About the Authors:
Emmanuelle Deniaud
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Joël Baguet
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Roxane Chalard
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Bariza Blanquier
Affiliations Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Lilia Brinza
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Julien Meunier
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Marie-Cécile Michallet
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Aurélie Laugraud
Affiliations Université de Lyon, Lyon, France, PRABI, Villeurbanne, France
Claudette Ah-Soon
Affiliations Université de Lyon, Lyon, France, PRABI, Villeurbanne, France
Anne Wierinckx
Affiliation: ProfileXpert, Bron, France
Marc Castellazzi
Affiliations Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France, Inserm, U758, Ecole Normale Supérieure de Lyon, Lyon, France
Joël Lachuer
Affiliation: ProfileXpert, Bron, France
Christian Gautier
Affiliations Université de Lyon, Lyon, France, PRABI, Villeurbanne, France
Jacqueline Marvel
Contributed equally to this work with: Jacqueline Marvel, Yann Leverrier
* E-mail: [email protected] (JM); [email protected] (YL)
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Yann Leverrier
Contributed equally to this work with: Jacqueline Marvel, Yann Leverrier
* E-mail: [email protected] (JM); [email protected] (YL)
Affiliations Inserm, U851, Lyon, France, Université Lyon1, IFR128, Lyon, France, Université de Lyon, Lyon, France
Introduction
Transcription factor Sp1 was the first identified member of the Sp/XKLF (Specificity protein/Krüppel-like factor) family. Sp1 protein comprises several domains of which the DNA binding domain is the most conserved among Sp family. The DNA binding domain of Sp1 consists of three contiguous Cys2His2 Zinc (Zn) fingers and mutational analysis has revealed that Zn fingers 2 and 3 are essential for Sp1 DNA binding activity [1]. Sp1 binds GC-rich elements [2] that are common regulatory elements in promoters of numerous genes. Sp1 binds individual Sp1 binding sites as a multimer and is capable of synergic activation on promoters containing multiple binding sites [3]. Sp1 regulates transcription by dynamically recruiting and forming complexes with many factors associated with transcription [4]. Although Sp1 has been described as a transcriptional activator it can also act as a repressor. Activation or repression of transcription by Sp1 depends on the promoter it binds to and on the co-regulators it interacts with [5].
An unbiased mapping of in vivo occupied Sp1 binding sites by combining chromatin immunoprecipitation and oligonucleotides arrays has led to the estimation that the human genome contains at least 12,000 Sp1 binding sites [6]. Therefore it is not surprising that Sp1 has been implicated in the expression of numerous genes involved in many aspects of cellular life such as metabolism, cell growth, differentiation, angiogenesis and apoptosis regulation. Although Sp1 is widely expressed and binds the promoters of a large number of genes, it is involved in tissue specific gene expression, its activity being finely modulated by a variety of stimuli through multiple post-translational modifications [7].
Sp1 expression levels are also regulated, changes in its expression levels being observed during murine development and during transformation. Indeed, differences in the levels of Sp1 of up to 100 times were observed during the development and the differentiation of mouse organs [8]. Importantly, Sp1 expression is increased in a number of tumour cells and this could be a critical factor for tumour development or maintenance. Indeed, Sp1 levels and/or activities are increased in gastric cancer, breast carcinoma and pancreatic carcinoma compared with normal tissues [1], [9], [10]. This elevated Sp1 expression is inversely correlated with the survival of patients with gastric cancer [9]. In primary pancreatic adenocarcinoma Sp1 overexpression identifies advanced stage tumours and predicts a poor clinical outcome [11]. Moreover, Sp1 levels slowly increase during mice skin tumour progression [12] and Sp1 accumulates in N-methyl-N-nitrosourea-induced mammary tumour cells compared to normal mammary cells [13]. Sp1 levels also increase during the process of transformation in a fibrosarcoma transformation model and reducing Sp1 expression in those human transformed fibroblasts inhibits their tumorogenicity [14]. Moreover reduction of Sp1 expression in pancreatic cancer cells inhibit their growth and metastasis in mouse models [15]. Sp1 could contribute to transformation via the regulation of expression of genes regulating cell growth (c-jun, Raf, cyclins, cdk inhibitors, E2F1, TGF-β, IEX-1 and TCL1), apoptosis (Bcl-2) or angiogenesis (VEGF, FGF) [16], [17]. Altogether, these findings show that Sp1 is overexpressed or overactivated in a number of cancers and that its activity plays a role in late stage of carcinogenesis.
Although Sp1 deregulation might be beneficial for tumour cells, we and others have previously shown that deregulation of Sp1 expression on its own induces apoptosis of several untransformed cell lines [18], [19]. The aim of the study was to further characterise the functional and transcriptional responses of untransformed cells following Sp1 overexpression. We used wild-type and DNA-binding-deficient Sp1 to demonstrate that Sp1-induction of apoptosis in untransformed Baf-3 cells requires its binding to DNA. Genome-wide expression profiling showed that Sp1 overexpression induces a transcriptional response that is enriched for genes regulating cell death and cell cycle. Sp1 overexpression leads to the down-regulation of cyclin D2 expression and the up-regulation of cyclin G2 and cdkn2c expression. Moreover, we show that this deregulation of cell cycle regulating genes is associated with the accumulation of cells in the G1 phase of the cell cycle. Finally, microarray data combined with promoter analysis revealed that only a fraction of the promoters of deregulated genes are enriched in Sp1-binding sites. This suggests that the transcriptional response induced by overexpressed Sp1 involves direct Sp1-driven transcription but also indirect mechanisms.
Materials and Methods
Cell culture
The murine IL-3-dependent Baf-3 cell line was maintained in DMEM (Gibco) containing 6% FBS (Pan Biotech GmbH) and 5% IL-3 as described [20]. Drosophila Schneider's SL2 cells were cultured in Drosophila medium (Invitrogen) containing 10% FBS at 28°C [21]. Baf-3 clones expressing inducible Sp1 and GFP were obtained as described previously [18]. To repress ectopic Sp1 expression, cells were grown in presence of doxycyline (30 ng/ml, Sigma). To induce Sp1 and GFP expression, cells were washed 3 times and cultured without doxycyline. Among the inducible clones generated, one expressed a truncated form of Sp1 (tSp1, Figure 1C) due to the integration into the genome of a retrovirus coding for a truncated Sp1 (data not shown). tSp1 is composed of the first 418 amino acids and is devoid of DNA binding domain and nuclear localisation sequences (Figure S1).
[Figure omitted. See PDF.]
Figure 1. Deregulation of the expression of wild-type but not truncated cytoplasmic Sp1 induces apoptosis.
(A) Baf-3-Sp1 clone 1 and (B) Baf-3-Sp1 clone 2 were grown in presence of doxycycline (+ dox) or in absence of doxycycline for the indicated time (- dox). Analysis of Sp1 and actin protein levels by Western Blot (left panel). Viability measured by flow cytometry after staining with propidium iodide (right panel). (C) Inducible clone Baf-3-tSp1 was grown with (+ dox) or without (-dox) doxycycline for the indicated time. Analysis of Sp1 and actin protein levels by Western Blot (left panel). tSp1: truncated Sp1. Cells were costained for DNA (blue) and Sp1 (red) and analysed by confocal microscopy (middle panel). Scale bar 10 µm. Viability measured by flow cytometry after staining with propidium iodide (right panel). Results show the mean ± sd of 3 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g001
Retroviral constructions, transfections and transductions
The retroviruses coding for full-length human Sp1 protein followed by an internal ribosomal entry site and a truncated cell surface marker (CD2) to identify transduced cells were described previously [18]. Sp1 carrying mutations of the second and third Zn Fingers (Sp1Zn2,3) (Figure S1) was obtained by PCR-mediated site-directed mutagenesis using pCMX-Gal4NSp1ZFM2 vector (a kind gift of Dr Hur MW, Seoul, Korea) encoding the DNA binding domain (amino acids 622–720) mutated for the second Zn Finger. Mutation of the third Zn finger was obtained using the following oligonucleotides 5′-CCTCATGAAGCGCTTAGGACTCTCAGGGCTGGCAAATTTCTTCTCACCTGTGTGTGTACGTTTGTGCCTCTGTAGCTCATCGGTGAGAAGAAATTTGCCAGCCCTGAGTGCCTAAG-3′, BamHI site: 5′-CCGCGGATCCTGGCAAAAAGAAACAGC-3′. The BamHI/Ecor47III cDNA PCR fragments were subcloned into pBSK-Sp1 to give pBSK-Sp1Zn2,3. The EcoRI-XhoI fragment was sequenced before subcloning into pMX-IRES-CD2. Sp1, Sp1Zn2,3 or EGFP cDNA were cloned under the Drosophila actin AC5 promoter into pAc5.1/V5-HisA vector (Invitrogen). The pGL2 derivative carries the tata-Sp1 promoter [21]. Transfections, transductions, magnetic selection of CD2-expressing cells and western blot analysis were performed as described [18].
