Monitoring and robust induction of nephrogenic intermediate mesoderm from human pluripotent stem cells

Abstract

A method for stimulating the differentiation of human pluripotent stem cells into kidney lineages remains to be developed. Most cells in kidney are derived from an embryonic germ layer known as intermediate mesoderm. Here we show the establishment of an efficient system of homologous recombination in human pluripotent stem cells by means of bacterial artificial chromosome-based vectors and single-nucleotide polymorphism array-based detection. This system allowed us to generate human-induced pluripotent stem cell lines containing green fluorescence protein knocked into OSR1, a specific intermediate mesoderm marker. We have also established a robust induction protocol for intermediate mesoderm, which produces up to 90% OSR1(+) cells. These human intermediate mesoderm cells can differentiate into multiple cell types of intermediate mesoderm-derived organs in vitro and in vivo, thereby supplying a useful system to elucidate the mechanisms of intermediate mesoderm development and potentially providing a cell source for regenerative therapies of the kidney.

ARTICLE

Received 11 Jul 2012 | Accepted 12 Dec 2012 | Published 22 Jan 2013

Shin-Ichi Mae1,*, Akemi Shono1,*, Fumihiko Shiota1, Tetsuhiko Yasuno1, Masatoshi Kajiwara1, Nanaka Gotoda-Nishimura1, Sayaka Arai1, Aiko Sato-Otubo2, Taro Toyoda1, Kazutoshi Takahashi1, Naoki Nakayama3, Chad A. Cowan4,5, Takashi Aoi1, Seishi Ogawa2, Andrew P. McMahon6, Shinya Yamanaka1,7,8,9 & Kenji Osafune1,8,10

A method for stimulating the differentiation of human pluripotent stem cells into kidney lineages remains to be developed. Most cells in kidney are derived from an embryonic germ layer known as intermediate mesoderm. Here we show the establishment of an efcient system of homologous recombination in human pluripotent stem cells by means of bacterial articial chromosome-based vectors and single-nucleotide polymorphism array-based detection. This system allowed us to generate human-induced pluripotent stem cell lines containing green uorescence protein knocked into OSR1, a specic intermediate mesoderm marker. We have also established a robust induction protocol for intermediate mesoderm, which produces up to 90% OSR1 cells. These human intermediate mesoderm cells can differentiate into multiple cell types of intermediate mesoderm-derived organs in vitro and in vivo, thereby supplying a useful system to elucidate the mechanisms of intermediate mesoderm development and potentially providing a cell source for regenerative therapies of the kidney.

1Center for iPS Cell Research and Application, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 2Cancer Genomics Project, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8655, Japan. 3Centre for Stem Cell Research, Brown Foundation Institute of Molecular Medicine, The University of Texas Health Science Center at Houston, 1825 Pressler Street, Houston, Texas 77030, USA. 4Harvard Stem Cell Institute, 42 Church Street, Cambridge, Massachusetts 02138, USA. 5Department of Molecular and Cellular Biology, Department of Stem Cell and Regenerative Biology, Harvard University, 7 Divinity Avenue, Cambridge, Massachusetts 02138, USA. 6Department of Stem Cell Biology and Regenerative Medicine, Eli and Edythe Broad-Center for Regenerative Medicine and Stem Cell Research, Keck School of Medicine of the University of Southern California, Los Angeles, California 90089, USA. 7Institute for Integrated CellMaterial Sciences, Kyoto University, 53 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. 8JST Yamanaka iPS Cell Special Project, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012, Japan. 9Gladstone Institute of Cardiovascular Disease, San Francisco, California 94158, USA. 10PRESTO, Japan Science and Technology Agency, 4-1-8 Honcho, Kawaguchi, Saitama 332-0012, Japan. *These authors contributed equally to this work. Correspondence and requests for materials should be addressed to K.O. (email: mailto:[email protected]

Web End [email protected] ).

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 1

& 2013 Macmillan Publishers Limited. All rights reserved.

DOI: 10.1038/ncomms2378

Monitoring and robust induction of nephrogenic intermediate mesoderm from human pluripotent stem cells

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378

The kidneys have highly differentiated and complicated structures, and have pivotal roles in many physiological processes, such as the regulation of uid and electrolyte

balance, body uid osmolality, the acidbase balance, the excretion of metabolic waste products and foreign chemicals, and the production of hormones controlling blood pressure and erythropoiesis. Once damaged, kidneys rarely recover their functions. The renal tubules can regenerate to some extent in the case of acute tubular necrosis, but kidneys generally do not regenerate in patients with chronic kidney diseases1. This failure to fully regenerate cause the progression to end-stage renal insufciency. An increasing number of patients suffer from end-stage renal disease2, and there is a shortage of donor kidneys for transplantation around the world. Most of the patients must undergo dialysis therapy for the remainder of their lives, which causes both medical and medico-economical problems.

To overcome this problem, kidney regeneration using embryonic stem cells (ESCs)35 or induced pluripotent stem cells (iPSCs)68, which have an unlimited self-renewal capability and the potential to differentiate into any cell type in the body, is a valuable alternative. The induction of renal lineage cells has been performed using mouse ESCs, while a method to induce the differentiation of human pluripotent stem cells (hPSCs) into the renal lineage has not yet been fully established915. Kidneys are derived from the intermediate mesoderm (IM), and Odd-skipped related 1 (Osr1) is one of the earliest markers specic for IM, although the expression also extends into the lateral plate mesoderm at early stages in mouse, chick and sh embryos1618. The differentiation of PSCs into OSR1-expressing IM cells is the rst step toward the induction of renal lineage cells.

In our present study, we initially constructed bacterial articial chromosome (BAC)-based vectors and transduced them into hiPSCs to obtain reporter hiPSC lines for an IM marker gene, OSR1, by homologous recombination. By using these lines and conducting combinational treatments with growth factors, we have established a robust induction protocol for IM, which produces up to 90% OSR1 cells. We have also conrmed that these hiPSC-derived IM cells have similar developmental potential to those found in embryos, and that they can differentiate into multiple cell types included in IM-derivative organs, such as the kidneys, gonads and adrenal cortex

ResultsGeneration of OSR1-GFP knock-in hiPSC lines. We initially constructed a conventional targeting vector with 5 and 3 kb homologous arms to generate OSR1-GFP reporter hiPSC lines to monitor their differentiation into IM, but did not obtain a homologous recombinant in the more than 1,300 drug-resistant clones we examined (data not shown). Therefore, we adopted a strategy using BAC-based vectors shown in Fig. 1a to establish OSR1-GFP knock-in lines. A previously derived hiPSC line, 201B7 (ref. 7), was used as a parental line. Notably, four clones, 3D36, 3D45, 3F3 and 3I49, were selected as candidate lines with homologous recombination from B130 drug-resistant clones by using a Taqman quantitative PCR (qPCR) analysis to detect the loss of an OSR1-coding region, which was replaced by a GFP-Neo cassette (Fig. 1b).

A single-nucleotide polymorphism (SNP) array analysis was utilized to examine the copy number of the OSR1 gene, and this indicated that the four clones had two loci, one of which was intact except for the GFP-Neo inserted region, whereas non-candidate clones, such as 3D12, showed three copies (Fig. 2a). Thus, the SNP array analysis conrmed the generation of four knock-in lines. This analysis also showed no other apparent genetic alterations, except that clone 3I49 has a copy number

variation in chromosome 9 (Fig. 2b, arrows). The G-banding analysis of the four clones showed a normal karyotype (Supplementary Fig. S1). The Neo cassette was excised at the anking loxP sites by transient expression of Cre-recombinase, and the elimination was conrmed by genomic PCR (Fig. 1c).

