OsMYBR1, a 1R-MYB Family Transcription Factor Regulates Starch Biosynthesis in Rice Endosperm

Abstract

Starch is the primary component of the endosperm and plays a crucial role in rice quality. Although the enzymes involved in starch synthesis have been extensively studied, the transcription factors that regulate these enzymes remain largely unknown. Here, we identified a MYB family transcription factor, OsMYBR1, that regulates starch biosynthesis in rice. OsMYBR1 is highly expressed during endosperm development. Mutations of OsMYBR1 result in reduced grain thickness and a decrease in 1000-grain weight. The endosperm of osmybr1 mutants exhibit rounded and loosely packed starch granules, decreased amylose content, altered fine structure of amylopectin, and modified physicochemical properties. The analysis of RT-qPCR showed that the expression of several starch-synthesis enzyme-coding genes (SSEGs), including OsGBSSⅠ, OsAGPL1, OsAGPL2, OsBEⅡb, OsISA1, PHOL, and OsSSⅢa, is altered in osmybr1 mutants. Further experiments indicated that OsMYBR1 directly binds to the promoters of OsGBSSⅠ, OsAGPL1, OsAGPL2, OsISA1, OsBEⅡb, and PHOL, resulting in an increase in the expression of OsGBSSⅠ but a decrease in the expression of OsAGPL2, OsISA1, and OsSSⅢa. In contrast, OsMYBR1-overexpressing endosperm appears normal, with starch granule morphology, increased amylopectin content, and improved alkali spreading value, indicating enhanced rice eating and cooking quality (ECQ). These findings suggest that the overexpression of OsMYBR1 could be a promising strategy for improving rice ECQ.

1. Introduction

Rice (Oryza sativa L.) is a vital staple food worldwide, with starch comprising more than 80% of the rice endosperm [1]. Starch is composed of linear amylose and highly branched amylopectin, and the ratio of these components, along with their hierarchical physicochemical properties, determines the rice quality [2,3]. Key indicators for evaluating and estimating rice eating and cooking quality (ECQ) include amylose content (AC), gel consistency (GC), and gelatinization temperature (GT).

Starch biosynthesis is a complex biochemical process involving multiple coordinated enzymes [4,5]. Amylose synthesis is primarily controlled by granule-bound starch synthase Ⅰ (GBSSⅠ), encoded by the Waxy gene. Generally, loss-of-function of OsGBSSⅠ generated glutinous rice [6,7]. Furthermore, genome editing the Waxy promoter or 5′-UTR-intron has been shown to fine-tune amylose levels and improved rice quality [8]. Recently, novel Wx alleles generated through base editing have been developed to enhance rice grain quality [9]. In contrast, amylopectin synthesis requires a series of enzymes, including soluble starch synthases (SSs), starch branching enzymes (SBEs), and debranching enzymes (DBEs). SSs are responsible for the elongating of amylopectin molecules, SBEs create α-1,6-glycoside branch points, and DBEs remove improper branch chains by hydrolyzing these bonds. Reduced expression or loss-of-function of enzymes, such as OsSSⅠ, OsSSⅡa, OsSSⅢa, OsBEⅡb, and OsISA1, disrupts starch biosynthesis and granule formation, resulting in abnormal endosperm development [10,11,12,13,14,15,16,17].

The enzymes involved in starch synthesis are regulated by various transcription factors. The MYC transcription factor OsBP-5 forms a heterodimer with the ethylene-responsive element binding protein OsEBP-89, enhancing Waxy gene transcription [18]. The nuclear factor Y family gene NF-YB1 forms a heterotrimer complex with NF-YC12 and bHLH144, directly activating the Waxy gene to regulate amylose content and grain quality [19]. Additionally, the NAC transcription factors OsNAC20 and OsNAC26 directly transactivate the expression of genes involved in starch and storage protein synthesis, including OsSSⅠ, OsPUL, DPE1, GluA1, GluB4/5, α-globulin, and 16 kD prolamin [1]. OsNAC24 acts as a transcriptional activator targeting the promoters of six starch-synthesis enzyme-coding genes (SSEGs): OsGBSSⅠ, OsSBEⅠ, OsAGPS2, OsSSⅠ, OsSSⅢa, and OsSSIVb [5]. Among bZIP family transcription factors, OsbZIP58 binds promoters of six starch synthesis genes (OsAGPL3, Wx, OsSSⅡa, SBE1, OsBEⅡb, and ISA2) to regulate their expression [20]. OsbZIP60 also activates the expression of several starch synthesis-related genes (GBSSI, AGPL2, SBEI, and ISA2) and storage protein synthesis-related genes (OsGluA2, Prol14, and Glb1) [21]. Conversely, the AP2/EREBP family transcription factor RSR1 negatively regulates the expression of several SSEGs, influencing amylose content and amylopectin structure [22].

MYB transcription factors constitute one of the largest plant-specific families, playing key roles in growth, development, metabolism, hormone signaling, disease resistance, and stress tolerance [23,24,25,26,27]. To date, more than 155 MYB genes have been identified in rice [23]. In maize, overexpression of ZmMYB115 significantly suppressed the expression of Du1, a key enzyme involved in the elongation of amylopectin chains, while enhancing Wx promoter activity related to amylose synthesis in the maize endosperm [28]. ZmMYB14 binds to the promoter of ZmBT1, a transporter of adenosine diphosphate-glucose, activating its expression and regulating maize starch synthesis [29]. However, despite these findings, there are few reports on the role of MYB family transcription factors in rice starch synthesis.

In this study, we identified 137 MYB family proteins in rice using HMMER searches. Expression analysis revealed that nine MYB genes are highly expressed in seeds. Further analysis identified the 1R-MYB transcription factor OsMYBR1 (LOC_Os10g20990), which is highly expressed in the immature rice endosperm. We hypothesize that OsMYBR1 plays a crucial regulatory role in starch biosynthesis during endosperm development. Consistent with this, loss-of-function mutants in OsMYBR1 altered the expression of several SSEGs, moderately impacting starch biosynthesis, composition, structure, starch granules, and physicochemical properties. Conversely, overexpression of OsMYBR1 improved the amylopectin content without affecting endosperm appearance or starch granule morphology, ultimately enhancing rice quality.

2. Materials and Methods

2.1. Plant Growth Conditions and Phenotypic Characterizations

The Oryza sativa L. ssp. japonica rice cultivar ‘Nipponbare’ (NIP) was used for transformation experiments. Wild-type NIP and all the transgenic plants were grown at the experimental fields in Hangzhou, Zhejiang Province, China, during the summer season. The seed length, seed width, seed thickness, 1000-grains-weight, chalky grain rate, and chalkiness degree of NIP, mutants, and overexpression lines were examined using a seed phenotyping system (Wanshen, Hangzhou, China).