Luciferase assay
SL2 cells were transfected with 5 µg of tata-Sp1 reporter plasmid and 0.5 µg of Drosophila expression vectors pPac, pPacSp1 or pPacSp1Zn2,3 and 0.5 µg of pPac-EGFP to quantify transfection efficiency. 48 hrs after transfection cells were lysed in 100 µl of Reporter Lysis Buffer (Promega) for 10 min. Samples were frozen at −80°C for at least 1 h. Luciferase assay was performed with Luciferase Assay System (Promega). Luciferase activity was normalized based on protein concentration (Bradford method) and on transfection efficiency determined as percentage of EGFP positive cells counted on a FACScalibur (Becton-Dickinson) and analysed using the CellQuest software.
Electrophoretic mobility shift assay
Proteins Sp1 or Sp1Zn2,3 were synthesised in vitro using a reticulocyte coupled transcription/translation system (Promega). The oligonucleotide probe carrying the Sp1 consensus sequence (upper strand sequence: 5′-ATTCGATCGGGGCGGGGCGAGC-3′) was 32P end-labelled with T4 DNA polynucleotide kinase (Promega). The binding reaction was performed in a 15 µl volume of binding buffer containing 2.5 µl of in vitro protein, 1.5 µg poly dI-dC and oligonucleotide probe for 30 min at room temperature and run on a gel.
Cell viability and cell cycle analysis
Viability was measured using Fluorescein-5-isothiocyanate (FITC)-Annexin V staining (BD Biosciences Pharmingen) or Propidium Iodide staining (2 µg/ml, Sigma) by flow cytometry. Cell cycle was analysed using the Flow Cytometry Kit (BD Biosciences Pharmingen). Cells (2.105 cells/ml) were grown for 16 hrs and then labelled with BrdU (32 µM, 20 min). Cells were fixed and permeabilised with Cytofix/Cytoperm and treated with DNase (1 hr, 37°C). Cells were stained with Allophycocyanin-conjugated anti-BrdU and 7-amino-actinomycin D (7-AAD). When required, transduced cells were stained with Phycoerythrin (PE)-coupled anti-CD2 antibody (30 min, 4 µg/ml, BD Biosciences Pharmingen). BrdU incorporation (FL4-H), 7-AAD (FL3-H) and CD2 expression (FL2-H) were recorded using a FACScalibur.
Immunofluorescence microscopy
Cells seeded on 12-mm glass coverslips coated with 0.01% Poly-L-lysine (Sigma) were fixed with 4% paraformaldehyde (BDH) in PBS for 5 min then permeabilised with 0.25% Triton X-100 (BDH) in PBS for 5 min. Sp1 was detected using anti-Sp1 polyclonal rabbit antibody (1∶100, 120 min) followed by biotin-conjugated goat anti-rabbit antibody (5 µg/ml, Jackson ImmunoResearch, 30 min) and either FITC-conjugated streptavidin (1 µg/ml, BD Biosciences Pharmingen, 30 min) or Tetramethyl-Rhodamine-Iso-Thio-Cyanate (TRITC)-conjugated streptavidin (3 µg/ml, Jackson ImmunoResearch, 30 min). Actin was labelled with rhodamine-conjugated phalloidin (0.2 µg/ml, Sigma, 30 min).
Detergent Triton X-100 was used to remove soluble proteins while leaving more tightly bound protein [22]. Thirty hrs after transduction, 106 cells were stained for 45 min with 0.5 µg biotinylated anti-CD2 antibody and with 0.75 µg TRITC-conjugated streptavidin for 20 min (Jackson ImmunoResearch). Cells were then washed in PBS containing 0.5 mM MgCl2 and 0.5 mM CaCl2, incubated for 5 min in CSK buffer (10 mM Pipes-KOH, pH 7.0, 100 mM NaCl, 300 mM sucrose, 3 mM MgCl2) and incubated for 3 min in CSK buffer containing 0.02% Triton X-100. A 10 times excess of CSK buffer was added and cells were loaded on Poly-L-lysine-coated coverslips and fixed immediately with 4% paraformaldehyde. Specimens were stained with 1∶100 anti-Sp1 antibody for 2 hrs followed by Alexa488 conjugated anti-rabbit antibody (Molecular Probes). Actin staining was performed in parallel to confirm the efficiency of triton removal of soluble proteins (not shown). Slides were mounted with ProLong anti-fade (Molecular Probes) containing DRAQ5 (1∶500, Alexis corporation) to counterstain DNA. Images of cells (single sections) were obtained using a Zeiss LSM 510 confocal laser-scanning microscope. Sp1 staining in CD2-positive cells was quantified using Image J software. The ratio of Sp1 signal in transduced CD2 positive cells versus non transduced neighbouring cells was calculated.
Quantification by Real Time PCR
RNA extraction and reverse transcription were performed as previously described [18]. Real Time PCR analysis was carried out using Platinum SYBR Green qPCR SuperMix UDG kit (Invitrogen) on an ABI Prism 7700 (Perkin Elmer) [23]. Relative level of the target sequence against the HPRT reference sequence was calculated using the ΔΔCt method with calculated real efficiencies. The sequences of primers used are:
Neo:Forward-ACCAAGGAAGGGGTTGCTA,Reverse-GTTTTGAATAGTCACCTGCATCTC;
Cxcl4:F-GCGTCGCTGCGGTGTTTCG,R-ATCCCAGAGGAGATGGTCTTCACAC;
Slc39a8:F-TTTCGTGGGACTCGCTATTGGG,R-ATCCACCAAACACAGCAACTGC;
Jun:F-AAGAACTGCATGGACCTAACATTCG,R-GTTAAGGAGCACTACAGAAGCAATCTAC;
Gsn:F-AGGTCAAAGGACGCCGTGTAG,R-GCCAGAGCCACACCACTGATAG;
Ccnd2:F- TTCATTGAGCACATCCTTCGC,R-AAGTCGGTAGCGCACAGAGC;
Ccng2:F-GCCGAGTTGTCTTCTCCAAAGC,R-AAGCAAGAGAATTTCCAGCAGTTCC;
Cdkn2c:F-GTCCTTCTGTCAGCCTCCGATG,R-TCGGCCATTCTTTAGGGTCCTG;
Human Sp1:F-GCCTCCAGACCATTAACCTCAGT,R-GCTCCATGATCACCTGGGGCAT;
Mouse Sp1: F-TCATGGATCTGGTGGTGATGGG,R-GCTCTTCCCTCACTGTCTTTGC;
Hprt1:F-TCATTATGCCGAGGATTTGGA,R-CAGAGGGCCACAATGTGATG.
Microarray analysis of gene expression
Inducible Baf-3-Sp1 clone 1 was grown in presence or absence of doxycycline for 28 hrs. Three independent experiments were performed. RNA extraction, reverse transcription and microarray hybridization on Affymetrix mouse Genechip Mouse genome 430 2.0 (Affymetrix) were carried out by ProfileXpert (Bron, France). Absolute expression transcripts levels were normalized for each chip by globally scaling all probesets to a target signal intensity of 500. Normalized data were analysed using GeneSpring GX 7.3 expression analysis software (Agilent Technology Inc). Differential probesets expression following Sp1 overexpression relative to control was determined using GeneSpring GX 7.3 statistical analysis module ANOVA (1 way test, assuming variance not equal, FDR 6% with multiple testing correction Benjamini and Hochberg). 1610 probesets corresponding to 1294 genes with unique gene symbol identifiers were differentially expressed with a fold change of expression of 1.3. To identify among deregulated genes the functional categories linked with Sp1 overexpression, differentially expressed probesets were imported into Ingenuity Pathway Analysis (Ingenuity Systems Inc, Mountain View, CA). The microarray data have been deposited and described in ArrayExpress under accession number E-MEXP-1702 (http://www.ebi.ac.uk/microarray-as/ae) in accordance with MIAME guidelines.
