/10.3390/beverages8010012.

Hai X, Liu GQ, Luo JX, Guo YS, Qian JP, Ya M, et al. Triplex real-time PCR assay for the authentication of camel-derived dairy and meat products. JDS. 2020;103(11):9841–50. https://doi.org/10.3168/jds.2019-17245.

Wu X, Na Q, Hao S, Ji R, Ming L. Detection of ovine or bovine milk components in commercial camel milk powder using a PCR-Based method. Molecules. 2022;27(9): 3017. https://doi.org/10.3390/molecules27093017.

Gao HY, Liu GF, Wu J, Chen PY. Animal DNA Typing and Its Research Progress in Forensic Medicine. Fa Yi Xue Za Zhi. 2023;39(2):161–167 https://doi.org/10.12116/j.issn.1004-5619.2021.511210.

Pei X, Liang F, Cao Y, Zhang Y. The dynamics of Bovini exploitation strategies on the Central Plains of China from the middle neolithic to the bronze age. Sci Rep. 2024;14(1):29616. https://doi.org/10.1038/s41598-024-81065.