2.2. Bioinformatics and Phylogenetic Analysis of OsMYBR1 Protein

The conserved domains of OsMYBR1 were predicted in NCBI (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 5 April 2025)). Orthologues of OsMYBR1 were identified via the Gramene database (http://www.gramene.org/ (accessed on 5 March 2025)) and protein sequences downloaded from NCBI’s non-redundant protein database using BLASTp (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 5 March 2025)) with OsMYBR1 as the query. A total of 137 MYB family proteins were identified (listed in Supplemental Table S1).

Phylogenetic analysis was performed on full-length OsMYBR1 and its homologous proteins in Zea mays, Triticum urartu, Triticum aestivum, Glycine max, Arabidopsis thaliana, rice (Oryza sativa), barley (Hordeum vulgare), Setaria viridis, Paspalum notatum, and Digitaria exilis. Sequences were aligned using MUSCLE in the MEGA 7.0 software [30]. The phylogenetic tree was constructed using the neighbor-joining method with 1000 bootstrap replicates.

2.3. Gene Expression Analysis of OsMYBR1

Transcript abundance of OsMYBR1 in root, stem, leaf, anther, pistil, panicle, and seed was acquired from RiceData (https://www.ricedata.cn/gene/ (accessed on 5 March 2025)). The qRT-PCR was used to analyze the expression pattern of OsMYBR1. The tissues of root, stem, leaf, spikelet, and developmental seeds (3, 10, 18, and 24 days after flowering (DAF)) were collected form NIP. Here, 3 DAF represented the early developmental stage, 10 DAF and 18 DAF corresponded to storage product accumulation stage, and 24 DAF indicated the maturation stage. Total RNA was extracted using the TRIzol reagent (Carlsbad, CA, USA) and reverse transcribed into cDNA with ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). SYBR Green Real-Time PCR Master Mix (Toyobo) was used for qRT-PCR analysis. The rice Ubiquitin gene (Os03g0234200) served as the internal control. Relative expression was calculated using the comparative CT method [21]. All primer sequences used in this analysis are listed in Supplemental Table S2.

2.4. Subcellular Localization of OsMYBR1 in Rice Protoplasts

The coding sequence (CDS) of OsMYBR1 was fused to the N-terminus of enhanced green fluorescent protein (eGFP) under the control of the 35S promoter, generating the p35S:OsMYBR1-eGFP construct. Free eGFP was used as a control. Both constructs were transiently expressed in rice protoplasts. After 16 h incubation, fluorescence was observed using a Zeiss LSM980 (Jena, Germany). DAPI staining served as a nuclear marker. Primer sequences are in Supplemental Table S2.

2.5. Construction of Gene Overexpression and Gene Knockout in Rice

The CDS of OsMYBR1 was cloned from NIP into the pCAMBIA1305 binary vector for overexpression. For knockout, the CRISPR/Cas9 system was used, with guide RNA editing sequences inserted to the BGK03 vector (Biogle, Changzhou, China). Primers and sequencing details are provided in Supplemental Table S2.

2.6. Scanning Electron Microscopy

Mature rice seeds were dried completely at 37 °C and cut longitudinally. Transverse sections were fixed, gold-coated, and observed under scanning electron microscopy (SEM) to examine starch grain morphology.

2.7. Physicochemical Properties of Endosperm Starch

The total starch and amylose content of polished seeds were measured using Megazyme assay kits K-TSTA and K-AMYL (Megazyme, Wicklow, Ireland). Total protein content was determined following Kang et al. [31]. The Alkali spreading value (ASV) assay evaluated the degree of spreading of milled rice in a 1.7% KOH solution after 23 h according to Cruz et al. [32]. ASV scores are generally categorized into four groups: (1) high GT = ASV score 1–2, (2) high intermediate GT = ASV score 3, (3) intermediate GT = ASV score 4–5, and (4) low GT = ASV score 6–7 [33].

Gelatinization temperature was measured by differential scanning calorimetry (DSC) (Mettler-Toledo, Columbus, OH, USA). We measured 5 mg of rice flour in the pan, added 10 μL ddH₂O, and the pan was sealed. Then the samples were heated from 25 to 120 °C at 10 °C/min. The thermodynamic characteristics of the rice flour, including onset temperature, peak temperature, conclusion temperature, and enthalpy (ΔH), were recorded.

Amylopectin chain length was determined via isoamylase digestion (Sigma-Aldrich, St. Louis, MO, USA) followed by capillary electrophoresis.

2.8. Yeast 1-Hybrid (Y1H), Dual-Luciferase Reporter and Electrophoresis Mobility Shift (EMSA) Assay

For Y1H assay, the CDS of OsMYBR1 was fused to the GAL4 AD structure domain in the pB42AD vector, and the promoter sequence of OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa was cloned into pLacZi vectors. Vectors were transformed into yeast strain EGY48 and cultured on SD/-Ura-His medium containing X-Gal. For dual-luciferase reporter assay (LUC), the promoter of OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa, was cloned into the pGreenⅡ 0800-LUC vector to create reporter constructs and the CDS of the OsMYBR1 was cloned into the pGreenⅡ 62-SK vector as effector. Protoplast preparation and transformation were conducted according to Zhong et al. [34]. Primer details are in Supplemental Table S2. The CDS of OsMYBR1 was amplified from cDNA of NIP and inserted into the pGEX6P-1 vector to obtain the GST-OsMYBR1 fusion protein. EMSA were performed using a EMSA Kit according to manufacturer instruction (GS009; Beyotime, Shanghai, China).

2.9. Statistical Analysis

Statistical significance of inter-group differences was assessed using one-way ANOVA and post hoc Tukey’s multiple comparisons test, conducted with Prism software version 9.0 (GraphPad, San Diego, CA, USA). Significant differences are indicated by different letters at p < 0.05. Statistical significance of two groups was assessed using Student’s t-test in R software version 4.0.5 with the “pwr” package (* p < 0.05, ** p < 0.01).

3. Results

3.1. Identification and Characterization of MYB Proteins in Rice

In this study, we identified 137 MYB family proteins containing MYB domain in rice by utilizing HMMER analysis to search the Oryza sativa L. ssp. Japonica protein database (E-value < 1.2 × 10⁻²⁸) (Supplementary Table S1). Based on the number of MYB binding domains, the MYB genes can be classified into four subgroups: MYB-related genes (1R-MYB), R2R3-MYB (2R-MYB), R1R2R3-MYB (3R-MYB), and atypical MYB genes (4R-MYB) (Supplementary Table S1). Notably, the R2R3-MYB subfamily has the largest number of genes, accounting for 78.1% of the total MYB genes in rice (Supplementary Table S1). We performed an expression profile analysis of these 137 MYB transcription factors using RNA-seq data from the Rice Expression Database (https://ngdc.cncb.ac.cn/red/ (accessed on 20 February 2025)). The results showed that nine MYB genes (LOC_Os05g37060 (1R-MYB), LOC_Os05g28320 (R2R3-MYB), LOC_Os07g31470 (R2R3-MYB), LOC_Os01g74590 (R2R3-MYB), LOC_Os06g14710 (1R-MYB), LOC_Os03g25304 (1R-MYB), LOC_Os10g20990 (1R-MYB), LOC_Os02g42850 (R2R3-MYB), LOC_Os04g45020 (R2R3-MYB)) were highly or specifically expressed in immature rice seeds (Figure S1).