Computational analysis of promoters regions
Promoter sequences (2000 nucleotides upstream of the transcriptional start site) were retrieved using Biomart service of the Ensembl project. Elkon et al. have shown that 80% of Transcription Factor-binding sites are located within 1200 bases upstream of the transcription start site (TSS) [24]. Since there is no clear consensus for the length of a promoter, we have performed our analysis studying the 2000 bases upstream of the TSS. Sp1 binding motifs GGGGCGGGG (V$SP1_Q6 as defined by TRANFAC 7.0) and GG[G/T]G[C/T]GGG [6] and STAT6 binding motif (TTCN4GAA) [25] were searched in promoters using PATTERNn service (http://bioinfo.hku.hk/services/analyseq/cgi-bin/patternn_in.pl). We have also used the DiRE server (http://dire.dcode.org) to identify transcription factor binding sites within conserved Regulatory Elements (RE) of deregulated genes. A control list of 1700 probesets was generated randomly that fulfils two criteria: no change in their expression levels following Sp1 overexpression and an overall distribution of expression of the control list similar to the overall distribution of expression of the differentially expressed list (Figure S2). Two sided binomial tests were conducted in R software to determine whether there were significant differences in the percentage of promoters containing transcription factor binding site between the different gene lists.
Results
Induction of apoptosis by overexpressed Sp1 requires its binding to DNA
The overexpression of transcription factor Sp1 was achieved using an inducible Sp1 expression system in untransformed murine haematopoietic Baf-3 cell line [18]. In Baf-3-Sp1 clone 1 the expression of ectopic full-length wild-type Sp1 was rapidly induced following doxycycline removal (Figure 1A). The first cells entering apoptosis were detected 30 hrs after doxycycline removal. Similar results were obtained when studying a second inducible clone (Baf-3-Sp1 clone 2) in which induction of Sp1 expression and apoptosis induction following doxycycline removal are slower (Figure 1B). In contrast a truncated Sp1 (tSp1, Figure S1), that accumulates in the cytoplasm does not affect cell viability (Figure 1C).
We then assessed whether Sp1 requires nuclear localisation and/or DNA binding to induce apoptosis. Therefore, we have constructed a retrovirus coding for Sp1 carrying point mutations on the Zn fingers two and three (Sp1Zn2,3) that are essential for DNA binding [1] (Figure S1). Sp1Zn2,3 does not bind Sp1-binding consensus sequence in vitro as revealed by EMSA analysis (Figure 2A). The lack of transactivation potential of Sp1Zn2,3 mutant was first verified in Drosophila Schneider SL2 cells since these cells are devoid of Sp-like activities. In SL2 cell line, wild-type Sp1 transactivates a promoter carrying Sp1 binding sites confirming that this form is transcriptionally active (Figure 2B). As expected Sp1Zn2,3 does not transactivate the same promoter. As proteins of the Sp/KLF family have nuclear localisation sequences adjacent to or within the Zn-finger motifs we next monitored the localisation of transduced Sp1Zn2,3 protein. Both Sp1 and Sp1Zn2,3 are localised in the nucleus of Baf-3 cells (Figure 2C). The binding of Sp1Zn2,3 to chromatin was assessed using triton extraction on live cells [22]. This approach which allows the removal of soluble proteins but not DNA-associated proteins was followed by immunostaining of Sp1 to quantify DNA-bound Sp1. Endogenous and wild-type ectopic Sp1 are triton-resistant confirming their association with DNA whereas Sp1Zn2,3 is triton-soluble suggesting a lack of a strong association with DNA (Figure 2D). When overexpressed in Baf-3 cells, wild-type Sp1 induces apoptosis whereas Sp1Zn2,3 mutant does not (Figure 2E). Mutations of the Zn finger 2 (Sp1Zn2), Zn finger 3 (Sp1Zn3) or the three Zn fingers (Sp1Zn1,2,3) also abrogate Sp1 ability to induce apoptosis (Figure S3). Altogether, these results show that induction of apoptosis by Sp1 requires its ability to bind to DNA through its Zn fingers and suggest that a transcriptional process is involved.
[Figure omitted. See PDF.]
Figure 2. DNA binding deficient Sp1Zn2,3 does not induce apoptosis.
(A) EMSA without (-) or with in vitro produced wild-type human Sp1 (Sp1) and mutant Sp1 carrying point mutations on Zn fingers 2 and 3 (Sp1Zn2,3) using 32P-labeled oligonucleotide carrying a Sp1 consensus sequence as a probe. Arrowhead indicates the DNA-protein complex. (B) Drosophila SL2 cells were transiently co-transfected with luciferase reporter plasmid pGL2 driven by the tata-Sp1 promoter and plasmids pAC encoding wild-type Sp1 or mutated Sp1Zn2,3. Empty vector was used as control and pPac-EGFP to normalize the efficiency of transfection. Luciferase activity was assayed 48 hrs after transfection. Results are expressed as relative light units. Results are the mean ± sd of triplicate samples and are representative of at least 2 independent experiments. (C) Baf-3 cells were transduced with retroviruses encoding wild-type Sp1 or Sp1Zn2,3 and analysed 30 hrs later. Cells were costained for actin (red), Sp1 (green) and DNA (blue) and analysed by confocal microscopy. Arrowheads indicate cells overexpressing Sp1 or Sp1Zn2,3. Scale bar, 10 µm. (D) Quantification of DNA-bound Sp1 (Triton resistant). Twenty-four hrs post-infection with control, Sp1 or Sp1Zn2,3 carrying retroviruses, cells were stained for CD2, submitted to extraction with triton to remove soluble proteins and fixed. Cells were then stained for Sp1. The intensity of Sp1 staining was quantified in transduced CD2-positive cells (n) as well as in non-transduced neighbouring cells. The ratio of Sp1 signals in transduced versus non-transduced cells is presented. (E) Western blot analysis of Sp1 protein levels in parental Baf-3 cells and in cells transduced with either control, Sp1 or Sp1Zn2,3 retroviruses purified by magnetic selection with anti-CD2 antibody 30 hrs post-infection (left panel). The percentage of apoptotic cells (Annexin V positive) was measured at various time points among transduced cells (CD2 positive) by flow cytometry (right panel). Results show the mean ± sd of 3 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g002
Transcriptional response associated with overexpression of Sp1
To have a better insight into the molecular perturbations induced by Sp1 overexpression, we performed a genome-wide expression profiling to identify set of genes that are affected by overexpression of Sp1. Expression profiling was conducted comparing Baf-3-Sp1 clone 1 grown in the presence of doxycycline for 28 hrs as control and the same clone grown 28 hrs without doxycycline. This time corresponds to a point where cells already expressed high levels of Sp1 protein without any detectable cell death (Figure 1A). Three independent experiments were performed and analysed using the Affymetrix genechip Mouse genome 430 2.0 arrays (data deposited in ArrayExpress http://www.ebi.ac.uk/microarray-as/ae, accession number E-MEXP-1702). Sp1 overexpression was associated with a substantial modification of transcription profiles (Figure S4). Differential probesets expression following Sp1 overexpression relative to control was determined using statistical analysis in GeneSpring: 1294 genes with unique gene symbol identifiers were found to be differentially expressed with a fold change of expression of 1.3. Among them, the expression of 766 genes was increased whereas the expression of 528 genes was decreased. With a two-fold change of expression, 172 genes with unique gene symbol identifiers were found to be differentially expressed (162 up-regulated genes, 10 down-regulated genes). Table 1 shows the most up-regulated and down-regulated genes. Sp1 overexpression has an effect on the expression of many genes involved in metabolism, ubiquitination and transcription but also many genes with unknown functions. The kinetic of expression of five of the most up-regulated genes (Neo1, Cxcl4, Gsn, Slc39a8, and Jun) was precisely monitored using quantitative real-time PCR (Figure 3, left panels). Their up-regulation starts to be detected 16 hrs following doxycycline removal and is also observed in Baf-3 cells transduced with wild-type Sp1 but not Sp1Zn2,3 indicating that the binding of Sp1 to DNA is necessary for their induction (Figure 3, right panels).