Next, OSR1 cells were induced from the four lines by spontaneous differentiation using embryoid body (EB) formation without any inducing factors, and then were isolated by ow cytometry for RTPCR (PCR with reverse transcription) analyses, which showed that only GFP cells expressed OSR1 in all four lines (Fig. 1d,e). Moreover, in situ hybridization analyses of clone 3D45 using OSR1 probes showed that almost all GFP cells expressed OSR1 transcripts, whereas the GFP cells did not, thereby conrming the correlation between GFP and OSR1 expression (Fig. 1f). These results suggested that OSR1-GFP knock-in hiPSC lines had been efciently generated using BAC-based vectors and the detection systems for homologous recombinants using the Taqman qPCR and SNP array analyses, and that these reporter lines can be used for monitoring OSR1 cells differentiated from hiPSCs.

Establishment of robust induction methods of IM cells. To establish protocols for the differentiation of IM from hPSCs, we examined the effects of B40 different growth factors on hESC differentiation and found that bone morphogenetic protein (BMP) 7 was the most potent inducer of OSR1 expression (Supplementary Fig. S2). We next examined the mesendoderm (ME) induction step before BMP7 treatment to increase the efciency of IM differentiation. We used 100 ng ml 1 of activin

A and Wnt3a to differentiate hPSCs into ME cells, as the factors had previously been shown to induce the differentiation from PSCs19,20. As expected, the treatment induced EBs from an OSR1 reporter hiPSC line, 3D45, to express ME markers, BRACHYURY, GSC and MIXL1, but not ectodermal (SOX1 and PAX6) or endodermal (SOX17 and FOXA2) marker expression (Supplementary Fig. S3a). Adding either or both SB431542 (an inhibitor of TGFb receptor kinase) and Frizzled-Fc chimeric protein (an antagonist of the Wnt pathway) decreased the expression of BRACHYURY, thus conrming the involvement of activin A and Wnt signalling in the ME differentiation (Supplementary Fig. S3b).

For IM induction, we conrmed that the combination of the ME induction step (Stage 1) and subsequent BMP7 treatment (Stage 2) produced higher OSR1 expression than BMP7 treatment alone, and also found that the addition of Wnt3a to BMP7 in Stage 2 led to even higher expression than BMP7 alone (Fig. 3a,b). The suppression of OSR1 expression by adding either or both Noggin (an antagonist of BMPs) and Frizzled-Fc chimeric proteins suggested that BMP7 and Wnt3a signals are essential for the induction of OSR1-expressing cells (Fig. 3c).

We next analysed the temporal expression pattern of OSR1 by qRTPCR and found a gradual increase, with a peak at culture day 19 (Fig. 4a). Flow cytometric analyses using 3D45 showed the induction rate of OSR1 cells to increase up to more than 40%

on day 19, which was consistent with the qRTPCR results (Fig. 4b).

We next examined the substitution of CHIR99021, a specic inhibitor of glycogen synthase kinase (GSK) 3b that activates canonical Wnt signalling, for Wnt3a in the differentiation protocol (Supplementary Fig. S4). OSR1 cells were more efciently induced with 1 mM CHIR99021 than with 100 ng ml 1 Wnt3a. In addition, 6-bromoindirubin-30-oxime, another GSK3b inhibitor, showed similar effects on the differentiation (data not shown). These results suggest that the Wnt3a protein can be replaced by synthetic GSK3b inhibitors,

2 NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378 ARTICLE

a

b

E. coli cells with a BAC clone containing the OSR1 gene

pRed/ET

1.5

0 3D12

OSR1

BAC clone (RP11-458J18)

ATG

1 2 3

1

ATG

Fold

Primer Primer

750 bp

0.5

Wild-type

3D36

3D45

3F3

3I49

201B7

Taqman probe

Red/ET-mediated recombination

Targeting vector

GFP

pA

PGK-Neo-pA

c

750 bp

ATG

loxP loxP

Targeting vector

OSR1 GFPNeo

OSR1 GFP

+ Cre recombinase

GFP

pA

PGK-Neo-pA

Homologous recombination

GFP

pA

PGK-Neo-pA

Cre + + + +

201B7

3D36 3D45 3F3 3I49

GFP

pA

Primer Primer

GFP

pA

PGK-Neo-pA

d

e

f

GFP nuclei

105

EGFP

OSR1

104

103

GFP

GFP(+)GFP()

OSR1(ISH) Nuclei

()

[afii9826]-ACTIN

+ + + +

102

(+)

3D36 3D45 3F3 3I49

102 103 104 105

OSR1(GFP)+

Figure 1 | Generation of OSR1-GFP knock-in hiPSC lines. (a) A schematic representation of the targeting strategy using BAC-based vectors to produce OSR1-GFP knock-in hiPSC lines. A part of the OSR1 cording region was replaced by EGFP and PGK-Neo cassettes. The black boxes represent three exons of the OSR1 gene. (b) The Taqman qPCR analysis of genomic DNA from the drug-resistant lines and the parental line (201B7). Note that a value of 1 indicates two intact OSR1 loci, while 0.5 suggests one intact and one targeted locus. 3D12 is a drug-resistant clone without homologous recombination. The Taqman probe and the primer pair indicated in a (red bars) was used. The data from three independent experiments are presented as the means.d. (n 3).

(c) Genomic PCR was used to conrm the removal of the Neo cassette by Cre recombination. The primer pair indicated in a (black bars) was used. (d) The ow cytometric analysis of OSR1 (GFP) cells on culture day 16 of spontaneously differentiating EB without any inducing factors. (e) The results of the

RTPCR analyses of the GFP and GFP populations isolated on day 16 that were shown in d. (f) In situ hybridization (ISH) analysis using specic probes against OSR1 and immnostaining using antibodies against GFP on the GFP and GFP cells on culture day 16. Scale bars, 100 mm.

and that the canonical Wnt pathway is involved in IM differentiation.

The complexity of EBs and the contamination of feeder cells make it difcult to analyse the molecular signals and cellular interactions involved in differentiation processes. We therefore tested the same inducing factors in two-dimensional monolayer culture without feeder layers (colony method, Supplementary Fig. S5). OSR1 cells were produced under these conditions with either of Wnt3a or CHIR99021, although the induction rate (about 15% on day 11) was lower than that with EB-based three-dimensional culture (EB method, Fig. 4).

To improve the induction efciency, we created a novel two-dimensional culture system, in which hPSCs were gently dissociated into single cells with Accutase, and the addition of a ROCK inhibitor (Y27,632) increased the survival and differentiation of single hPSCs (single-cell method). Notably, the induction rate of OSR1 cells at culture day 11 increased up to 90% when 3 mM CHIR99021 was used with activin A at Stage 1 and BMP7 at Stage 2 (Fig. 5a and Supplementary Fig. S6a). These results were conrmed by qRTPCR analysis of OSR1 expression and in situ hybridization using OSR1 probes (Fig. 5b and

Supplementary Fig. S6b). The single-cell method more efciently induced OSR1 cells and produced more than 10-fold higher

OSR1 expression than the EB or colony methods (Fig. 5c,d and Supplementary Fig. S7a), which was consistent with the ow cytometric ndings that the protocol more frequently generated cells expressing high levels of OSR1 than other methods (Supplementary Fig. S7b).