3.2. Gene Expression Patterns, Subcellular Localization, and Phylogenetic Analysis of the OsMYBR1 Protein

Among the nine MYB genes above, we selected the LOC_Os10g 20990, named as OsMYBR1, to further study. The qRT-PCR analysis indicated that OsMYBR1 was mainly expressed in immature rice seed, which was consistent with the prediction of the Rice Expression Database (Figure 1). Protein sequence analysis by using NCBI-CDD (https://www.ncbi.nlm.nih.gov/cdd (accessed on 5 March 2025)) revealed that OsMYBR1 contains a ribosomal S12-like superfamily domain, a Myb-like DNA-binding domain, and a PLN03212 superfamily domain (Figure 2a). Phylogenetic analysis showed that KAK8457615.1, a ribosomal S12-like superfamily protein in Setaria viridis, shares the highest homology with OsMYBR1 (Figure 2b). However, protein sequence alignment indicates that OsMYBR1 shares only 16% similarity with KAK8457615.1, primarily within the ribosomal S12-like superfamily domain (Figure S2). The closest orthologues in Arabidopsis are NP_195916.1 and AtMYB73; NP_195916.1 shares similarity mainly in the ribosomal S12-like superfamily domain, while AtMYB73 shares similarity primarily in the Myb-like DNA-binding domain (Figures S2 and S3). These results suggest that OsMYBR1 is a specific protein characterized by a ribosomal S12-like superfamily, a Myb-like DNA-binding domain, and a PLN03212 superfamily domain.

Subcellular localization analysis revealed that OsMYBR1-eGFP fluorescence signals were detected in both the cytoplasm and nucleus of rice protoplasts, similar to the free eGFP control (Figure 2c), indicating that OsMYBR1 localizes to both compartments.

3.3. Loss-of-Function of OsMYBR1 Alters Starch Biosynthesis in Rice Endosperm

To investigate OsMYBR1 function, osmybr1 mutants were generated via a CRISP/Cas9 system in the japonica cultivar ‘Nipponbare’. Two homozygous mutants were obtained in T1 generation (Figure 3a,b). DNA sequencing analysis revealed that osmybr1-1 contained a 1 bp insertion, leading to a premature stop codon and a truncated 294-amino acid protein. osmybr1-2 has a 1 bp deletion producing a 260-amino acid truncated protein (Figure S4). Compared with NIP, the chalky grain rate and chalkiness degree of the osmybr1-1 and osmybr1-2 were significantly increased (Figure 3c–e). SEM analysis of mature endosperm cross-sections showed loosely packed, spherical starch granules with large air spaces in mutants, unlike the densely packed, irregular polyhedral granules in NIP (Figure S5). Grain length and width did not differ significantly, but mutant grains were thinner, leading to reduced 1000-grain weight (Figure 3f–i). The results suggest OsMYBR1 influences rice grain appearance and yield.

The amylose content in the osmybr1 mutants was significantly lower compared to the wild type (Figure 3j), while the amylopectin content showed no significant difference (Figure 3k). The total starch content also slightly decreased in the mutants (Figure 3l). Notably, the protein content shows a slight increase in the mutants compared to wild type (Figure 3m). The starch gel consistency did not differ significantly between NIP and osmybr1 mutants (Figure 3n). However, the alkali spreading value (ASV) significantly increased in mutants (Figure 3o), indicating that the loss of OsMYBR1 function made rice more easily gelatinized.

We further analyzed the thermal properties of the two osmybr1 mutants and NIP using differential scanning calorimetry (DSC). Onset temperature indicates the start of amylopectin crystallite melting, while gelatinization enthalpy reflects the heat required for this process [19]. The mutants exhibited significantly lower I onset, peak, and end gelatinization temperatures, as well as decreased gelatinization enthalpy (Figure 3p), suggesting that OsMYBR1 influences rice gelatinization characteristics.

Amylopectin includes chains of the types A, B1, B2, and B3, with size ranges of DP (degree of polymerization) ~6–12, DP = 13 to 24, DP = 25 to 36, and DP ≥ 37, respectively [35]. To assess the impact of osmybr1 mutants on amylopectin structure, we analyzed chain length distribution via high-performance anion-exchange chromatography (HPAEC). The mutants showed a significant reduction in short chains (DP 6–18) and an increase in longer chains (DP 19–52) compared to NIP (Figure 3q). The calculation of the ratios for each type in the amylopectin of NIPand osmybr1 mutants showed that short chains (type A) and short B1 chains were much less prevalent in osmybr1 plants compared to the wild type, while longer B1 chains and long chain B2–3 were more abundant in the osmybr1 plants. The results suggested that the mutation of OsMYBR1 did not affect the content of amylopectin, but influenced its chain length distribution.

3.4. Mutation of OsMYBR1 Affects the Expression of SSEGs

We analyzed OsMYBR1 expression in wild type NIP and osmybr1 mutants, finding significantly lower transcript levels in mutants (Figure 4). Since starch is the main component of rice endosperm and the roles of SSEGs in the process of starch synthesis are well understood, we investigated their expression in both osmybr1 mutants and wild type NIP. Among the 15 endosperm-preferentially expressed SSEGs [22], except for OsAGPS1, OsAGPS2, OsISA2, OsISA3, OsBEⅠ, OsPUL, OsSSⅠ, and OsSSⅡa showed no significant differences in expression levels; the expression levels of genes OsGBSSⅠ and OsAGPL1 was significantly down-regulated, while the expression of OsAGPL2, OsBEⅡb, OsISA1, OsPHOL, and OsSSⅢa were up-regulated in osmybr1 (Figure 4). These results indicated that OsMYBR1 could regulate the development of endosperm by modulating the expression of several genes related to starch synthesis.