[Figure omitted. See PDF.]
Figure 3. Changes in expression profile is dependent on Sp1 binding to DNA.
Kinetic of expression levels of five differentially expressed genes (Neogenin, Slc39a8, Gelsolin, Cxcl4, Jun) following doxycycline removal in Baf-3-Sp1 clone 1 (left panel). At the indicated times, cells were harvested and mRNA levels were measured by real-time PCR and normalized to HPRT mRNA levels. Results show the ratio of the mRNA levels measured in the absence of doxycycline relative to mRNA levels measured in the presence of doxycycline at each time point. Results show the mean ± sd of at least 2 independent experiments. Expression levels in Baf-3 cells transduced with either control, Sp1 or Sp1Zn2,3 retroviruses purified by magnetic selection with anti-CD2 antibody 30 hrs post-infection (right panel). Results show the mean ± sd of at least 2 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g003
[Figure omitted. See PDF.]
Table 1. Genes affected by Sp1 overexpression.
https://doi.org/10.1371/journal.pone.0007035.t001
Endogenous Sp1 is down-regulated immediately following Sp1 overexpression
One of the most down-regulated gene following overexpression of human Sp1 is the endogenous murine sp1 gene (2.3-fold decrease, Table 1). Sp1 promoter contains Sp1 binding sites and the Sp1 protein has been shown to autoregulates its own expression [26]. As Baf-3-Sp1 clone 1 expresses human Sp1 as well as GFP under the same inducible promoter we could monitor, in parallel, GFP protein expression by flow cytometry and both endogenous murine and ectopic human Sp1 mRNA levels by real-time PCR. Kinetic studies showed that the first GFP expressing cells are detected 8 hrs after doxycycline removal (Figure 4A). This correlates with the expression of ectopic Sp1 at the mRNA and protein levels (Figure 4B and data not shown). Importantly, down-regulation of endogenous sp1 gene transcription starts to be observed as early as 8 hrs after doxycycline removal in the whole cell population where only 20% of the cells are GFP positive (Figure 4C). This down-regulation requires the binding of Sp1 to the DNA. Altogether these results indicate that an excess of DNA-bound Sp1 is sensed by cells and induces a rapid repression of endogenous sp1 gene expression, revealing a transcriptional negative feedback loop.
[Figure omitted. See PDF.]
Figure 4. Sp1 autoregulates negatively its transcription.
(A) Baf-Sp1 clone 1 was grown in the absence of doxycycline. At the indicated times the percentage of GFP expressing cells was measured by Flow cytometry. (B) & (C) mRNA levels of ectopic human Sp1 and endogenous murine Sp1 mRNA levels measured as indicated in figure 3. Results show the ratio of the mRNA levels measured in Sp1-overexpressing cells relative to mRNA levels measured in control cells and show the mean ± sd of at least 2 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g004
Genes with Sp1 consensus binding site in their promoters are enriched among down-regulated genes but not among up-regulated genes
We next determined whether the set of Sp1-modified genes was enriched for the presence of Sp1 binding motif in their promoters (consensus Sp1 binding motif GGGGCGGGG as defined by TRANFAC 7.0 (V$SP1_Q6) and its variant GG[G/T]G[C/T]GGG [6]). As a control, we also estimated the degree of enrichment for STAT6 transcription factor binding site TTCN4GAA [25]. The presence of Sp1 and STAT6 binding sites was searched using a computational approach in the promoter regions consisting of 2000 bp upstream from the transcription start site. As a control, we analysed the promoters of a control list generated randomly that fulfils two criteria: no change in the gene expression levels following Sp1 overexpression and an overall distribution of expression that is similar to the one of the differentially expressed list (Figure S2). There was no significant difference in the percentage of promoters containing STAT6 site among down or up-regulated and control genes. In contrast, Sp1 sites were enriched among the promoters of genes whose expression was repressed (Table 2). Moreover, down-regulated genes contain on average more Sp1 sites in their promoters than genes from the control list. Surprisingly, there was no enrichment for the presence of Sp1 sites among the genes whose expression was increased by Sp1. The in silico analysis was extended using comparative genomic tool DiRE that predicts regulatory elements (RE) within the promoters of a set of genes based on their inter-species conservation and their transcription factor binding sites content. Again the percentage of candidate regulatory elements containing a Sp1 binding site was higher within down-regulated genes compared to a control list (Figure S5) and Sp1 was predicted to be the most important transcription factor within the promoters of down-regulated genes. When the analysis was extended to promoters and the most conserved Evolutionary Conserved Regions (ECRs), Sp1 occurrence was the highest among down-regulated genes. Altogether, these analysis indicate Sp1-binding sites are enriched only in down-regulated genes but not in up-regulated genes. This suggests that down-regulation of gene expression could be directly mediated by Sp1 whereas up-regulation of gene expression does not seem to involve the association of Sp1 with proximal promoters. As Sp1 DNA-binding is necessary for deregulation of gene expression, up-regulation of gene expression could represent an indirect event of Sp1 binding to genomic DNA.
[Figure omitted. See PDF.]
Table 2. Frequency of Sp1 consensus binding sites in the promoters of genes deregulated by Sp1.
https://doi.org/10.1371/journal.pone.0007035.t002
Deregulated expression of cell cycle regulating genes following Sp1 overexpression is associated with accumulation of cells in the G1 phase of the cell cycle
Among the genes found to be differentially expressed, using the Ingenuity Pathway Analysis software, we observed the highest enrichments for the following categories: cancer, cell death and cell cycle (Figure S6). The list of genes belonging to these 3 categories being very large, we focused our attention on the cell cycle category as only a very small number of genes involved in the core cell cycle machinery was found to be affected by Sp1 overexpression (Figure 5). As a matter of fact, microarray data indicated that among the genes associated with the progression through the cell cycle such as cyclins, cyclin-dependent protein kinases and cyclin-dependent kinase inhibitors, only three showed a significant modification of expression levels: Ccnd2 (cyclin D2, 1.7-fold decrease), Ccng2 (cyclin G2, 1.9-fold increase) and Cdkn2c (cyclin-dependent kinase inhibitor 2c/p18, 2.0-fold increase). The down-regulation of Ccnd2 expression and the up-regulation of Ccng2 and Cdkn2c expression can be observed 16 hrs after doxycycline removal in inducible Baf-3-Sp1 clone (Figure 6A) and require Sp1 binding to DNA (Figure 6B). These genes have all been involved in the regulation of the G1-S transition. Therefore, we next investigated whether Sp1-induced overexpression of these genes could impair cell proliferation. Baf-3-Sp1 clone 1 was grown in the absence or in the presence of doxycycline and the distribution of the cells through the different phases of the cell cycle was studied by flow cytometry after a pulse with BrdU. As soon as 22 hrs after Sp1 induction the percentage of cells in the G1 phase started to increase whereas the percentage of cells in the S phase decreased in comparison to control condition (Figure 7A). A more pronounced effect on cell cycle was observed 28 hrs after Sp1 expression. Similar results were obtained with Baf-3-Sp1 clone 2 (Figure 7B) and in parental Baf-3 cells transduced with wild-type Sp1 (Figure 7C). Cell cycle was not affected by the accumulation of truncated tSp1 in the cytoplasm of the cells (Figure 7D) or by the expression of Sp1Zn2,3 (Figure 7E). A detailed analysis of the cell cycle progression indicates that Sp1 overexpression only delays progression from the G1 to the S phase (data not shown). The results indicates that Sp1 overexpression leads to the expression of cell cycle inhibitor Cdkn2c and stress-associated cyclin G2, whereas the expression of cell cycle regulating cyclin D2 is down-regulated and this correlates with the inhibition of G1/S transition of cycling cells, a process that precedes the onset of cell death.
[Figure omitted. See PDF.]
Figure 5. Effect of Sp1 deregulation on the expression of cell cycle regulating genes.
Fold change of Cyclins, Cyclin-dependent kinases and Cyclin-dependent kinases inhibitors expression in Sp1 overexpressing cells compared to non expressing cells. Expression ratios are from microarray data (GeneSpring GX).
https://doi.org/10.1371/journal.pone.0007035.g005
[Figure omitted. See PDF.]