Different hESC lines have been shown to vary in their differentiation potential21. The induction protocols for IM cells was tested on three additional hiPSC lines, 201B6 (ref. 7), 253G1 and 253G4 (ref. 22), and three hESC lines, H9 (ref. 5), khES1 and khES3 (ref. 23) (Fig. 5e and Supplementary Fig. S8). Importantly, the single-cell method induced similar expression levels of OSR1 from all the hPSC lines examined, whereas the EB method was not applicable for one of the hiPSC lines, 253G4.

To establish a well-dened differentiation method of PSCs would provide an excellent system for studying the molecular mechanisms underlying differentiation. We therefore devised a serum-free differentiation method by replacing both fetal bovine serum (FBS) used in Stage 1 and knockout serum replacement (KSR) in Stage 2 of the single-cell method with B27 supplement.

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 3

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378

a

b

Chromosome 2

3I49

3I49

Chromosome 9

3D12

Total CN

Total CN (average)

AsCN

2 copies

2 copies

1 copy

OSR1 locus OSR1 locus

Total CN

Total CN 3 copies

2 copies

3D45

3F3

Total CN

Total CN

Total CN

3D36

2 copies

2 copies

2 copies

2 copies

Figure 2 | SNP array analysis of OSR1-GFP reporter hiPSC lines. (a) The copy number (CN) of OSR1 gene loci was analysed by the number of SNPs in the ve reporter hiPSC lines; 3D36, 3D45, 3F3, 3I49 and 3D12. Genomic DNA from the parental line (201B7) and the ve reporter lines was analysed by GeneChip Mapping 250K NSP arrays. The genomic CNs, including AsCNs, were calculated using the CNAG/AsCNAR software program. On each panel, the red dots and y axis represent the signal intensity of each SNP probe, and CNs (black lines) were detected using a hidden Markov model-based algorithm implemented in the CNAG/AsCNAR software program. CNs were normalized to the samples of 201B7. Note that 3D36, 3D45, 3F3 and 3I49 (CN 2) are knock-in lines with homologous recombination, whereas 3D12 (CN 3) is a drug-resistant transgenic line without

homologous recombination. (b) The copy number variation in chromosome 9 (black arrows) of a reporter hiPSC line, 3I49. The blue line in the upper middle represents the averaged total CNs, and heterozygous SNP calls are marked with the green bars beneath the chromosomes shown as white, grey and black boxes in the bottom middle. The red and green lines in the bottom represent the moving average of AsCNs.

The induction efciency of OSR1 cells in the rened protocol (serum-free single-cell method) was about 90% and comparable to the original single-cell method (Fig. 5f,g).

The OSR1 cells that were differentiated using the single-cell method and isolated on culture day 11 expressed some of the

PAX2, LIM1, WT1, CITED2, EYA1 and SALL1 genes, which are known to be expressed in cells of IM or kidney lineage10, and the cells expressed all of the markers after an additional 57 days of culture with 100 ng ml 1 BMP7 and 100 ng ml 1 Wnt3a or 13 mM CHIR99021 (Fig. 5h). The gene expression patterns of the OSR1 cells isolated on day 11 that were generated using the single-cell method and the cells on day 18 (11 7) were similar to

that of embryonic day (E) 8.5 Osr1 IM and E11.5 Osr1 metanephric cells obtained from Osr1-GFP knock-in mice18, respectively (Fig. 5h). Some OSR1 cells were positive for PAX2,

WT1 or SALL1 by immunostaining, which was similar to the ndings observed in the IM cells of mouse embryos (Fig. 5i and Supplementary Fig. S9). Although the weak expression of a hematopoietic lineage marker, CD41, was detected (Supplementary Fig. S10), these results suggested that the novel monolayer culture with single-cell dissociation can efciently generate OSR1 cells, and that most of these cells might therefore represent IM.

We next examined the applicability of our induction protocols to mouse PSC (mPSC) lines using two iPSC lines, 492B-4 (ref. 24) and 20D-17 (ref. 25), and two ESC lines, D3 and J1 (Fig. 6). In contrast to hPSCs, the EB method did not signicantly stimulate the Osr1 expression in any of the four mouse lines. As retinoic acid (RA) was previously used for the renal lineage differentiation of mouse ESCs10, we examined the effect of adding RA to the differentiation culture and observed the enhancement of Osr1 expression. However, adding RA to the hPSC differentiation culture did not show any advantageous effects on the IM induction (Supplementary Fig. S11). These results suggest that

our differentiation protocols for generating IM cells can be applicable to multiple hPSC lines and that the addition of RA enhances the IM induction from mPSCs.

Characterization of developmental potential of human IM cell. During mouse development, Osr1 IM cells contribute to renal, gonadal and adrenocortical cells18. After culturing the OSR1 cells isolated on culture day 11 using the single-cell method for an additional 7 days with 100 ng ml 1 BMP7 and 100 ng ml 1

Wnt3a or 13 mM CHIR99021, the expression of marker genes for various IM-derived organs was elevated, including RET, SALL4 and HOXB7 for nephric duct and ureteric bud, SIX2 and HOXD11 for metanephric mesenchyme, FOXD1 for metanephric stroma, AQUAPORIN 1 (AQP1), PODOCALYXIN and E-CADHERIN for the adult kidney, and DAX1, LHX9, SF1, GATA4, GATA6 and HSD3b2 for gonadal or adrenocortical cells (Fig. 7a). We also found cells that were positive for metanephric kidney markers, such as Lotus tetragonobulus lectin (LTL) and AQP1 for proximal renal tubule, peanut agglutinin and PODOCALYXIN for glomerulus, aSMA for smooth muscle,

Dolichos biorus agglutinin (DBA) and SALL4 for ureteric bud, and epithelial markers, CYTOKERATIN and E-CADHERIN (Fig. 7b and Supplementary Table S1). The OSR1 cells also differentiated into cells that stained positively for gonadal or adrenocortical markers, GATA4, GATA6 and

HSD3b (Fig. 7b).

To assess the developmental potential of hiPSC-derived IM cells in vivo, we transplanted day 11 OSR1 cells generated with single-cell method into the epididymal fat pads (EFPs) of immunodecient mice (NOD. CB17-Prkdcscid/J). At 4 weeks after transplantation, grafts from nine independent experiments contained cells immunoreactive for renal markers, such as AQP1, LTL, E-CADHERIN and DBA (Fig. 7c) without developing either

4 NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378 ARTICLE

c

1: BW

2: Frizzeled-Fc

3: Noggin-Fc

4: Frizzeled-Fc+ Noggin-Fc

a

105

1: No factors 2: BB 3: AWB

1.20.3% 10.12.9% 18.73.8%

105

105

105

104

104

104

104

103

103

103

103

102

102

102

102

102 103 104 105

102 103 104 105 102 103 104 105 102 103 104 105

102 103 104 105

22.53.6%

15.82.3%

10.32.0%

3.21.9%

OSR1(GFP)+

2: No factors 3: W100 4: B100

105

b

1: Day 1

1.81.0%

0% 2.20.5% 13.15.3%

104

105

105

105

105

103

104

104

104

104

102

103

103

103

103

102 103 104 105

102

102

102

102

102 103 104 105 102 103 104 105 102 103 104 105

105

OSR1(GFP)+

5: B100W25 6: B10W100 7: B100W100

104

105

105

105

103

19.12.7% 6.15.2% 23.85.2%

104

104

104

102

103

103

103

102 103 104 105

102

102

102

102

103

104

105

102 103 104 105 102 103 104 105

105

OSR1(GFP)+

104

103

102

102 103 104 105

OSR1(GFP)+

Figure 3 | Differentiation of hiPSCs into the intermediate mesoderm. (a) Flow cytometric analyses of OSR1(GFP) cell differentiation on culture day 11. 1: no factors; 2: 100 ng ml 1 BMP7; 3: Stage 1, 100 ng ml 1 activin A 100 ng ml 1 Wnt3a, Stage 2, 100 ng ml 1 BMP7. (b) The differentiation of