3.5. OsMYBR1 Regulates Six SSEGs by Directly Binding to Their Promoters

The qRT-PCR results indicate that several SSEGs (OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa) are regulated by OsMYBR1. We first conducted Y1H and LUC reporter assays to validate this regulation. The Y1H analysis revealed that, except OsSSⅢa, OsMYBR1 could directly bind to the promoters of the other six SSEGs (OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, and OsISA1) (Figure 5a). The LUC results indicated that OsMYBR1 enhances the expression of OsGBSSⅠ while repressing the expression of OsAGPL2, OsISA1, and OsSSⅢa; the other three SSEGs showed no significant change in expression (Figure 5b–h). Additionally, an EMSA analysis confirmed that OsMYBR1 directly binds to the promoter of OsGBSSⅠ (Figure 5i). These results suggest that OsMYBR1 could directly bind to the promoters of six SSEGs (OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, and OsISA1), enhancing the expression of OsGBSSⅠ while repressing the expression of OsAGPL2, OsISA1, and OsSSⅢa.

3.6. Overexpression of OsMYBR1 Enhances Rice ECQ Without Affecting Endosperm Appearance

To evaluate the application value of OsMYBR1, we generated overexpression transgenic lines. Three overexpression lines, OE-7, OE-15, and OE-16, were identified via qRT-PCR (Figure S6). The T2 generations of OE-15 and OE-16, named as OE-MYBR1-1 and OE-MYBR1-2, were planted in the experiment field for phenotype analysis. Compared to NIP, OE lines showed no significant differences in major agronomic traits, grain appearance (chalky grain rate and chalkiness degree), or grain phenotype (grain length and grain width) compared to the NIP (Figure 6a–f). However, grain thickness slightly decreased in the OsMYBR1-overexpression lines, leading to reduced grain weight compared to NIP (Figure 6g,h).

In terms of starch composition, amylose content significantly decreased in the OsMYBR1-overexpression lines compared to NIP (Figure 6i), while amylopectin content significantly increased (Figure 6j). Total starch content in the OsMYBR1-overexpression lines showed a slight increase but was not significant from NIP (Figure 6k). The protein content also showed no significant difference between OsMYBR1-overexpression lines and NIP (Figure 6l). The ASV significantly increased in OsMYBR1-overexpression lines, indicating that these lines gelatinized more easily (Figure 6m). DSC analysis revealed significantly lower conclusion temperature and gelatinization enthalpy, with slight, non-significant decreases in onset and peak temperatures in OsMYBR1-overexpression lines (Figure 6n). These results further demonstrated that the OsMYBR1-overexpression lines gelatinized more easily than NIP. The gel consistency showed no significant difference when compared to NIP (Figure 6o). In summary, the overexpression of OsMYBR1 decreased amylose content and gelatinization temperature while increased amylopectin content, without affecting grain appearance. These findings suggest that OsMYBR1 overexpression could be utilized to improve rice quality.

4. Discussion

MYB family transcription factors regulate diverse processes including secondary metabolism [26], hormone signaling [25,36], and stress response [27]. In maize, MYBs such as ZmMYB14 activate starch synthesis genes including ZmBT1 [29], and ZmMYB138/115 are candidates linked to starch biosynthesis [28]. However, there are few reports on MYB family genes involved in the starch synthesis of rice. This study identified the 1R-MYB transcription factor OsMYBR1 (LOC_Os10g20990) as a regulator of starch synthesis in rice endosperm. OsMYBR1 is a specifical MYB-related protein that contains a ribosomal S12-like superfamily domain, a Myb-like DNA-binding domain, and a PLN03212 superfamily domain, localizing in both the cell nucleus and cytoplasm.

OsMYBR1 regulates amylose content in rice grains. The osmybr1 mutants exhibited significantly lower amylose content (9.7% and 12.9%) compared to wild type NIP (17.0%). The Waxy (Wx) gene, encoding granule-bound starch synthase Ⅰ (OsGBSSⅠ) controls amylose synthesis [6,7,8,9]. Our Y1H, LUC, and EMSA assays demonstrated that OsMYBR1 directly binds to the OsGBSSⅠ promoter and enhances its expression (Figure 5). This was further confirmed by qRT-PCR, indicating that OsMYBR1 mediates amylose biosynthesis in rice by regulating OsGBSSⅠ expression. Loss-of-function of OsMYBR1 reduce expression of OsAGPL1, a subunit of ADP-glucose pyrophosphorylase (AGPase), which is a heterotetramer composed of two large subunits (AGPL) and two small subunits (AGPS) catalyzing the first committed step in starch biosynthesis [3,37,38]. Although OsAGPL2 expression increased, the reduced OsAGPL1 likely impaired the formation of AGPase, leading to decreased ADP-glucose availability for starch synthesis in osmybr1 mutants. Consequently, both starch content and grain yield were reduced.

OsMYBR1 affects the amylopectin chain length distribution. Amylopectin comprises chains classified as types A, B1, B2, and B3, ranging in size from DP ~6–12, DP = 13 to 24, DP = 25 to 36, and DP ≥ 37, respectively [35]. Amylopectin synthesis involves SSs, SBEs, and DBEs, which elongate amylopectin chains, generate branches, and remove improper branches [37]. The role of PHOL remains unclear, with debate over whether it plays a synthetic versus phosphorolytic role in vivo [39]. phol mutants show a higher proportion of short chains (DP ≤ 11) and a lower proportion of intermediate chains (DP 13–21) [39]. BEIIb specifically synthesizes short chains; beIIb mutants increase long branch-chains and reduce short branch-chains [14,15]. OsISA1 is responsible for removing excessive or misplaced branch points in amylopectin. osisa1 mutants show increased short A chains (DP ≤ 12) and intermediate B2 chains (25 ≤ DP ≤ 36), alongside a reduction in B1 (13 ≤ DP ≤ 24) and longer B3 to B4 chains (DP ≥ 37) compared to wild type [16]. Chao et al. [17] found that in isa1 mutants, short chains (DP ≤ 10) increased while longer chains (DP 10–60) decreased. OsSSIIIa is crucial for generating relatively long chains in rice endosperm, especially those with DP ≥ 30 and DP 16 to 20 [12,13]. In osmybr1 mutants, expression of OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa were significantly upregulated, with increases of over 9.5- and 7.5-fold for OsISA1 and OsSSⅢa, respectively. Elevated OsSSⅢa expression may boost the content of long chains (DP ≥ 30), and upregulation of OsISA1 expression can remove excessive or misplaced branch points, increasing the longest B3 to B4 chains (DP ≥ 37). These changes led to higher proportions of longer B1 and B2–3 chains (DP 19–52), and decreased proportions of A chains and short B1 chains (DP 6–18) in osmybr1 mutants (Figure 3q). The changes in amylopectin chain length distribution in osmybr1 mutant (in which OsISA1 and OsSSⅢa were upregulated) were similar to those of OsISA1 and OsSSⅢa, indicating the combined effects of multiple starch synthesis genes.