Figure 6. Changes in expression profile of cyclin D2, cdkn2c/p18 and cyclin G2.
mRNA levels of cyclin D2, cdkn2c and cyclin G2 in Baf-3-Sp1 clone 1 (A) or in Baf-3 cells transduced with control, Sp1 and Sp1Zn2,3 encoding retroviruses (B) were measured by real-time PCR as indicated in figure 3. Results show the ratio of the mRNA levels measured in Sp1-overexpressing cells relative to mRNA levels measured in control cells and show the means of ± sd of at least 2 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g006
[Figure omitted. See PDF.]
Figure 7. Cell cycle inhibition induced by Sp1 requires its binding to DNA.
(A) Baf-3-Sp1 clone 1 was grown in presence of doxycycline (+dox) or in absence of doxycycline for the indicated times (- dox) and pulsed with BrdU for 20 min. Cells were harvested and processed for BrdU labelling and DNA content staining. Cell cycle distribution was analysed by flow cytometry. Representative cell cycle profile with or without doxycycline at 28 hrs (left panel). Percentage of cells in the different phases of the cell cycle 22 or 28 hrs after treatment (right panel). (B) Cell cycle distribution of Baf-3-Sp1 clone 2 at 72 hrs. (C) Baf-3 cells were transduced with control or Sp1 encoding retrovirus. Cell cycle distribution among transduced (CD2 positive) cells 30 hrs post-infection. (D) Cell cycle distribution of Baf-3-tSp1 clone analysed after 72 hrs. (E) Baf-3 cells transduced with control or Sp1Zn2,3 encoding retroviruses were analysed 30 hrs later. Percentage of cells in the different phases of the cell cycle assessed among CD2 positive cells. Results show the means of ± sd of 2 to 3 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.g007
Discussion
This study extends previous findings that have shown that Sp1 overexpression is detrimental to untransformed cells [18], [19]. Our study shows that overexpressed Sp1 induces an inhibition of the progression through the cell cycle of Baf-3 cells that precedes apoptosis. Both processes require the binding of Sp1 to DNA and are not observed following the expression of a cytoplasmic truncated form of Sp1 or a mutated Sp1 unable to bind DNA. Microarray analysis shows that among the genes found to be differentially expressed following Sp1 overexpression there is an enrichment in genes involved in cancer, cell cycle and cell death.
Indeed, analysis of Sp1-induced deregulated genes with Ingenuity Pathways Analysis software revealed that 223 of them are linked with apoptosis. This includes the up-regulation of proteins that induce apoptosis when overexpressed such as pro-apoptotic Bcl-2 family members (Bmf, Bcl2L11/Bim, Bcl2L13/Rambo) [27], caspase 6 [28], cell death inducing factors (CIDEB, DAP) [29], [30], dependence receptor neogenin [31] (Table 1 and microarray data available in Array express). Therefore Sp1 overexpression could trigger apoptosis through one or a combination of these pathways.
A number of data support a link between Sp1 and cell cycle progression [16], [32]. A computational approach by Elkon et al. comparing the promoters of a set of cell cycle regulated genes revealed that Sp1 binding sequences are significantly enriched in promoters of genes that are expressed in G1/S phase [24]. Although Sp1 has been linked with cell growth, both positive and negative effects of Sp1 on cell growth have been reported. This is consistent with the regulation of both growth promoting genes as well as growth inhibitory genes by Sp1 [16]. Although down-regulation of cell cycle inhibitor cdkn1a/p21 has been implicated in Sp1-induced inhibition of proliferation in vascular smooth muscle cells [19], we did not find a significant modification of cdkn1a gene expression upon Sp1 induction in Baf-3 cells (Figure 5). However, we identified cyclin D2, cyclin G2 and cdkn2c/p18 as being deregulated among cell cycle regulating genes following the binding to DNA of overexpressed Sp1. The products of these genes could be responsible for Sp1-mediated cell cycle inhibition that we observed as they are all involved in regulating G1/S progression. D-cyclins are believed to serve as a link between the extracellular environment and the cell cycle machinery, driving progression through the G1/S phase of the cell cycle. In Baf-3 cells, Interleukin-3 removal induces a decrease of cyclin D2 mRNA expression and a cell cycle arrest that can be abolished by ectopic expression of cyclin D2 [33]. Cdkn2c is a member of the INK4 family that block cell cycle progression by binding to cyclin dependent kinase Cdk4 or Cdk6 and inhibiting the action of cyclin D. Finally, cyclin G2 is an unconventional cyclin that is up-regulated in B cells responding to growth inhibitory signals and its overexpression promotes a cell cycle arrest in G1 phase [34], [35]. These 3 genes have previously been shown to possess Sp1-binding sites in their promoters and/or to be regulated by Sp1 [36]–[38]. In our experimental system, regulation of these cell cycle genes are likely a direct consequence of Sp1 on transcription.
This study revealed that elevation of Sp1 levels is almost immediately followed by a decrease of sp1 gene transcription. As a matter of fact, endogenous Sp1 mRNA levels start to decrease as soon as 8 hrs after doxycycline removal. At this time point, only 20% of the cells are GFP positive and ectopic Sp1 mRNA starts to be detected in the whole population cell lysate. Transient transfections of Sp1 and luciferase assays using a minimal Sp1 promoter have revealed that Sp1 autoregulates positively its own transcription [26]. Our results confirm that Sp1 autoregulates its own transcription and that an excess of DNA-bound Sp1 represses sp1 gene transcription in the chromatin context.
The genome-wide expression profiling in Baf-3 cells indicates that a substantial proportion of expressed genes shows a modification of their transcription following Sp1 deregulation. Using real-time PCR, we have confirmed the impact of Sp1 on the expression of 18 out of 18 of these genes and shown that it requires Sp1 binding to DNA (this study and data not shown). To determine the proportion of genes that were potentially transcribed via binding of Sp1 to their promoter, we have search for Sp1-binding sites in the promoter of regulated genes. We observe that only down-regulated genes show a significant enrichment for Sp1 sites in their promoters. It is unlikely that this inhibition is due to the squelching of factors required for transcription as there is no global shut-down of transcription following Sp1 overexpression. Moreover expression of high levels of mutant nuclear form of Sp1 does not lead to transcription modulation. Therefore our results suggest that overexpressed DNA-bound Sp1 exerts a specific inhibitory effect on Sp1-driven transcription in Baf-3 cells. Contrasting with Sp1, the genes induced by c-Rel deregulation show an enrichment for genes containing consensus NF-kB/Rel sites in their proximal promoter region [39]. However, the up-regulation of a large number of genes following Sp1 overexpression could result from an indirect process that requires the binding of Sp1 to DNA. Indeed, DNA-binding of Sp1 could trigger transcription through multiple mechanisms. First, Sp1 could induce the expression of transcription factors that would then activate transcription. This seems unlikely since promoters of up-regulated genes did not exhibit an enrichment for binding sites for the few transcription factors (c-jun, Fos, E2F2) that were up-regulated by Sp1 (data not shown). Moreover, the DiRE analysis does not reveal an enrichment of putative regulatory elements in the non-coding sequence of deregulated genes (Figure S5). Second, Sp1 might affect gene transcription through the control of non coding RNA as it was observed that many Sp1 binding sites are localised next to non coding RNA genes [6]. Finally, the human genome contains more than 12,000 occupied Sp1 binding sites [6] and Sp1 has also been shown to localize within subnuclear foci that infrequently overlap with sites of transcription [40]. Therefore, the association of deregulated Sp1 with DNA might perturb chromatin structure. Further experiments will be necessary to determine the precise mechanisms involved in the gene transcription up-regulation induced by overexpressed Sp1.
Deregulated expression of Sp1 has been associated with the late steps of cell transformation [14]–[16]. Analysis of the categories of genes enriched following Sp1 deregulation revealed that the highest enrichment was observed for genes belonging to the Cancer category (Figure S6). The expression of genes known to have important role in migration/metastasis were up-regulated following Sp1 overexpression. This includes actin-binding protein gelsolin a protein involved in cell motility and required for cancer cell invasion [41], matrix metalloproteases MMP9 which degrade extracellular matrix and promotes invasion [42], metastasis-associated proteins S100A4/metastasin [43] and cathepsin B [44] (data not shown). Altogether these results show that Sp1 overexpression is detrimental for untransformed cells. However, in cells having acquired resistance to cell cycle inhibition and cell death, expression of these genes involved in migration/metastasis could confer a selective advantage and contribute to their further transformation.