OSR1(GFP) cells on culture day 11, analysed by ow cytometry. 1: on day 1 before treatments; 2: no factors; 37: Stage 1, 100 ng ml 1 activinA 100 ng ml 1 Wnt3a. The treatments at stage 2 are as follows, 3: 100 ng ml 1 Wnt3a; 4: 100 ng ml 1 BMP7; 5: 100 ng ml 1 BMP7 25 ng ml 1

Wnt3a; 6: 10 ng ml 1 BMP7 100 ng ml 1 Wnt3a; 7: 100 ng ml 1 BMP7 100 ng ml 1 Wnt3a. (c) The suppression of the induction efciency of

OSR1(GFP) cells on culture day 11 by adding Frizzled- and/or Noggin-Fc chimeric proteins to the treatment with 100 ng ml 1 BMP7 100 ng ml 1

Wnt3a at Stage 2. The treatment at Stage 1 is 100 ng ml 1 activin A 100 ng ml 1 Wnt3a in all experiments. 1: without Frizzled- or Noggin-Fc; 2:

1 mg ml 1 Frizzled-Fc; 3: 1 mg ml 1 Noggin-Fc; 4: 1 mg ml 1 Frizzled-Fc 1 mg ml 1 Noggin-Fc. The data from three independent experiments are

presented as the meanss.d. (n 3).

teratomas or forming lineage cells other than IM derivatives (Supplementary Fig. S10).

The ability of hiPSC-derived OSR1 cells to differentiate into polarized epithelia with tubular structures was examined by coculturing the cells with mouse metanephric cells in organ culture experiments, as described previously26. We found that the OSR1 cells evaluated after treatment with 10 ng ml 1 TGFb1 for an additional 7 days were integrated into mouse metanephric tissues to form renal structures. Some of the OSR1 IM-derived cells constituted polarized tubule-like structures, which were positive for both a proximal tubule marker (LTL) and LAMININ, a marker for polarized epithelia (Fig. 7d). We examined a total of 354 organ culture samples (162 with hiPSC-derived OSR1 cells

and 192 with control untreated hiPSCs) and found that human LTL LAMININ tubule-like structures originated from

OSR1 IM cells in 8 organ culture samples out of 162 (4.94%). On the other hand, when we cocultured untreated hiPSCs with mouse metanephric cells, the human cells did not form kidney-like structures or express any of the markers (n 192; 0%;

P 0.0017). We found only a few human DBA ureteric bud

lineage cells differentiated from hiPSC-derived OSR1 cells in the organ cultures (Supplementary Fig. S12). These data suggest that IM cells induced from hPSCs using our differentiation protocols can differentiate into IM derivatives in vitro and in vivo, and also indicated that they have the developmental potential to contribute to three-dimensional renal structures.

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 5

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378

a

500 OSR1

No factors

AWBW

400

Expression level

(fold change)

300

200

100

0 Day 3

Day 7

Day 11

Day 15

Day 19

Day 23

Day 1 Day 3 Day 7 Day 11 Day 19

2.60.7%

0.90.2%

0%

b

105

105

105

105

105

0% 3.11.1%

104

104

104

104

104

No factors

103

103

103

103

103

102

102

102

102

102 103 104 105

102

102 103 104 105

102 103 104 105

102 103 104 105

102 103 104 105

105

105

105

105

1.80.4%

0% 22.02.7% 46.56.6%

102 103 104 105

104

104

104

104

AWBW

103

103

103

103

102

102

102

102

102

103

104

105

102 103 104 105

102 103 104 105

OSR1(GFP)+

Figure 4 | Differentiation pattern of OSR1 cells using the EB-based induction method. (a) The time course analysis of OSR1 expression. Each value was normalized to the samples on day 1 before treatments. White bars: no factors; black bars (AW-BW): Stage 1, 100 ng ml 1 activin A 100 ng ml 1

Wnt3a; Stage 2, 100 ng ml 1 BMP7 100 ng ml 1 Wnt3a. Note that the OSR1 expression on day 3 is so low that the histogram bars are at the baseline.

(b) The differentiation course of OSR1(GFP) cells was analysed by ow cytometry. The data from three independent experiments are presented as the meanss.d. (n 3) in a and b.

DiscussionGene targeting in hPSCs has proven to be technically difcult, and around 20 genes have so far been successfully targeted in hPSCs27. The efcient gene targeting in hPSCs has been performed using zinc-nger nucleases27, transcription activator-like effector nucleases28 or adeno-associated viruses29,30. BAC-based approaches were also used to disrupt both alleles of ATM or p53 by sequential targeting in hESCs31. We have herein extended these ndings to generate GFP reporter lines in hiPSCs, which can be used for monitoring the differentiation of the cell lines. We have also made use of the combination of Taqman qPCR and SNP array analyses to detect homologous recombinants. The BAC-based strategy has led to the efcient targeting of 3% of drug-resistant clones. As BAC clones contain the entire length of target genes, it was speculated that longer homologous arms from BAC-based vectors might more efciently induce homologous recombination. Our results indicate the applicability of BAC-mediated strategies to target genes in hPSCs.

Several studies conducted on the differentiation of ESCs into IM and kidney lineages have demonstrated the difculty of isolating and examining the differentiated cells915. The generation of reporter lines in this study enables the quantitative monitoring of the IM differentiation from hiPSCs, and also allowed us to examine the gene expression and the developmental potential of puried IM cells. Two-dimensional

cultures are simple differentiation formats suitable for studying developmental mechanisms and for screening drug compounds. The reporter lines and induction methods established in this study (Fig. 8) could provide powerful tools for elucidating the mechanisms of IM and kidney lineage commitment.

The iPSC technology enables the creation of patient-derived hPSC lines and in vitro disease models for studying the pathophysiology and for identifying therapeutic drug compounds. Other clinical applications include the use of iPSC-derived cells for replacement therapy and in vitro toxicology studies32. However, the efciency and frequency of generating the differentiated renal cell types, such as glomerular podocytes and renal tubular cells, or three-dimensional renal structures from hPSC-derived IM cells in this study is low and not sufcient to be used in the development of these strategies. Therefore, the next step in developing new strategies for the treatment of kidney diseases will require subsequent studies to develop both specic and efcient methods to differentiate hPSC-derived IM cells into renal lineage cells, by modifying the induction protocols established in our current study. In addition, the targeted protocols to differentiate IM cells into other IM derivatives, such as adrenal cortex and gonad, should be devised as well for regenerative medicine strategies in the elds of endocrinology and reproductive medicine.