Mutations in OsMYBR1 altered the physicochemical properties of endosperm starch. The Wx gene is a major regulator of amylose content and gel consistency regulation and also contributes to rice gelatinization temperature [40]. Changes in amylopectin structure can affect starch granules crystallinity, altering the gelatinization property. A chains are critical for crystalline structure formation; alterations in short A chains affect gelatinization [22]. Mutation of BEIIb increases the proportion of long branch-chains, reduces short branch-chains, and raises gelatinization temperature [41]. Conversely, sbe1 mutants exhibit increased short chains, decreased long chains, and lower gelatinization temperature [42]. In osmybr1 mutants, reduced A chains coincided with lower gelatinization temperatures, differing from previous reports, but consistent with Fu et al. [22] for rsr1 mutants, which showed decreased A chains and increased B1 and B2–3 chains.

Amylose content, gel consistency, gelatinization temperature, and viscosity are widely accepted indicators for assessing rice ECQ [40,43]. Our results indicate that osmybr1 mutations decrease amylose content and gelatinization temperature, along with a lower enthalpy (ΔH) value, making starch easier to gelatinize, indicated that the mutation of OsMYBR1 improves rice ECQ. While gel consistency remained unchanged, increased chalkiness and chalky grain rate adversely affected rice appearance, impacting overall rice quality. Overexpression of OsMYBR1 improved rice ECQ without affecting endosperm appearance. We found that overexpression-OsMYBR1 increased the amylopectin and total starch content while decreasing amylose content. This indicates that both OsMYBR1 mutation and overexpression lead to reduced amylose content. This seemingly paradoxical phenomenon has also been reported in other studies. For example, OsSGL (STRESS_tolerance and GRAIN_LENGTH), a DUF1645 domain protein, regulates several starch biosynthesis genes including OsISA1, PHOL, OsAGPL1, OsSBE1, OsBEⅡb, OsSUS1, and OsSSⅡa, thereby balancing starch content in rice seeds. Both the overexpression and knockdown of OsSGL reduced the amylose and starch content in the rice grains [44]. Similarly, SDG711, a histone H3K27me2/3 transmethylase in rice, directly binds to the gene bodies of several starch synthesis and amylase genes. Both the overexpression and downregulation of SDG711 result in decreased amylose and starch content in rice grains [45]. Based on these examples, OsMYBR1 likely functions as a regulator of starch metabolism, maintaining the balance of starch content in rice seeds. OsMYBR1 regulates the expression of seven SSEGs (OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa) (Figure 7), but the mechanism underlying the decrease in amylose content in overexpression lines requires further investigation. Overexpression of OsMYBR1 resulted in an increased alkali spreading value (ASV) and decreased the enthalpy values (ΔH), indicating that the endosperm starch more easily gelatinized, even though gelatinization temperature and 1000-grain weight showed slight decreases. Importantly, starch granule morphology and endosperm appearance remained unchanged in OsMYBR1 overexpression lines. Overall, overexpression of OsMYBR1 can be utilized to improve rice quality by fine-tuning starch synthesis in rice grains. But, when considering biosafety, genome editing offers a safer approach than transgenic overexpression for genetic improvement. Future work will focus on haplotype analysis of OsMYBR1 in rice germplasms and association studies with phenotypes to identify beneficial haplotypes for use in rice breeding.

5. Conclusions

This study identified an 1R-MYB family gene, OsMYBR1, that regulates the expression of seven SSEGs (OsGBSSⅠ, OsAGPL1, OsAGPL2, OsPHOL, OsBEⅡb, OsISA1, and OsSSⅢa), thereby modulating starch biosynthesis in rice endosperm. Overexpression of OsMYBR1 increased amylopectin and total starch content while decreasing amylose content, resulting in a higher alkali spreading value (ASV) and lower enthalpy value (ΔH), indicating that the endosperm starch more easily gelatinized. Despite changes in starch composition and physicochemical properties, starch granule morphology and endosperm appearance were unaffected in OsMYBR1 overexpression lines. Overall, overexpression of OsMYBR1 can be utilized to improve rice ECQ by fine-tuning starch synthesis in rice grains.

Author Contributions

X.W., P.H. and S.T. designed the studies. K.H., L.C., G.J., Z.R. and X.L. performed the experiments. K.H. and X.W. analyzed data. K.H., L.C. and X.W. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data is contained within the article and Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Figures

Figure 1 The expression pattern of OsMYBR1 in rice. (a) The transcripts per million (TPM) value of OsMYBR1 in different tissues of rice. The expression values of OsMYBR1 obtained from RiceData (www.ricedata.cn), in which each gene model was quantified as TPM using Kallisto (v0.51.0). DAP is days after pollination of seeds. (b) qRT-PCR analysis of OsMYBR1 in different tissues and in developing seeds of wild-type NIP. DAF is days after flowering of seeds. The 3DAF, 10DAF, and 18DAF samples collectively represent immature seeds. For rice seeds, DAF is equivalent to DAP.

Figure 2 Prediction of conserved domains in OsMYBR1, phylogenetic analysis of OsMYBR1, and analysis of the subcellular location of OsMYBR1. (a) Search for conserved domains of OsMYBR1 in NCBI (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi (accessed on 5 March 2025)). (b) Phylogenetic tree of OsMYBR1 (in red) and its orthologues. The phylogenetic tree was constructed using the neighbor-joining algorithm and bootstrap method with 1000 replicates. (c) Subcellular localization of OsMYBR1-eGFP in rice protoplasts (bottom panel). Bars = 5 μm.

Figure 3 Phenotypical characterization of osmybr1 and wild type NIP (a). Plant morphology at grain-filling stage (b). Generation of osmybr1 mutants via CRISPR/Cas9-mediated genome editing. The red arrow indicates the target region of OsMYBR1, with the mutated sites highlighted in red. (c). Grains appearance of osmybr1 and NIP (d–i). Comparison of the chalky grain rate (d), chalkiness degree (e), seed length (f), width (g), thickness (h), and 100-grain-weight (i) of osmybr1 and NIP. (j–l), amylose content (j), amylopectin content (k), total starch content (l), and protein content (m) in mature seeds of osmybr1 and NIP (n). Gel consistency of starches from NIP and the osmybr1 mutants (o). Alkali spreading vale in endosperms of NIP and the osmybr1 mutants (p). Differential scanning calorimetry (DSC) analysis: onset temperature (To), peak temperature (Tp), conclusion temperature (Tc), and gelatinization enthalpy (ΔH) (q). Amylopectin chain length distribution differences between NIP and osmybr1. Data presented means ± SD of three replicates. Different letters denote significant differences (p < 0.05, one-way ANOVA with two-sided Tukey’s HSD test).

Figure 4 Expression of starch synthesis enzyme-coding genes in NIP and the osmybr1 mutants analyzed by qRT-PCR. Data represent mean ± SD of three biological replicates. * p < 0.05, ** p < 0.01, Student’s t-test.