Supporting Information
[Figure omitted. See PDF.]
Figure S1.
Sp1 constructs used in the study. Wild-type of Sp1 (Sp1) consists of four transactivation domains (A to D) and a DNA-binding domain (DBD) composed of three Zinc fingers. The mutant form Sp1Zn2,3 carries point mutation on the second and third Zinc fingers of the DBD. The truncated Sp1 tSp1 is composed of the first 418 amino acids.
https://doi.org/10.1371/journal.pone.0007035.s001
(0.28 MB EPS)
Figure S2.
Distribution of the expression of the genes differentially expressed following Sp1 deregulation (1610 probesets) (A) and the non-regulated genes from a control list (1700 probesets) (B) generated as indicated in the experimental procedures.
https://doi.org/10.1371/journal.pone.0007035.s002
(0.38 MB EPS)
Figure S3.
Zn finger mutations abolish Sp1 ability to induce apoptosis. Baf-3 cells were transduced with retroviruses encoding wild-type Sp1 (Sp1) or Sp1 mutants carrying mutations in their DNA binding domain and analysed 30 hrs later. (A) Cells were costained for actin (red), Sp1 (green) and DNA (blue) and analysed by confocal microscopy. Arrowheads indicate overexpressing cells. Scale bar, 10 µm. (B) Left Western blot analysis of Sp1 protein levels in Baf-3 cells transduced with either control, Sp1 or various Sp1Zn mutants retroviruses purified with anti-CD2 antibody 30 hrs post-infection. Right The percentage of apoptotic cells (Annexin V positive) was measured at various time points among infected cells (CD2 positive) by flow cytometry. Results show the mean ± sd of at least 2 independent experiments.
https://doi.org/10.1371/journal.pone.0007035.s003
(0.77 MB EPS)
Figure S4.
Gene expression profiles following Sp1 overexpression. Scatter plots of the mean signal intensity values of three independent microarray experiments (Affymetrix Mouse Genome 430.2). Data were analysed using GeneSpring GX 7.3 expression analysis software (Agilent Technology Inc). (A) All probesets. (B) Probesets differentially expressed following Sp1 overexpression relative to control. Differential expression was determined using GeneSpring GX 7.3 statistical analysis module ANOVA 1 way test, assuming variance not equal, choosing a false discovery rate of 6% with multiple testing correction (Benjamini and Hochberg). This gave a list of 1610 differentially expressed probesets with a fold change of expression of 1.3.
https://doi.org/10.1371/journal.pone.0007035.s004
(0.44 MB EPS)
Figure S5.
Analysis of transcription factor binding sites within Regulatory Elements (RE), predicted using inter-species conservation, of (A) down-regulaled genes, (B) up-regulated genes and (C) the control list (expressed but non- regulated). Search was performed via the DiRE server which uses RE located within as well outside promoters (http://dire.dcode.org, Gotea, V. and I. Ovcharenko (2008) DiRE: identifying distant regulatory elements of co-expressed genes. Nucleic Acids Research, doi:10.1093/nar/gkn300). The results show the occurence of transcription factor binding sites within RE and the Importance of each transcription factor that is the product of its occurrence and its weight (i.e. its association with the input gene set). The number of genes eligible for DiRE analysis are indicated.
https://doi.org/10.1371/journal.pone.0007035.s005
(0.36 MB EPS)
Figure S6.
Functional classification of differentially expressed genes following Sp1 overexpression. Functional classification was performed using the Ingenuity Pathway Analysis software. Among the genes found to be differentially expressed with a fold change of expression of 1.3, 732 genes were eligible for function/pathway analysis. The seven highest-ranking functional categories are shown. The scores are based on their connectivity.
https://doi.org/10.1371/journal.pone.0007035.s006
(0.34 MB EPS)
Acknowledgments
We thank the staff from the Plateau de Cytométrie and the Plateau d'Imagerie (IFR 128) for technical assistance. We thank Dr B. Kahn-Perlès for helpful suggestions.
Author Contributions
Conceived and designed the experiments: ED JM YL. Performed the experiments: ED JB RC MCM YL. Analyzed the data: ED JB RC BB LB JM MCM AL CAS AW JM YL. Contributed reagents/materials/analysis tools: JM MC JL CG. Wrote the paper: ED JM YL.
Citation: Deniaud E, Baguet J, Chalard R, Blanquier B, Brinza L, Meunier J, et al. (2009) Overexpression of Transcription Factor Sp1 Leads to Gene Expression Perturbations and Cell Cycle Inhibition. PLoS ONE4(9): e7035. https://doi.org/10.1371/journal.pone.0007035
1. Song J, Ugai H, Ogawa K, Wang Y, Sarai A, et al. (2001) Two consecutive zinc fingers in Sp1 and in MAZ are essential for interactions with cis-elements. J Biol Chem 276: 30429–30434.J. SongH. UgaiK. OgawaY. WangA. Sarai2001Two consecutive zinc fingers in Sp1 and in MAZ are essential for interactions with cis-elements.J Biol Chem2763042930434
2. Philipsen S, Suske G (1999) A tale of three fingers: the family of mammalian Sp/XKLF transcription factors. Nucleic Acids Res 27: 2991–3000.S. PhilipsenG. Suske1999A tale of three fingers: the family of mammalian Sp/XKLF transcription factors.Nucleic Acids Res2729913000
3. Mastrangelo IA, Courey AJ, Wall JS, Jackson SP, Hough PV (1991) DNA looping and Sp1 multimer links: a mechanism for transcriptional synergism and enhancement. Proc Natl Acad Sci U S A 88: 5670–5674.IA MastrangeloAJ CoureyJS WallSP JacksonPV Hough1991DNA looping and Sp1 multimer links: a mechanism for transcriptional synergism and enhancement.Proc Natl Acad Sci U S A8856705674
4. Li L, He S, Sun JM, Davie JR (2004) Gene regulation by Sp1 and Sp3. Biochem Cell Biol 82: 460–471.L. LiS. HeJM SunJR Davie2004Gene regulation by Sp1 and Sp3.Biochem Cell Biol82460471
5. Doetzlhofer A, Rotheneder H, Lagger G, Koranda M, Kurtev V, et al. (1999) Histone deacetylase 1 can repress transcription by binding to Sp1. Mol Cell Biol 19: 5504–5511.A. DoetzlhoferH. RothenederG. LaggerM. KorandaV. Kurtev1999Histone deacetylase 1 can repress transcription by binding to Sp1.Mol Cell Biol1955045511
6. Cawley S, Bekiranov S, Ng HH, Kapranov P, Sekinger EA, et al. (2004) Unbiased mapping of transcription factor binding sites along human chromosomes 21 and 22 points to widespread regulation of noncoding RNAs. Cell 116: 499–509.S. CawleyS. BekiranovHH NgP. KapranovEA Sekinger2004Unbiased mapping of transcription factor binding sites along human chromosomes 21 and 22 points to widespread regulation of noncoding RNAs.Cell116499509
7. Bouwman P, Philipsen S (2002) Regulation of the activity of Sp1-related transcription factors. Mol Cell Endocrinol 195: 27–38.P. BouwmanS. Philipsen2002Regulation of the activity of Sp1-related transcription factors.Mol Cell Endocrinol1952738
8. Saffer JD, Jackson SP, Annarella MB (1991) Developmental expression of Sp1 in the mouse. Mol Cell Biol 11: 2189–2199.JD SafferSP JacksonMB Annarella1991Developmental expression of Sp1 in the mouse.Mol Cell Biol1121892199
9. Wang L, Wei D, Huang S, Peng Z, Le X, et al. (2003) Transcription factor Sp1 expression is a significant predictor of survival in human gastric cancer. Clin Cancer Res 9: 6371–6380.L. WangD. WeiS. HuangZ. PengX. Le2003Transcription factor Sp1 expression is a significant predictor of survival in human gastric cancer.Clin Cancer Res963716380