6 NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378 ARTICLE

a b OSR1

No factors

ACBC

Day 1 Day 3 Day 7 Day 11 Day 15

0%

Expression level

(fold change)

800

600

400

200

0

0% 95.02.2%

39.76.2%

94.40.6%

OSR1(GFP)+

Day 1 Day 3 Day 7 Day 11 Day 15

c

EB method

Single cell method

Colony method

1 M CHIR99021

d OSR1

3 M CHIR99021

19.84.6% 36.07.3% 58.37.3% 92.81.7%

100 ng ml1

Wnt3a

3 M CHIR99021

3 M CHIR99021

1 M CHIR99021

14.50.9%

14.71.2%

Expression level

(fold change)

40

30

20

10

0

EB method 100 ng ml

Wnt3a

EB method 3 m CHIR99021

Colony

method3 m CHIR99021

Single-cell method

3 m CHIR99021

OSR1(GFP)+

e OSR1

f

h i

Day 16(11+5)Day 11

1.5

800

400

0

Expression level

(fold change)

OSR1

PAX2

EYA1

[afii9826]-ACTIN

SALL1

1

OSR1(GFP) Nuclei

PAX2 Nuclei

WT1 Nuclei

SALL1 Nuclei

Single-cell method

Serum-free single-cell method

OSR1(GFP)+

Osr1

Pax2

Eya1

[afii9826]-Actin

Sall1

92.51.8%

92.80.8%

0.5

10

10

Lim1

Wt1

LIM1

WT1

0

253G1

253G4

khES1

10

10

3D45(201B7)

201B6

khES3

H9

Cited2

CITED2

10 10 10 10

g

OSR1

10

10

Expression level

(fold change)

E8.5 Osr1+ IM cell

E11.5 Osr1+

Metanephric cell

Day 11 OSR1+ cell

dH 2O Day18(11+7)

OSR1+ derived cell

Day 11 OSR1+ cell

Human embryonic

kidney

1200

E14.5 Kidney

dH 2O

10

10

10 10 10 10

Day 1 Single-cell method

Serum-free single-cell method

Single cell method

EB method

Figure 5 | Establishing methods for differentiating hPSCs into OSR1 cells. (a) Temporal differentiation pattern of OSR1 cells using the single-cell method. (b) Time course analysis of OSR1 expression in the differentiation culture with the single-cell method. Each value was normalizedto the samples on day 1 before treatments. Black bars (AC-BC): Stage 1, 100 ng ml 1 activin A 3 mM CHIR99021; Stage 2, 100 ng ml 1 BMP7 3 mM

CHIR99021. Note that the OSR1 expression of samples on culture days 1 and 3 and without factors is so low that histogram bars are at the baseline. (c) The induction rate of OSR1 cells on day 11 obtained using the three induction protocols; EB-based three-dimensional culture (EB method), feeder-free monolayer culture (colony method), and feeder-free monolayer culture with single-cell dissociation (single-cell method). (d) The OSR1 expressionin the 3D45 clone resulting from the three induction methods. (e) A comparison of the OSR1 expression on day 11 in multiple hiPSC/ESC lines treated with the single-cell method. Samples of 3D45 were used as controls to normalize the data. (f) The differentiation of OSR1 cells on day 11 using the serum-free single-cell method. (g) The OSR1 expression in the serum-free single-cell method. (h) RTPCR analyses of marker gene expression for IM or kidney lineage in Osr1 cells isolated from E8.5 and E11.5 mouse embryos, isolated OSR1 cells differentiated from 3D45 on day 11 using two induction protocols (EB and single-cell methods), and the differentiated cells on day 18 (after an additional 7-day culture of the day 11 isolated OSR1 cells generated with the single-cell method). (i) Immunostaining of isolated OSR1 cells on day 11 generated with the single-cell method, and the differentiated cells on day 16 (after an additional 5-day culture of the day 11 isolated OSR1 cells) using antibodies against GFP and other IM markers. The cells were isolated by ow cytometry and then spun down onto slides. The data from three independent experiments are presented as the meanss.d. (n 3) in ag. Scale bars, 100 mm.

Methods

Cell culture. hiPSCs (201B6, 201B7, 253G1 and 253G4) and hESCs (H9, khES1 and khES3) were grown on feeder layers of mitomycin C-treated mouse embryonic broblasts (MEF) derived from embryonic day (E) 12.5 ICR mouse embryos in media containing Primate ES medium (ReproCELL) supplemented with500 U ml 1 penicillin/streptomycin (Invitrogen) and 4 ng ml 1 recombinant human basic broblast growth factor (Wako). For routine passaging, hiPSC colonies were dissociated by an enzymatic method with CTK dissociation solution consisting of 0.25% trypsin (Invitrogen), 0.1% collagenase IV (Invitrogen), 20% KSR (Invitrogen) and 1 mM CaCl2 in PBS, and split at a ratio between 1:3 and 1:6.

BAC recombineering. The human BAC clone RP11-458J18, which contains all of the exons of the OSR1 gene and extends from 86.3 kb upstream to 89.8 kb downstream of the gene locus, was purchased from BACPAC Resource Center at the Childrens Hospital, Oakland Research Institute (Oakland, CA).

Recombineering was performed as described33. Briey, the BAC clone was introduced into E. coli strain DH10B. To construct the knock-in vector, we designed two primers which have short sequences of the homologous recombination regions of the OSR1 gene with the 50 or 30 end of EGFP-pA-PNL sequence, and performed genomic PCR using KOD Plus Neo polymerase (TOYOBO) according to the manufacturers protocol. The primers used for genomic PCR were as follows: hOSR1-EGFP-S, 50-TCTTCTTTTCTTT

GCAGATCCGGATTGAGAAGCCACTGCAACTACCGAACACCATGGTGAGC AAGGGCGAGGA-30; hOSR1-PNL-AS, 50-GTTCACTGCCTGAAGGAAGGAG

TAGTTGGTGAGCTGCAGGGAAGGGTGGAGTCGACGGCGAGCTCAGACG-30.

Then, the targeting vector, EGFP-pA-PNL cassette containing 50 and 30 homology arms, was electroporated into DH10B containing BAC RP11-458J18 and activated recombinases. The transformed bacteria were plated on LB plates with appropriate antibiotics and incubated overnight at 37 1C. Selected clones were picked and subjected to PCR to conrm whether the EGFP-pA-PNL cassette was integrated into the OSR1 endogenous locus through successful homologous recombination.

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 7

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378

30

Osr1

15 Osr1

No factors

AWBWR

AWBW

Expression level

(fold change)

Expression level

(fold change)

20

No factors

AWBWR

AWBW

10

10

5

0

0

Day 5 Day 9 Day 13 Day 17

492B-4

20D-17

D3

J1

Osr1

Pax2

Eya1 Sall1

Lim1

Wt1

Cited2

[afii9826]-Actin

[afii9826]-Actin no-RT

Day 1

Day 13

Day 1

Day 13

Day 1

Day 13

E14.5 Kidney

Day 1

Day 13

492B-4

20D-17 D3 J1

Figure 6 | The differentiation of multiple miPSC/ESC lines into IM cells. (a) The temporary expression pattern of Osr1 in differentiation culture from a miPSC line, 492B-4. Samples before treatments on day 1 were used as a control. White bars: no factors; grey bars (AW-BW): Stage 1, 100 ng ml 1 activin

A 100 ng ml 1 Wnt3a, Stage 2, 100 ng ml 1 BMP7 100 ng ml 1 Wnt3a; black bars (AW-BWR): Stage 1, 100 ng ml 1 activin A 100 ng ml 1

Wnt3a, Stage 2, 100 ng ml 1 BMP7 100 ng ml 1 Wnt3a 0.1 mM RA. (b) A comparison of the Osr1 expression on day 13 of differentiation culture from

two miPSC lines (492B-4 and 20D-17) and two mESC lines (D3 and J1). Samples from 492B-4 iPSCs on day 13 were used as a control to normalize data. (c) The expression of IM marker genes analysed by RTPCR is shown. The data from three independent experiments are presented as the meanss.d. (n 3) in a and b. For mPSCs, we generated EBs without any inducing factors, and then the same two-step treatment was employed as used for hPSCs.