Figure 5 OsMYBR1 bind and regulate several SSEG expressions. (a) Yeast one-hybrid assay showing interaction between OsMYBR1 and the promoters of seven SSEGs. (b–h) Transcription assay of OsMYBR1 for OsGBSSI, OsAGPL1, OsAGPL2, PHOL, OsISA1, OsSSⅢa, and OsBEⅡb in rice protoplasts. The LUC reporter genes were driven by ~2 kb upstream promoter regions. Relative luciferase activities (LUC/REN) were measured following co-transfection with effector and reporter plasmids; empty 62SK vector served as negative control. Data represent mean ± SD of three biological replicates. Statistical significance was evaluated using Student’s t-test: p < 0.05 (*), p < 0.01 (**), and ns indicates no significant difference. (i) EMSAs showing OsMYBR1 binding to the OsGBSSI promoter. Black arrowheads indicate the shifted bands (up) and the free probe bands (down). The probe sequence was ‘AGTTGGCAGGCACTAATAGCTACAGTAAAGTAAAGAGCAACGTGCC’.

Figure 6 Phenotypical characterization of wild type NIP and the over-expression OsMYBR1 lines. (a) Plant morphology at grain-filling stage. (b–d): Comparison of grains appearance (b), chalky grain rate (c), and chalkiness degree (d) of NIP and the OsMYBR1 over-expression lines. (e–h): omparison of the seed length (e), width (f), thickness (g), and 100-grain-weight (h) of NIP and the OsMYBR1 over-expression lines. (i–l): Amylose content (i), amylopectin content (j), total starch content (k), and protein content (l) in mature seeds of NIP and the OsMYBR1 over-expression lines. (m) Alkali spreading value in endosperms of NIP and the OsMYBR1 over-expression lines. (n) DSC analysis including onset temperature (To), peak temperature (Tp), conclusion temperature (Tc), and enthalpy of gelatinization (ΔH). (o) Gel consistency of endosperm starch in OsMYBR1 overexpression lines and wild type. All data represent mean ± SD of three replicates (a,c,d,f–n). Different letters denote significant differences (p < 0.05, one-way ANOVA with two-sided Tukey’s HSD test).

Figure 7 A model for the OsMYBR1 regulates the rice starch synthesis.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/life15060962/s1, Figure S1: The expression pattern of MYB family genes; Figure S2. Amino acid sequence alignment of OsMYBR1 with four homologous proteins; Figure S3. Amino acid sequence alignment of OsMYBR1 and three homologous proteins; Figure S4. Amino acid sequence alignment of OsMYBR1, osmybr1-1 and osmybr1-2. The osmybr1-1 mutant contained a 1 bp insertion that introduces a premature stop codon, resulting in a truncated 294-amino acid protein. The osmybr1-2 mutant has a 1 bp deletion, producing a truncated protein of 260-amino acids. Both mutations disrupt the Myb-like binding domain and leads to the loss of the PLN03212 superfamily domain; Figure S5. Scanning electron microscopy images of mature grains in NIP, osmybr1 and overexpression OsMYBR1. Scale bars, 10 μm; Figure S6. qRT-PCR analysis of OsMYBR1 overexpression lines; Table S1: A total of 137 MYB family proteins were identified in rice; Table S2: Primers used in this study.

References

1. Wang, J.; Chen, Z.; Zhang, Q.; Meng, S.; Wei, C. The NAC transcription factors OsNAC20 and OsNAC26 regulate starch and storage protein synthesis. Plant Physiol.; 2020; 184, pp. 1775-1791. [DOI: https://dx.doi.org/10.1104/pp.20.00984] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32989010]

2. Zeeman, S.C.; Kossmann, J.; Smith, A.M. Starch: Its metabolism, evolution, and biotechnological modification in plants. Annu. Rev. Plant Biol.; 2010; 61, pp. 209-234. [DOI: https://dx.doi.org/10.1146/annurev-arplant-042809-112301] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20192737]

3. Huang, L.; Tan, H.; Zhang, C.; Li, Q.; Liu, Q. Starch biosynthesis in cereal endosperms: An updated review over the last decade. Plant Commun.; 2021; 2, 100237. [DOI: https://dx.doi.org/10.1016/j.xplc.2021.100237] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34746765]

4. Jeon, J.S.; Ryoo, N.; Hahn, T.R.; Walia, H.; Nakamura, Y. Starch biosynthesis in cereal endosperm. Plant Physiol. Biochem.; 2010; 48, pp. 383-392. [DOI: https://dx.doi.org/10.1016/j.plaphy.2010.03.006]

5. Jin, S.K.; Xu, L.N.; Leng, Y.J.; Zhang, M.Q.; Yang, Q.Q.; Wang, S.L.; Jia, S.W.; Song, T.; Wang, R.A.; Tao, T. . The OsNAC24-OsNAP protein complex activates OsGBSSI and OsSBEI expression to fine-tune starch biosynthesis in rice endosperm. Plant Biotechnol. J.; 2023; 21, pp. 2224-2240. [DOI: https://dx.doi.org/10.1111/pbi.14124]

6. Zhang, J.S.; Zhang, H.; Botella, J.R.; Zhu, J.K. Generation of new glutinous rice by CRISPR/Cas9-targeted mutagenesis of the Waxy gene in elite rice varieties. J. Integr. Plant Biol.; 2018; 60, pp. 369-375. [DOI: https://dx.doi.org/10.1111/jipb.12620]

7. Fei, Y.; Yang, J.; Wang, F.Q.; Fan, F.J.; Li, W.Q.; Wang, J.; Xu, Y.; Zhu, J.Y.; Zhong, W.G. Production of two elite glutinous rice varieties by editing Wx gene. Rice Sci.; 2019; 26, pp. 118-124.

8. Huang, L.; Li, Q.; Zhang, C.; Chu, R.; Gu, Z.; Tan, H.; Zhao, D.; Fan, X.; Liu, Q. Creating novel Wx alleles with fine-tuned amylose levels and improved grain quality in rice by promoter editing using CRISPR/Cas9 system. Plant Biotechnol. J.; 2020; 18, pp. 2164-2166. [DOI: https://dx.doi.org/10.1111/pbi.13391]

9. Huang, X.; Su, F.; Huang, S.; Mei, F.; Niu, X.; Ma, C.; Zhang, H.; Zhu, X.; Zhu, J.K.; Zhang, J. Novel Wx alleles generated by base editing for improvement of rice grain quality. J. Integr. Plant Biol.; 2021; 63, pp. 1632-1638. [DOI: https://dx.doi.org/10.1111/jipb.13098]

10. Fujita, N.; Yoshida, M.; Asakura, N.; Ohdan, T.; Miyao, A.; Hirochika, H.; Nakamura, Y. Function and characterization of starch synthase I using mutants in rice. Plant Physiol.; 2006; 140, pp. 1070-1084. [DOI: https://dx.doi.org/10.1104/pp.105.071845]

11. Gao, Z.; Zeng, D.; Cheng, F.; Tian, Z.; Guo, L.; Su, Y.; Yan, M.; Jiang, H.; Dong, G.; Huang, Y. . ALK, the key gene for gelatinization temperature, is a modifier gene for gel consistency in rice. J. Integr. Plant Biol.; 2011; 53, pp. 756-765. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21711449]

12. Fujita, N.; Yoshida, M.; Kondo, T.; Saito, K.; Utsumi, Y.; Tokunaga, T.; Nishi, A.; Satoh, H.; Park, J.; Jane, J. . Characterization of SSIIIa-deficient mutants of rice: The function of SSIIIa and pleiotropic effects by SSIIIa deficiency in the rice endosperm. Plant Physiol.; 2007; 144, pp. 2009-2023. [DOI: https://dx.doi.org/10.1104/pp.107.102533] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17586688]

13. Ryoo, N.; Yu, C.; Park, C.S.; Baik, M.Y.; Park, I.M.; Cho, M.H.; Bhoo, S.H.; An, G.; Hahn, T.R.; Jeon, J.S. Knockout of a starch synthase gene OsSSIIIa/Flo5 causes white-core floury endosperm in rice (Oryza sativa L.). Plant Cell Rep.; 2007; 26, pp. 1083-1095. [DOI: https://dx.doi.org/10.1007/s00299-007-0309-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17297616]

14. Ying, Y.; Zhang, Z.; Tappiban, P.; Xu, F.; Deng, G.; Dai, G.; Bao, J. Starch fine structure and functional properties during seed development in BEIIb active and deficient rice. Carbohydr. Polym.; 2022; 292, 119640. [DOI: https://dx.doi.org/10.1016/j.carbpol.2022.119640]

15. Butardo, V.M.; Fitzgerald, M.A.; Bird, A.R.; Gidley, M.J.; Flanagan, B.M.; Larroque, O.; Resurreccion, A.P.; Laidlaw, H.K.C.; Jobling, S.A.; Morell, M.K. . Impact of down-regulation of starch branching enzyme IIb in rice by artificial microRNA- and hairpin RNA-mediated RNA silencing. J. Exp. Bot.; 2011; 62, pp. 4927-4941. [DOI: https://dx.doi.org/10.1093/jxb/err188]

16. Kubo, A.; Fujita, N.; Harada, K.; Matsuda, T.; Satoh, H.; Nakamura, Y. The Starch-Debranching Enzymes Isoamylase and Pullulanase Are Both Involved in Amylopectin Biosynthesis in Rice Endosperm. Plant Physiol.; 1999; 121, pp. 399-410. [DOI: https://dx.doi.org/10.1104/pp.121.2.399]

17. Chao, S.; Cai, Y.; Feng, B.; Jiao, G.; Sheng, Z.; Luo, J.; Tang, S.; Wang, J.; Hu, P.; Wei, X. Editing of Rice isoamylase gene ISA1 provides insights into its function in starch formation. Rice Sci.; 2019; 26, pp. 77-87.

18. Zhu, Y.; Cai, X.L.; Wang, Z.Y.; Hong, M.M. An interaction between a MYC protein and an EREBP protein is involved in transcriptional regulation of the rice Wx gene. J. Biol. Chem.; 2003; 278, pp. 47803-47811. [DOI: https://dx.doi.org/10.1074/jbc.M302806200]

19. Bello, B.K.; Hou, Y.; Zhao, J.; Jiao, G.; Wu, Y.; Li, Z.; Wang, Y.; Tong, X.; Wang, W.; Yuan, W. . NF-YB1-YC12-bHLH144 complex directly activates Wx to regulate grain quality in rice (Oryza sativa L.). Plant Biotechnol. J.; 2019; 17, pp. 1222-1235. [DOI: https://dx.doi.org/10.1111/pbi.13048]

20. Wang, J.C.; Xu, H.; Zhu, Y.; Liu, Q.Q.; Cai, X.L. OsbZIP58, a basic leucine zipper transcription factor, regulates starch biosynthesis in rice endosperm. J. Exp. Bot.; 2013; 64, pp. 3453-3466. [DOI: https://dx.doi.org/10.1093/jxb/ert187]

21. Cao, R.; Zhao, S.; Jiao, G.; Duan, Y.; Ma, L.; Dong, N.; Lu, F.; Zhu, M.; Shao, G.; Hu, S. . OPAQUE3, encoding a transmembrane bZIP transcription factor, regulates endosperm storage protein and starch biosynthesis in rice. Plant Commun.; 2022; 3, 100463. [DOI: https://dx.doi.org/10.1016/j.xplc.2022.100463] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36258666]

22. Fu, F.F.; Xue, H.W. Coexpression analysis identifies Rice Starch Regulator1, a rice AP2/EREBP family transcription factor, as a novel rice starch biosynthesis regulator. Plant Physiol.; 2010; 154, pp. 927-938. [DOI: https://dx.doi.org/10.1104/pp.110.159517] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20713616]

23. Katiyar, A.; Smita, S.; Lenka, S.K.; Rajwanshi, R.; Chinnusamy, V.; Bansal, K.C. Genome-wide classification and expression analysis of MYB transcription factor families in rice and Arabidopsis. BMC Genom.; 2012; 13, 544. [DOI: https://dx.doi.org/10.1186/1471-2164-13-544] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23050870]

24. Gu, M.; Zhang, J.; Li, H.; Meng, D.; Li, R.; Dai, X.; Wang, S.; Liu, W.; Qu, H.; Xu, G. Maintenance of phosphate homeostasis and root development are coordinately regulated by MYB1, an R2R3-type MYB transcription factor in rice. J. Exp. Bot.; 2017; 13, pp. 3603-3615. [DOI: https://dx.doi.org/10.1093/jxb/erx174]

25. Piao, W.; Kim, S.H.; Lee, B.D.; An, G.; Sakuraba, Y.; Paek, N.C. Rice transcription factor OsMYB102 delays leaf senescence by down-regulating abscisic acid accumulation and signaling. J. Exp. Bot.; 2019; 10, pp. 2699-2715. [DOI: https://dx.doi.org/10.1093/jxb/erz095]

26. Zheng, J.; Wu, H.; Zhao, M.; Yang, Z.; Zhou, Z.; Guo, Y.; Lin, Y.; Chen, H. OsMYB3 is a R2R3-MYB gene responsible for anthocyanin biosynthesis in black rice. Mol. Breed.; 2021; 41, 51. [DOI: https://dx.doi.org/10.1007/s11032-021-01244-x]

27. Peng, Y.; Tang, N.; Zou, J.; Ran, J.; Chen, X. Rice MYB transcription factor OsMYB1R1 negatively regulates drought resistance. Plant Growth Regul.; 2023; 99, pp. 515-525. [DOI: https://dx.doi.org/10.1007/s10725-022-00922-w]