10. Zannetti A, Del Vecchio S, Carriero MV, Fonti R, Franco P, et al. (2000) Coordinate up-regulation of Sp1 DNA-binding activity and urokinase receptor expression in breast carcinoma. Cancer Res 60: 1546–1551.A. ZannettiS. Del VecchioMV CarrieroR. FontiP. Franco2000Coordinate up-regulation of Sp1 DNA-binding activity and urokinase receptor expression in breast carcinoma.Cancer Res6015461551
11. Jiang NY, Woda BA, Banner BF, Whalen GF, Dresser KA, et al. (2008) Sp1, a new biomarker that identifies a subset of aggressive pancreatic ductal adenocarcinoma. Cancer Epidemiol Biomarkers Prev 17: 1648–1652.NY JiangBA WodaBF BannerGF WhalenKA Dresser2008Sp1, a new biomarker that identifies a subset of aggressive pancreatic ductal adenocarcinoma.Cancer Epidemiol Biomarkers Prev1716481652
12. Kumar AP, Butler AP (1999) Enhanced Sp1 DNA-binding activity in murine keratinocyte cell lines and epidermal tumors. Cancer Lett 137: 159–165.AP KumarAP Butler1999Enhanced Sp1 DNA-binding activity in murine keratinocyte cell lines and epidermal tumors.Cancer Lett137159165
13. Chuang JY, Wang YT, Yeh SH, Liu YW, Chang WC, et al. (2008) Phosphorylation by c-Jun NH2-terminal kinase 1 regulates the stability of transcription factor Sp1 during mitosis. Mol Biol Cell 19: 1139–1151.JY ChuangYT WangSH YehYW LiuWC Chang2008Phosphorylation by c-Jun NH2-terminal kinase 1 regulates the stability of transcription factor Sp1 during mitosis.Mol Biol Cell1911391151
14. Lou Z, O'Reilly S, Liang H, Maher VM, Sleight SD, et al. (2005) Down-regulation of overexpressed sp1 protein in human fibrosarcoma cell lines inhibits tumor formation. Cancer Res 65: 1007–1017.Z. LouS. O'ReillyH. LiangVM MaherSD Sleight2005Down-regulation of overexpressed sp1 protein in human fibrosarcoma cell lines inhibits tumor formation.Cancer Res6510071017
15. Yuan P, Wang L, Wei D, Zhang J, Jia Z, et al. (2007) Therapeutic inhibition of Sp1 expression in growing tumors by mithramycin a correlates directly with potent antiangiogenic effects on human pancreatic cancer. Cancer 110: 2682–2690.P. YuanL. WangD. WeiJ. ZhangZ. Jia2007Therapeutic inhibition of Sp1 expression in growing tumors by mithramycin a correlates directly with potent antiangiogenic effects on human pancreatic cancer.Cancer11026822690
16. Black AR, Black JD, Azizkhan-Clifford J (2001) Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer. J Cell Physiol 188: 143–160.AR BlackJD BlackJ. Azizkhan-Clifford2001Sp1 and kruppel-like factor family of transcription factors in cell growth regulation and cancer.J Cell Physiol188143160
17. Verrecchia F, Rossert J, Mauviel A (2001) Blocking sp1 transcription factor broadly inhibits extracellular matrix gene expression in vitro and in vivo: implications for the treatment of tissue fibrosis. J Invest Dermatol 116: 755–763.F. VerrecchiaJ. RossertA. Mauviel2001Blocking sp1 transcription factor broadly inhibits extracellular matrix gene expression in vitro and in vivo: implications for the treatment of tissue fibrosis.J Invest Dermatol116755763
18. Deniaud E, Baguet J, Mathieu AL, Pages G, Marvel J, et al. (2006) Overexpression of Sp1 transcription factor induces apoptosis. Oncogene 25: 7096–7105.E. DeniaudJ. BaguetAL MathieuG. PagesJ. Marvel2006Overexpression of Sp1 transcription factor induces apoptosis.Oncogene2570967105
19. Kavurma MM, Khachigian LM (2003) Sp1 inhibits proliferation and induces apoptosis in vascular smooth muscle cells by repressing p21WAF1/Cip1 transcription and cyclin D1-Cdk4-p21WAF1/Cip1 complex formation. J Biol Chem 278: 32537–32543.MM KavurmaLM Khachigian2003Sp1 inhibits proliferation and induces apoptosis in vascular smooth muscle cells by repressing p21WAF1/Cip1 transcription and cyclin D1-Cdk4-p21WAF1/Cip1 complex formation.J Biol Chem2783253732543
20. Leverrier Y, Thomas J, Perkins GR, Mangeney M, Collins MK, et al. (1997) In bone marrow derived Baf-3 cells, inhibition of apoptosis by IL-3 is mediated by two independent pathways. Oncogene 14: 425–430.Y. LeverrierJ. ThomasGR PerkinsM. MangeneyMK Collins1997In bone marrow derived Baf-3 cells, inhibition of apoptosis by IL-3 is mediated by two independent pathways.Oncogene14425430
21. Chamboredon S, Castellazzi M (2005) v-Jun downregulates the alpha 2 (I) collagen target gene indirectly through Sp1/3. Oncogene 24: 2547–2557.S. ChamboredonM. Castellazzi2005v-Jun downregulates the alpha 2 (I) collagen target gene indirectly through Sp1/3.Oncogene2425472557
22. Martini E, Roche DM, Marheineke K, Verreault A, Almouzni G (1998) Recruitment of phosphorylated chromatin assembly factor 1 to chromatin after UV irradiation of human cells. J Cell Biol 143: 563–575.E. MartiniDM RocheK. MarheinekeA. VerreaultG. Almouzni1998Recruitment of phosphorylated chromatin assembly factor 1 to chromatin after UV irradiation of human cells.J Cell Biol143563575
23. Marcais A, Tomkowiak M, Walzer T, Coupet CA, Ravel-Chapuis A, et al. (2006) Maintenance of CCL5 mRNA stores by post-effector and memory CD8 T cells is dependent on transcription and is coupled to increased mRNA stability. Eur J Immunol 36: 2745–2754.A. MarcaisM. TomkowiakT. WalzerCA CoupetA. Ravel-Chapuis2006Maintenance of CCL5 mRNA stores by post-effector and memory CD8 T cells is dependent on transcription and is coupled to increased mRNA stability.Eur J Immunol3627452754
24. Elkon R, Linhart C, Sharan R, Shamir R, Shiloh Y (2003) Genome-wide in silico identification of transcriptional regulators controlling the cell cycle in human cells. Genome Res 13: 773–780.R. ElkonC. LinhartR. SharanR. ShamirY. Shiloh2003Genome-wide in silico identification of transcriptional regulators controlling the cell cycle in human cells.Genome Res13773780
25. Ehret GB, Reichenbach P, Schindler U, Horvath CM, Fritz S, et al. (2001) DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites. J Biol Chem 276: 6675–6688.GB EhretP. ReichenbachU. SchindlerCM HorvathS. Fritz2001DNA binding specificity of different STAT proteins. Comparison of in vitro specificity with natural target sites.J Biol Chem27666756688
26. Nicolas M, Noe V, Jensen KB, Ciudad CJ (2001) Cloning and characterization of the 5′-flanking region of the human transcription factor Sp1 gene. J Biol Chem 276: 22126–22132.M. NicolasV. NoeKB JensenCJ Ciudad2001Cloning and characterization of the 5′-flanking region of the human transcription factor Sp1 gene.J Biol Chem2762212622132
27. Cory S, Huang DC, Adams JM (2003) The Bcl-2 family: roles in cell survival and oncogenesis. Oncogene 22: 8590–8607.S. CoryDC HuangJM Adams2003The Bcl-2 family: roles in cell survival and oncogenesis.Oncogene2285908607
28. Fernandes-Alnemri T, Litwack G, Alnemri ES (1995) Mch2, a new member of the apoptotic Ced-3/Ice cysteine protease gene family. Cancer Res 55: 2737–2742.T. Fernandes-AlnemriG. LitwackES Alnemri1995Mch2, a new member of the apoptotic Ced-3/Ice cysteine protease gene family.Cancer Res5527372742
29. Levy-Strumpf N, Kimchi A (1998) Death associated proteins (DAPs): from gene identification to the analysis of their apoptotic and tumor suppressive functions. Oncogene 17: 3331–3340.N. Levy-StrumpfA. Kimchi1998Death associated proteins (DAPs): from gene identification to the analysis of their apoptotic and tumor suppressive functions.Oncogene1733313340
30. Inohara N, Koseki T, Chen S, Wu X, Nunez G (1998) CIDE, a novel family of cell death activators with homology to the 45 kDa subunit of the DNA fragmentation factor. Embo J 17: 2526–2533.N. InoharaT. KosekiS. ChenX. WuG. Nunez1998CIDE, a novel family of cell death activators with homology to the 45 kDa subunit of the DNA fragmentation factor.Embo J1725262533