Genetic modication of hiPSCs. Electroporation was performed as previously described34 with some modications. The human OSR1-EGFP-pA-PNL BAC vector was linearized by restriction enzymes and sterilized by ethanol precipitation. hiPSCs (201B7) were treated with 10 mM ROCK inhibitor Y27,632 (Wako)

overnight and trypsinized. Cells were then centrifuged and resuspended in PBS. A total of 30 mg of linearized DNAs was added into the resuspended hiPSCs. The cells were subjected to a single 250 V, 500 mF pulse (Gene pulser CE, Bio-Rad) at room temperature and plated on feeder layers of mitomycin C-treated STO cells. Antibiotic selection was applied 2 days after electroporation.

Taqman PCR assay. Real-time PCR reactions were carried out with 100 ng of genomic DNA, 250 nM of Taqman probes and 500 nM of primers. The sequences of the primers were as follows: OSR1F, 50-GGATTGAGAAGCCACTGCAACT-30;

OSR1R, 50-CCGTTCACTGCCTGAAGGA-30 and OSR1 probe, 50-(FAM)-CAAGGTTTTGCTGCCC(MGB)-30.

Removal of PGK-Neo cassette. The hiPSCs with a targeted OSR1 allele were treated with 10 mM Y27,632 overnight and trypsinized. Cells resuspended in PBS were electroporated with 30 mg of pCXW-Cre-Puro as described above and plated on feeder layers of mitomycin C-treated STO cells. Antibiotic selection was applied a week after electroporation.

SNP array analysis. Genomic DNA was analysed on GeneChip Mapping 250K NSP arrays (Affymetrix) according to the manufacturers protocol. The genomic copy numbers, including allele-specic copy numbers (AsCNs), were calculated using the CNAG/AsCNAR software program as previously described35. Genetic lesions, including copy number gains and losses, were detected using a hidden Markov model-based algorithm implemented in the CNAG/AsCNAR software program36.

Differentiation protocols. For EB formation from hiPSC/ESCs, a 10-cm plate containing hiPSCs with 80% conuency was rinsed with PBS and treated with 1 mg ml 1 collagenase IV in DMEM for 10 min at 37 1C. The collagenase solution was rinsed away with PBS and replaced with Stage 1 medium containing DMEM/

F12 Glutamax (Invitrogen) supplemented with 500 U ml 1 penicillin/strepto

mycin and 2% FBS (HyClone). The cells were then scraped off with a cell scraper, dissociated by pipetting and distributed into a low attachment six-well plate (NALGENE NUNC) containing Stage 1 medium, 100 ng ml 1 recombinant human/mouse/rat activin A (R&D Systems) and 100 ng ml 1 recombinant mouse

Wnt3a (R&D Systems or StemRD) or 13 mM CHIR99021 (Wako). To differentiate cells towards the IM, EBs on culture day 3 were transferred onto gelatin-coated plates. The cells were cultured for an additional 20 days with Stage 2 medium containing DMEM/F12 Glutamax supplemented with 0.1 mM non-essential

amino acids, 500 U ml 1 penicillin/streptomycin, 0.55 mM 2-mercaptoethanol, 10% KSR, 100 ng ml 1 recombinant human BMP7 (R&D Systems) and100 ng ml 1 recombinant mouse Wnt3a or 13 mM CHIR99021.

Before differentiation with the colony method, hiPSC colonies grown on a MEF feeder layer were dissociated by an enzymatic method with CTK dissociation solution, incubated on gelatin-coated plates for 30 min to remove MEFs, and seeded on Matrigel-coated plates (BD) with MEF conditioned Primate ES medium containing 10 ng ml 1 basic broblast growth factor. When hiPSC colonies attained B70% conuency, the same induction method used for the three-dimensional EB method described above was implemented.

For the single-cell method, hiPSC/ESC colonies grown on a MEF feeder layer were rst dissociated by an enzymatic method with CTK dissociation solution and incubated on gelatin-coated plates for 30 min to remove MEFs. Then, the cells were dissociated to single cells by gentle pipetting after the treatment with Accutase (Innovative Cell Technologies, Inc.) for 20 min and seeded on Human Collagen Type I-coated plates (BD) at a density of 1.5 105 cells cm 2. The same inducing

factors described above was used, except for the addition of 10 mM Y27,632 to the Stage 1 treatment.

For the serum-free single-cell method, the cells were cultured with a serum-free medium containing DMEM/F12 Glutamax supplemented with 1 B27

8 NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378 ARTICLE

60

8,000

Day 1

Day 1

1,000

Day 18(11+7)

Day 18(11+7)

Adult tissue

Expression level

(fold change)

50

40

30

20

10

0

Expression level

(fold change)

200

4

Adult tissue

50

12

8

3

2

1

nd

AQP1

nd

nd

0

RET

SIX2

HOXD11

FOXD1

DAX1

GATA4

GATA6

SALL4

HOXB7

PDX

E-CAD

LHX9

HSD3[afii9826]2

SF1

Ureteric bud

Metanephric mesenchyme

Metanephric stroma

Gonad or adrenal cortex

Ureteric bud

Adult kidney

Gonad or Adrenal cortex

SALL4 Nuclei

PNA Nuclei

LTL Nuclei AQP1 Nuclei PODOCALYXINNuclei

DBA Nuclei

SMA Nuclei

Proximal tubule Glomerulus (podocyte) Smooth muscle Nephric duct and ureteric bud

Gonad or adrenal cortex

HSD3 Nuclei

CYTOKERATIN Nuclei

AQP1 HuNu

E-CADHERIN Nuclei

GATA4 Nuclei

GATA6 Nuclei

Epithelia

hMito Nuclei

hMito LAMININ Nuclei

hMito LTL Nuclei

LTL Nuclei

Rabbit IgG Mouse IgG Nuclei

E-CADHERIN Nuclei

DBA Nuclei

Figure 7 | In vitro and in vivo differentiation of OSR1 cells into IM derivatives. (a) The expression of marker genes for the developing kidney, gonad and adrenal cortex in the differentiated cells on culture day 18 (after an additional 7-day culture of the day 11 isolated OSR1 cells differentiated from an

OSR1-GFP knock-in hiPSC line, 3D45, using the single-cell method). The mRNAs of human adult kidney were used as controls for the expression of RET, SALL4, HOXB7, SIX2, HOXD11, FOXD1, AQP1, PODOCALYXIN and E-CADHERIN. The mRNAs of human adult testis were used as controls for DAX1 and LHX9. The mRNAs of human adult ovary were used as controls for GATA4 and GATA6. The mRNAs of human adult adrenal gland were used as controls for SF1 and HSD3b2. Each value of RET, SIX2, HOXD11, FOXD1, DAX1, GATA4 and GATA6 was normalized to the samples on day 1 before treatments, while that of SALL4,

HOXB7, AQP1, PODOCALYXIN, E-CADHERIN, LHX9, SF1 and HSD3b2 was normalized to the samples on day 18, whose expression levels in the day 1 samples were so low or much higher than day 18 samples or adult tissues. The data from three independent experiments are presented as the meanss.d. (n 3). nd; not

detected. PDX; PODOCALYXIN, E-CAD; E-CADHERIN. (b) The differentiated cells on day 18 were stained with antibodies or lectins against markers for IM derivatives: LTL and AQP1 for proximal renal tubule, peanut agglutinin (PNA) and PODOCALYXIN for glomerular podocytes, aSMA for smooth muscle, DBA and

SALL4 for nephric duct and ureteric bud, epithelial markers CYTOKERATIN and E-CADHERIN, and GATA4, GATA6 and HSD3b for the gonads or adrenal cortex. (c) AQP1 and human nuclear antigen (HuNu), control, LTL, E-CADHERIN and DBA staining of histological sections of 4-week-old hiPSC-derived IM grafts transplanted into immunodecient mice (NOD. CB17-Prkdcscid/J). (d) Immunostaining of the histological sections of organ culture samples collected on day 7 for human mitochondria (hMito) and for LTL or LAMININ. Note that the right two panels are images of the same section. Scale bars, 50 mm.

supplements (Invitrogen) and 500 U ml 1 penicillin/streptomycin throughout the differentiation culture.

For miPSC/ESCs, cells were dissociated with 0.25% trypsin/EDTA and split onto gelatinized plates. After incubation for 30 min to remove feeder cells, EBs were generated by 2-day hanging drop culture from 1,000 undifferentiated iPSCs or ESCs in 20 ml undifferentiation medium without leukaemia inhibitory factor. Then, EBs were plated onto gelatinized 24-well plates (30 EBs per well) and cultured with Stage 1 treatment for 2 days, followed by Stage 2 treatment for additional days, as indicated.

Long-term culture of OSR1(GFP) cells. hiPSC-derived OSR1(GFP) cells on culture day 11 were isolated by ow cytometry sorting, seeded onto gelatin-coated

96-well plates at a density of 1.0 104 cells per well, and cultured with Stage 2

medium containing 10 mM Y27,632. After overnight incubation, 100 ng ml 1 recombinant human BMP7 and 100 ng ml 1 recombinant mouse Wnt3a or 13 mM CHIR99021 were added to the medium, and cells were cultured for an additional 7 days. After the culture, cells were examined by immunostaining.

Graft preparation and implantation. hiPSC-derived OSR1 and OSR1 cells on culture day 11 were isolated by ow cytometry sorting, seeded onto low attachment 96-well plates (NALGENE NUNC) at a density of 1.0 105 cells per well, and

cultured with Stage 2 medium containing 10 mM Y27,632 for 2 days. Then about 20 aggregates were transferred onto polyethylene terephthalate ber-Collagen Sponge

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 9

& 2013 Macmillan Publishers Limited. All rights reserved.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378

Stage 1

Stage 2

100 ng ml1 activin A

100 ng ml1 BMP7

3 M CHIR99021

3 M CHIR99021

DMEM/F12

+ 2%FBS

DMEM/12 +B27 supplement

DMEM/F12 + 10%KSR

DMEM/F12 +B27 supplement

EB method Colony method Single-cell method

Serum -free single-cell method

EB method Colony method Single-cell method

Serum -free single-cell method

Day 1 Day 3

2 days 4~20 days

Kidney

Gonad

Adrenal cortex

PSC ME IM

BRACHYURY GSC MIXL1

OSR1

PAX2

LIM1

WT1

Activin A + CHIR99021+Y27,632 BMP7 + CHIR99021

2 Days 8 Days

Serum-free single-cell method

Accutase for 20 min

Collagen type I IM cell

Undifferentiated hiPSC/ESC

Collagenase IV for 10 min orCTK dissociation solution for 3 min

Split on gelatin to remove MEF

Activin A + CHIR99021+Y27,632 BMP7 + CHIR99021

2 Days 8 Days

Single-cell method

Collagen type I IM cell

Matrigel

Activin A + CHIR99021 BMP7 + CHIR99021

2 Days 8 Days

IM cell

Colony method

Colony formation

Activin A + CHIR99021 BMP7 + CHIR99021

2 Days 4~20 Days

IM cell

EB method

EB formation Gelatin

Figure 8 | Schematic illustrations of two-step differentiation methods from hPSCs through ME into IM cells. Applied factors and media are summarized in boxes. Marker genes that help characterize cells within particular domain are shown below developmental stages.

(MedGEL) that was prewetted with Stage 2 medium. The aggregates and Sponge were overlayed with 50 ml of Matrigel. The resultant implant constructs were placed in an incubator set at 37 1C and 5% CO2 for 1 h to allow the construct to gel. These constructs were transferred to culture dishes with prewarmed medium until implantation. One of the EFPs of immunodecient mice (NOD. CB17-Prkdcscid/J) was carefully externalized through an abdominal incision, then a single implant construct was wrapped in the EFP and the implanted EFP were returned to abdominal cavity. After 4 weeks of implantation, mice were killed and the serial sections of implanted tissues were examined with immunostaining.

Organ culture experiment. hiPSC-derived OSR1(GFP) cells on culture day 11 were isolated by ow cytometry sorting, seeded onto gelatin-coated 24-well plates at a density of 5.0 104 cells per well, and cultured with Stage 2 medium

containing 10 mM Y27,632 and 10 ng ml 1 recombinant human TGFb1 (R&D Systems) for 7 days.

Embryonic day 11.5 metanephric kidneys from ICR mice were dissected in improved MEM (Invitrogen). The metanephric kidneys were then placed in 0.05% trypsin-EDTA for 10 min at 37 1C and dissociated by pipetting. Dissociated cells were stabilized in kidney culture medium containing improved MEM

supplemented with 500 U ml 1 penicillin/streptomycin and 10% FBS for 10 min at 37 1C, and then ltered through a 40-mm cell strainer (BD). A total of 10 104

freshly dissociated metanephric cells and 1 104 of TGFb1-treated hiPSC-derived

OSR1(GFP) cells dissociated by Accutase were mixed, seeded onto 96-well low-cell-adhesion plates (Lipidure Coat, NOF) with adding 10 mM Y27,632, then cultured for overnight at 37 1C to form aggregates. The aggregates were cultured at airuid interface on 0.4-mm pore polycarbonate lter (Millipore) supplied with kidney culture medium at 37 1C. After 1 week of organ culture, the aggregates were xed and the serial sections were examined with immunostaining. Stained sections were analysed with an LSN710 confocal microscope (Zeiss).

The statistical signicance of the difference in frequency of renal tubule formation between hiPSC-derived OSR1 cells and control undifferentiated hiPSCs in organ culture was analysed using Fishers exact test.

References

1. Humphreys, B. D. & Bonventre, J. V. The contribution of adult stem cells to renal repair. Nephrol. Ther. 3, 310 (2007).

2. Lysaght, M. J. Maintenance dialysis population dynamics: current trends and long-term implications. J. Am. Soc. Nephrol. 13(Suppl 1): S37S40 (2002).

10 NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications

& 2013 Macmillan Publishers Limited. All rights reserved.

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms2378 ARTICLE

3. Evans, M. J. & Kaufman, M. H. Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154156 (1981).

4. Martin, G. R. Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl Acad. Sci. USA 78, 76347638 (1981).

5. Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts. Science 282, 11451147 (1998).

6. Takahashi, K. & Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult broblast cultures by dened factors. Cell 126, 663676 (2006).

7. Takahashi, K. et al. Induction of pluripotent stem cells from adult human broblasts by dened factors. Cell 131, 861872 (2007).

8. Yu, J. et al. Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 19171920 (2007).

9. Kobayashi, T. et al. Wnt4-transformed mouse embryonic stem cells differentiate into renal tubular cells. Biochem. Biophys. Res. Commun. 336, 585595 (2005).

10. Kim, D. & Dressler, G. R. Nephrogenic factors promote differentiation of mouse embryonic stem cells into renal epithelia. J. Am. Soc. Nephrol. 16, 35273534 (2005).

11. Vigneau, C. et al. Mouse embryonic stem cell-derived embryoid bodies generate progenitors that integrate long term into renal proximal tubules in vivo. J. Am. Soc. Nephrol. 18, 17091720 (2007).

12. Bruce, S. J. et al. In vitro differentiation of murine embryonic stem cells toward a renal lineage. Differentiation 75, 337349 (2007).

13. Batchelder, C. A., Lee, C. C., Matsell, D. G., Yoder, M. C. & Tarantal, A. F. Renal ontogeny in the rhesus monkey (Macaca mulatta) and directed differentiation of human embryonic stem cells towards kidney precursors. Differentiation 78, 4556 (2009).

14. Morizane, R., Monkawa, T. & Itoh, H. Differentiation of murine embryonic stem and induced pluripotent stem cells to renal lineage in vitro. Biochem. Biophys. Res. Commun. 390, 13341339 (2009).

15. Mae, S. et al. Combination of small molecules enhances differentiation of mouse embryonic stem cells into intermediate mesoderm through BMP7-positive cells. Biochem. Biophys. Res. Commun. 393, 877882 (2010).

16. James, R. G., Kamei, C. N., Wang, Q., Jiang, R. & Schultheiss, T. M. Odd-skipped related 1 is required for development of the metanephric kidney and regulates formation and differentiation of kidney precursor cells. Development 133, 29953004 (2006).

17. Tena, J. J. et al. Odd-skipped genes encode repressors that control kidney development. Dev. Biol. 301, 518531 (2007).

18. Mugford, J. W., Sipila, P., McMahon, J. A. & McMahon, A. P. Osr1 expression demarcates a multi-potent population of intermediate mesoderm that undergoes progressive restriction to an Osr1-dependent nephron progenitor compartment within the mammalian kidney. Dev. Biol. 324, 8898 (2008).19. DAmour, K. A. et al. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotechnol. 24, 13921401 (2006).

20. Gadue, P., Huber, T. L., Paddison, P. J. & Keller, G. M. Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Proc. Natl Acad. Sci. USA 103, 1680616811 (2006).

21. Osafune, K. et al. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotechnol. 26, 313315 (2008).

22. Nakagawa, M. et al. Generation of induced pluripotent stem cells without Myc from mouse and human broblasts. Nat. Biotechnol. 26, 101106 (2008).

23. Suemori, H. et al. Efcient establishment of human embryonic stem cell lines and long-term maintenance with stable karyotype by enzymatic bulk passage. Biochem. Biophys. Res. Commun. 345, 926932 (2006).

24. Okita, K., Nakagawa, M., Hyenjong, H., Ichisaka, T. & Yamanaka, S. Generation of mouse induced pluripotent stem cells without viral vectors. Science 322, 949953 (2008).

25. Okita, K., Ichisaka, T. & Yamanaka, S. Generation of germline-competent induced pluripotent stem cells. Nature 448, 313317 (2007).

26. Unbekandt, M. & Davies, J. A. Dissociation of embryonic kidneys followed by reaggregation allows the formation of renal tissues. Kidney Int. 77, 407416 (2010).

27. Hockemeyer, D. & Jaenisch, R. Gene targeting in human pluripotent cells. Cold Spring Harb. Symp. Quant. Biol. 75, 201209 (2010).

28. Hockemeyer, D. et al. Genetic engineering of human pluripotent cells using TALE nucleases. Nat. Biotechnol. 29, 731734 (2011).

29. Suzuki, K. et al. Highly efcient transient gene expression and gene targeting in primate embryonic stem cells with helper-dependent adenoviral vectors. Proc. Natl Acad. Sci. USA 105, 1378113786 (2008).

30. Khan, I. F. et al. Engineering of human pluripotent stem cells by AAV-mediated gene targeting. Mol. Ther. 18, 11921199 (2010).

31. Song, H., Chung, S. K. & Xu, Y. Modeling disease in human ESCs using an efcient BAC-based homologous recombination system. Cell Stem Cell 6, 8089 (2010).

32. Kiskinis, E. & Eggan, K. Progress toward the clinical application of patient-specic pluripotent stem cells. J. Clin. Invest. 120, 5159 (2010).

33. Lee, E. C. et al. A highly efcient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73, 5665 (2001).

34. Costa, M. et al. A method for genetic modication of human embryonic stem cells using electroporation. Nat. Protoc. 2, 792796 (2007).

35. Nannya, Y. et al. A robust algorithm for copy number detection using high-density oligonucleotide single nucleotide polymorphism genotyping arrays. Cancer Res. 65, 60716079 (2005).

36. Yamamoto, G. et al. Highly sensitive method for genomewide detection of allelic composition in nonpaired, primary tumor specimens by use of affymetrix single-nucleotide-polymorphism genotyping microarrays. Am. J. Hum. Genet. 81, 114126 (2007).

Acknowledgements

We thank D.A. Melton for his valuable help and scientic comments; H. Nagashima,H. Sakurai, K. Okita, T. Ichisaka, T. Sudo, Y. Kurose, J.L. Fox, A. Kweudjeu, C. Balatbat and C.S. Fitz-Gerald for technical assistance; Y. Sato for statistical analysis; and K. Woltjen,T. Araoka, T. Toyohara and T. Inoue for helpful discussion. This study was supported in part by research grants from the Leading Project of MEXT, the Uehara Memorial Foundation and the Takeda Science Foundation and by the Japan Society for the Promotion of Science through its Funding Programme for World-Leading Innovative R&D on Science and Technology (FIRST Programme) and Grant-in-Aid for Young Scientists(B) to K.O. The work in APMs laboratory is supported by a grant from the NIH (DK054364). S-I.M. was supported by a fellowship from JSPS.

Author contributions

S.-I.M., T.T., K.T., N.N., C.A.C., T.A., S.O., A.P.McM., S.Y. and K.O. designed the study.S.-I.M., A.S., F.S., T.Y., M.K., N.G.-N., S.A. and A.S.-O. performed the experiments.S.-I.M., K.T., C.A.C., T.A., S.O., A.P.McM., S.Y. and K.O. analysed the data. S.Y. and K.O. supervised the study. S.-I.M. and K.O. wrote the manuscript.

Additional information

Supplementary Information accompanies this paper at http://www.nature.com/naturecommunications

Web End =http://www.nature.com/ http://www.nature.com/naturecommunications

Web End =naturecommunications

Competing nancial interests: The authors declare no competing nancial interests.

Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions/

Web End =http://npg.nature.com/ http://npg.nature.com/reprintsandpermissions/

Web End =reprintsandpermissions/

How to cite this article: Mae, S.-I. et al. Monitoring and robust induction of nephrogenic intermediate mesoderm from human pluripotent stem cells. Nat. Commun. 4:1367doi: 10.1038/ncomms2378 (2013).

NATURE COMMUNICATIONS | 4:1367 | DOI: 10.1038/ncomms2378 | http://www.nature.com/naturecommunications

Web End =www.nature.com/naturecommunications 11 & 2013 Macmillan Publishers Limited. All rights reserved.