28. Hu, Y.; Li, Y.; Weng, J.; Liu, H.; Yu, G.; Liu, Y.; Xiao, Q.; Huang, H.; Wang, Y.; Wei, B. . Coordinated regulation of starch synthesis in maize endosperm by microRNAs and DNA methylation. Plant J.; 2021; 105, pp. 108-123. [DOI: https://dx.doi.org/10.1111/tpj.15043]

29. Xiao, Q.; Wang, Y.; Du, J.; Li, H.; Wei, B.; Wang, Y.; Li, Y.; Yu, G.; Liu, H.; Zhang, J. . ZmMYB14 is an important transcription factor involved in the regulation of the activity of the ZmBT1 promoter in starch biosynthesis in maize. FEBS J.; 2017; 284, pp. 3079-3099. [DOI: https://dx.doi.org/10.1111/febs.14179]

30. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Mol. Biol. Evol.; 2016; 33, pp. 1870-1874. [DOI: https://dx.doi.org/10.1093/molbev/msw054]

31. Kang, H.G.; Park, S.; Matsuoka, M.; An, G. White-core endosperm floury endosperm-4 in rice is generated by knockout mutations in the C-type pyruvate orthophosphate dikinase gene (OsPPDKB). Plant J.; 2005; 42, pp. 901-911. [DOI: https://dx.doi.org/10.1111/j.1365-313X.2005.02423.x] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/15941402]

32. Cruz, N.D.; Khush, G.S. Rice grain quality evaluation procedures. Aromatic Rices; Singh, R.K.; Singh, U.S.; Khush, G.S. Oxford & IBH Publishing Co. Pvt. Ltd.: New Delhi, India, 2000; pp. 15-28.

33. Armstrong, P.R.; Maghirang, E.B.; Chen, M.; McClung, A.M.; Yaptenco, K.F.; Brabec, D.; Wu, T. Predicting single kernel and bulk milled rice alkali spreading value and gelatinization temperature class using NIR spectroscopy. Cereal Chem.; 2022; 99, pp. 1234-1245. [DOI: https://dx.doi.org/10.1002/cche.10587]

34. Zhong, Z.; Zhang, Y. Protoplast isolation and transfection in rice. Methods Mol. Biol.; 2022; 2464, pp. 83-90. [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35258826]

35. Li, C.; Wu, A.; Yu, W.; Hu, Y.; Li, E.; Zhang, C.; Liu, Q. Parameterizing starch chain-length distributions for structure-property relations. Carbohydr. Polym.; 2020; 241, 116390. [DOI: https://dx.doi.org/10.1016/j.carbpol.2020.116390]

36. Woodger, F.J.; Millar, A.; Murray, F.; Jacobsen, J.V.; Gubler, F. The role of GAMYB transcription factors in GA-regulated gene expression. J. Plant Growth Regul.; 2003; 22, pp. 176-184. [DOI: https://dx.doi.org/10.1007/s00344-003-0025-8]

37. Pfister, B.; Zeeman, S.C. Formation of starch in plant cells. Cell. Mol. Life Sci.; 2016; 73, pp. 2781-2807. [DOI: https://dx.doi.org/10.1007/s00018-016-2250-x]

38. Lee, S.-K.; Hwang, S.-K.; Han, M.; Eom, J.-S.; Kang, H.-G.; Han, Y.; Choi, S.-B.; Cho, M.-H.; Bhoo, S.H.; An, G. . Identification of the ADP-glucose pyrophosphorylase isoforms essential for starch synthesis in the leaf and seed endosperm of rice (Oryza sativa L.). Plant Mol. Biol.; 2007; 65, pp. 531-546. [DOI: https://dx.doi.org/10.1007/s11103-007-9153-z]

39. Satoh, H.; Shibahara, K.; Tokunaga, T.; Nishi, A.; Tasaki, M.; Hwang, S.K.; Okita, T.W.; Kaneko, N.; Fujita, N.; Yoshida, M. . Mutation of the plastidial alpha-glucan phosphorylase gene in rice affects the synthesis and structure of starch in the endosperm. Plant Cell; 2008; 20, pp. 1833-1849. [DOI: https://dx.doi.org/10.1105/tpc.107.054007]

40. Wang, J.D.; Wang, J.; Huang, L.C.; Kan, L.J.; Wang, C.X.; Xiong, M.; Zhou, P.; Zhou, L.H.; Chen, C.; Zhao, D.S. . ABA-mediated regulation of rice grain quality and seed dormancy via the NF-YB1-SLRL2-bHLH144 Module. Nat. Commun.; 2024; 15, 4493. [DOI: https://dx.doi.org/10.1038/s41467-024-48760-w]

41. Nishi, A.; Nakamura, Y.; Tanaka, N.; Satoh, H. Biochemical and genetic analysis of the effects of Amylose-extender mutation in rice endosperm. Plant Physiol.; 2001; 127, pp. 459-472. [DOI: https://dx.doi.org/10.1104/pp.010127]

42. Satoh, H.; Nishi, A.; Yamashita, K.; Takemoto, Y.; Tanaka, Y.; Hosaka, Y.; Sakurai, A.; Fujita, N.; Nakamura, Y. Starch-branching enzyme I-deficient mutation specifically affects the structure and properties of starch in rice endosperm. Plant Physiol.; 2003; 133, pp. 1111-1121. [DOI: https://dx.doi.org/10.1104/pp.103.021527] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/14526120]

43. Zhang, C.; Zhou, L.; Zhu, Z.; Lu, H.; Zhou, X.; Qian, Y.; Li, Q.; Lu, Y.; Gu, M.; Liu, Q. Characterization of grain quality and starch fine structure of two japonica rice (Oryza sativa) cultivars with good sensory properties at different temperatures during the filling stage. J. Agric. Food Chem.; 2016; 64, pp. 4048-4057. [DOI: https://dx.doi.org/10.1021/acs.jafc.6b00083] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/27128366]

44. Liu, Z.; Jiang, S.; Jiang, L.; Li, W.; Tang, Y.; He, W.; Wang, M.; Xing, J.; Cui, Y.; Lin, Q. . Transcription factor OsSGL is a regulator of starch synthesis and grain quality in rice. J. Exp. Bot.; 2022; 73, pp. 3417-3430. [DOI: https://dx.doi.org/10.1093/jxb/erac068] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/35182423]

45. Liu, X.; Luo, J.; Li, T.; Yang, H.; Wang, P.; Su, L.; Zheng, Y.; Bao, C.; Zhou, C. SDG711 Is Involved in Rice Seed Development through Regulation of Starch Metabolism Gene Expression in Coordination with Other Histone Modifications. Rice; 2021; 14, 25. [DOI: https://dx.doi.org/10.1186/s12284-021-00467-y]