31. Matsunaga E, Tauszig-Delamasure S, Monnier PP, Mueller BK, Strittmatter SM, et al. (2004) RGM and its receptor neogenin regulate neuronal survival. Nat Cell Biol 6: 749–755.E. MatsunagaS. Tauszig-DelamasurePP MonnierBK MuellerSM Strittmatter2004RGM and its receptor neogenin regulate neuronal survival.Nat Cell Biol6749755
32. Lacroix I, Lipcey C, Imbert J, Kahn-Perles B (2002) Sp1 transcriptional activity is up-regulated by phosphatase 2A in dividing T lymphocytes. J Biol Chem 277: 9598–9605.I. LacroixC. LipceyJ. ImbertB. Kahn-Perles2002Sp1 transcriptional activity is up-regulated by phosphatase 2A in dividing T lymphocytes.J Biol Chem27795989605
33. Parada Y, Banerji L, Glassford J, Lea NC, Collado M, et al. (2001) BCR-ABL and interleukin 3 promote haematopoietic cell proliferation and survival through modulation of cyclin D2 and p27Kip1 expression. J Biol Chem 276: 23572–23580.Y. ParadaL. BanerjiJ. GlassfordNC LeaM. Collado2001BCR-ABL and interleukin 3 promote haematopoietic cell proliferation and survival through modulation of cyclin D2 and p27Kip1 expression.J Biol Chem2762357223580
34. Bennin DA, Don AS, Brake T, McKenzie JL, Rosenbaum H, et al. (2002) Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest. J Biol Chem 277: 27449–27467.DA BenninAS DonT. BrakeJL McKenzieH. Rosenbaum2002Cyclin G2 associates with protein phosphatase 2A catalytic and regulatory B' subunits in active complexes and induces nuclear aberrations and a G1/S phase cell cycle arrest.J Biol Chem2772744927467
35. Horne MC, Donaldson KL, Goolsby GL, Tran D, Mulheisen M, et al. (1997) Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest. J Biol Chem 272: 12650–12661.MC HorneKL DonaldsonGL GoolsbyD. TranM. Mulheisen1997Cyclin G2 is up-regulated during growth inhibition and B cell antigen receptor-mediated cell cycle arrest.J Biol Chem2721265012661
36. Blais A, Monte D, Pouliot F, Labrie C (2002) Regulation of the human cyclin-dependent kinase inhibitor p18INK4c by the transcription factors E2F1 and Sp1. J Biol Chem 277: 31679–31693.A. BlaisD. MonteF. PouliotC. Labrie2002Regulation of the human cyclin-dependent kinase inhibitor p18INK4c by the transcription factors E2F1 and Sp1.J Biol Chem2773167931693
37. Martino A, Holmes JHt, Lord JD, Moon JJ, Nelson BH (2001) Stat5 and Sp1 regulate transcription of the cyclin D2 gene in response to IL-2. J Immunol 166: 1723–1729.A. MartinoJHt HolmesJD LordJJ MoonBH Nelson2001Stat5 and Sp1 regulate transcription of the cyclin D2 gene in response to IL-2.J Immunol16617231729
38. Stossi F, Likhite VS, Katzenellenbogen JA, Katzenellenbogen BS (2006) Estrogen-occupied estrogen receptor represses cyclin G2 gene expression and recruits a repressor complex at the cyclin G2 promoter. J Biol Chem 281: 16272–16278.F. StossiVS LikhiteJA KatzenellenbogenBS Katzenellenbogen2006Estrogen-occupied estrogen receptor represses cyclin G2 gene expression and recruits a repressor complex at the cyclin G2 promoter.J Biol Chem2811627216278
39. Bunting K, Rao S, Hardy K, Woltring D, Denyer GS, et al. (2007) Genome-wide analysis of gene expression in T cells to identify targets of the NF-kappa B transcription factor c-Rel. J Immunol 178: 7097–7109.K. BuntingS. RaoK. HardyD. WoltringGS Denyer2007Genome-wide analysis of gene expression in T cells to identify targets of the NF-kappa B transcription factor c-Rel.J Immunol17870977109
40. He S, Sun JM, Li L, Davie JR (2005) Differential intranuclear organization of transcription factors Sp1 and Sp3. Mol Biol Cell 16: 4073–4083.S. HeJM SunL. LiJR Davie2005Differential intranuclear organization of transcription factors Sp1 and Sp3.Mol Biol Cell1640734083
41. Van den Abbeele A, De Corte V, Van Impe K, Bruyneel E, Boucherie C, et al. (2007) Downregulation of gelsolin family proteins counteracts cancer cell invasion in vitro. Cancer Lett 255: 57–70.A. Van den AbbeeleV. De CorteK. Van ImpeE. BruyneelC. Boucherie2007Downregulation of gelsolin family proteins counteracts cancer cell invasion in vitro.Cancer Lett2555770
42. Chang C, Werb Z (2001) The many faces of metalloproteases: cell growth, invasion, angiogenesis and metastasis. Trends Cell Biol 11: S37–43.C. ChangZ. Werb2001The many faces of metalloproteases: cell growth, invasion, angiogenesis and metastasis.Trends Cell Biol11S3743
43. Helfman DM, Kim EJ, Lukanidin E, Grigorian M (2005) The metastasis associated protein S100A4: role in tumour progression and metastasis. Br J Cancer 92: 1955–1958.DM HelfmanEJ KimE. LukanidinM. Grigorian2005The metastasis associated protein S100A4: role in tumour progression and metastasis.Br J Cancer9219551958
44. Vasiljeva O, Papazoglou A, Kruger A, Brodoefel H, Korovin M, et al. (2006) Tumor cell-derived and macrophage-derived cathepsin B promotes progression and lung metastasis of mammary cancer. Cancer Res 66: 5242–5250.O. VasiljevaA. PapazoglouA. KrugerH. BrodoefelM. Korovin2006Tumor cell-derived and macrophage-derived cathepsin B promotes progression and lung metastasis of mammary cancer.Cancer Res6652425250
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2009 Deniaud et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background
The ubiquitous transcription factor Sp1 regulates the expression of a vast number of genes involved in many cellular functions ranging from differentiation to proliferation and apoptosis. Sp1 expression levels show a dramatic increase during transformation and this could play a critical role for tumour development or maintenance. Although Sp1 deregulation might be beneficial for tumour cells, its overexpression induces apoptosis of untransformed cells. Here we further characterised the functional and transcriptional responses of untransformed cells following Sp1 overexpression.
Methodology and Principal Findings
We made use of wild-type and DNA-binding-deficient Sp1 to demonstrate that the induction of apoptosis by Sp1 is dependent on its capacity to bind DNA. Genome-wide expression profiling identified genes involved in cancer, cell death and cell cycle as being enriched among differentially expressed genes following Sp1 overexpression. In silico search to determine the presence of Sp1 binding sites in the promoter region of modulated genes was conducted. Genes that contained Sp1 binding sites in their promoters were enriched among down-regulated genes. The endogenous sp1 gene is one of the most down-regulated suggesting a negative feedback loop induced by overexpressed Sp1. In contrast, genes containing Sp1 binding sites in their promoters were not enriched among up-regulated genes. These results suggest that the transcriptional response involves both direct Sp1-driven transcription and indirect mechanisms. Finally, we show that Sp1 overexpression led to a modified expression of G1/S transition regulatory genes such as the down-regulation of cyclin D2 and the up-regulation of cyclin G2 and cdkn2c/p18 expression. The biological significance of these modifications was confirmed by showing that the cells accumulated in the G1 phase of the cell cycle before the onset of apoptosis.
Conclusion
This study shows that the binding to DNA of overexpressed Sp1 induces an inhibition of cell cycle progression that precedes apoptosis and a transcriptional response targeting genes containing Sp1 binding sites in their promoter or not suggesting both direct Sp1-driven transcription and indirect mechanisms.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer