About the Authors:
Xiangning Chen
* E-mail: [email protected]
Affiliations Department of Psychiatry and Virginia Institute for Psychiatric and Behavior Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America, Department of Human and Molecular Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America
Cuie Sun
Affiliation: Department of Psychiatry and Virginia Institute for Psychiatric and Behavior Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America
Qi Chen
Affiliation: Department of Psychiatry and Virginia Institute for Psychiatric and Behavior Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America
F. Anthony O'Neill
Affiliation: The Department of Psychiatry, The Queens University, Belfast, Northern Ireland
Dermot Walsh
Affiliation: The Health Research Board, Dublin, Ireland
Ayman H. Fanous
Affiliation: Washington VA Medical Center, Washington, D. C., and Georgetown University School of Medicine, Washington, D. C., United States of America
Kodavali V. Chowdari
Affiliation: Department of Psychiatry, University of Pittsburgh School of Medicine and Graduate School of Public Health, Pittsburgh, Pennsylvania, United States of America
Vishwajit L. Nimgaonkar
Affiliation: Department of Psychiatry, University of Pittsburgh School of Medicine and Graduate School of Public Health, Pittsburgh, Pennsylvania, United States of America
Adrian Scott
Affiliation: Western Australian Institute for Medical Research, Centre for Medical Research, University of Western Australia, Perth, Australia
Sibylle G. Schwab
Affiliation: Western Australian Institute for Medical Research, Centre for Medical Research, University of Western Australia, Perth, Australia
Dieter B. Wildenauer
Affiliation: Centre for Clinical Research in Neuropsychiatry, School of Psychiatry and Clinical Neurosciences, University of Western Australia, Perth, Australia
Ronglin Che
Affiliation: Bio-X Center, Shanghai Jiao Tong University, Shanghai, People's Republic of China
Wei Tang
Affiliation: Bio-X Center, Shanghai Jiao Tong University, Shanghai, People's Republic of China
Yongyong Shi
Affiliation: Bio-X Center, Shanghai Jiao Tong University, Shanghai, People's Republic of China
Lin He
Affiliation: Bio-X Center, Shanghai Jiao Tong University, Shanghai, People's Republic of China
Xiong-jian Luo
Affiliation: State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, People's Republic of China
Bing Su
Affiliation: State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, People's Republic of China
Todd L. Edwards
Affiliation: Miami institute of human genetics, University of Miami, Miami, Florida, United States of America
Zhongming Zhao
Affiliation: Departments of Biomedical Informatics and Psychiatry, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America
Kenneth S. Kendler
Affiliations Department of Psychiatry and Virginia Institute for Psychiatric and Behavior Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America, Department of Human and Molecular Genetics, Virginia Commonwealth University, Richmond, Virginia, United States of America
Introduction
Schizophrenia is a complex psychiatric disorder with strong genetic influences. Recently, many genes have been identified as potential susceptibility candidates [8], [10], [55], [56]. In a recent study, we reported the association of MEGF10 with schizophrenia in our Irish family and case-control samples [7]. MEGF10 is the human ortholog of the draper (DRPR) and cell death abnormal 1 (CED-1) gene in Drosophila melanogaster and Caenorhabditis elegans respectively [62]. In both Drosophila and C. elegans, DRPR and CED-1 are key components of phagocytosis functioning in the clearance of apoptotic cells [23], [67]. In multicellular organisms, phagocytosis is a crucial process in development and in the innate immune system [17], [26]. In addition to its role in the clearance of apoptotic cells, DRPR plays a critical role in axon pruning and degenerating neurons [1], [30]. In C. elegans, CED-1 mutations cause abnormal axon patterns and commissure branching [51].
In C. elegans, two parallel pathways are involved in the clearance of apoptotic cells. One involves the CED-2, CED-5 and CED-12 genes, which activate GTPase CED-10 and trigger rearrangement of cytoskeleton during phagocytosis. The other involves the CED-1, CED-6 and CED-7 genes. CED-1 is a membrane protein that senses cell death signals and recognizes neighboring cell corpses. It clusters at the phagocytic cups and initiates pseudopod extension. CED-6 is an adaptor protein for CED-1, helping to control the delivery of vesicles to phagocytic cups and phagosomes. CED-7 works with CED-1 in recognizing engulfment signals of cell corpses. The detail functions of these genes are reviewed recently [12], [24], [32].
The apoptotic engulfment pathways are evolutionarily conserved and it is believed that they function similarly in higher organisms, including humans [24]. In the last several years, orthologs of several components of these pathways have been identified in mammals [28], [39], [63]. In humans, MEGF10 and GULP1 have been determined to be orthologs of CED-1 and CED-6 respectively [16], [28], [59]. For CED-7, two human genes, ABCA1 and ABCA7, are proposed as orthologs [16], [19], [39]. Based on our study of the MEGF10 gene and its function in apoptosis, we hypothesize that the apoptotic engulfment pathways are involved in the etiology of schizophrenia. To test the hypothesis, we conducted association studies of GULP1, ABCA1 and ABCA7, located at chromosomes 2, 9 and 19 respectively, with the Irish study of high density schizophrenia families (ISHDSF) and Irish case-control study of schizophrenia (ICCSS) samples and followed up these analyses with targeted replication in multiple independent samples. In this article, we report the results from these studies.
Results
Association analysis
The GULP1 gene.
The GULP1 gene was the first gene in the CED pathway we analyzed in this study. As in our previous studies [4]–[9], the ISHDSF sample was used as a screening sample and the ICCSS was used to follow up as a replication sample. For the 10 SNPs typed in the ISHDSF sample, multiple markers reached nominal significance by the pedigree disequilibrium test (PDT) [34] (Table 1). Subsequently, we typed the same SNPs in the ICCSS sample. Two SNPs, rs2004888 and rs4522565 were nominally significant, and another SNP, rs10469735, was significant at a trend level. Rs2004888 was the only marker that was significant in both ISHDSF and ICCSS sample, and the associated allele, T, was the same in the two samples. Overall, the 10 SNPs typed in GULP1 gene have similar frequencies and LD structure in both ISHDSF and ICCSS samples (see Table S1, Figure S1 in supplementary materials).
[Figure omitted. See PDF.]
Table 1. Single marker association analyses of the GULP1 gene.
https://doi.org/10.1371/journal.pone.0006875.t001
The ABCA1 and ABCA7 genes.
We typed 11 and 5 SNPs for the ABCA1 and ABCA7 genes to test whether these genes in the phagocytosis pathway may impact on risk for schizophrenia. Rs4149324 in ABCA1 was nominally associated with the disease in the ICCSS sample (p = 0.0258) and rs2242436 in ABCA7 was significant in the ISHDSF sample (p = 0.0013) (supplementary Table S2). Like the GULP1 gene, markers in ABCA1 and ABCA7 genes have similar frequencies and LD structure in the two Irish samples (Table S1 and Figure S1).
Gene-gene interaction in the CED pathway
To test whether genes interact to increase risk for schizophrenia, we examined gene-gene interaction by the multifactor dimensionality reduction pedigree disequilibrium test (MDR-PDT) [35] and the multifactor dimensionality reduction method (MDR) [46] for the ISHDSF and ICCSS samples respectively. In both samples, 36 SNPs typed in the MEGF10 (10 markers), GULP1 (10 markers), ABCA1 (11 markers) and ABCA7 (5 markers) gene were included in the analyses. We limited our search to 2- and 3-marker interactions. In the MDR-PDT analyses of the ISHDSF sample, we found a significant 2-marker interaction (p = 0.011): SNPs rs3858075 in the ABCA1 gene and rs2242436 in the ABCA7 gene interact with each other to increase risk of the disease. In the model, 3 genotype combinations of rs3858075 and rs2242436 (C/C-G/G, C/T-G/G and T/T-G/A) were overrepresented in the affected individuals (Figure 1). The overall OR of these groups were 26.2, 95% CI 3.2–210.8, p = 0.002 (Table 2). In the analyses of the ICCSS sample, we found a significant 3-marker interaction (p = 0.006). These 3 markers come from the GULP1 (rs4522565), ABCA1 (rs3858075) and MEGF10 (rs246896) genes. In this model, the most abundant risk genotype group is T/T-C/C-C/T for markers rs4522565-3858075-rs246896 (Figure 1). None of these markers had significant main effects in our regression analysis. In contrast, the 3-marker interaction term was significant with an OR of 1.31, 95% CI 1.03–1.7, p = 0.0120 (Table 2). SNP rs3858075 in the ABCA1 was involved in both the 2-marker and 3-marker interactions observed in the two samples. No gene-gene interaction analyses were conducted for other samples since they were typed only for rs2004888.
[Figure omitted. See PDF.]
Figure 1. MDR-PDT and MDR analysis of the MEGF10, GULP1, ABCA1 and ABCA7 genes in the ISHDSF (A) and ICCSS (B) samples.
For each cell, the count of affected individuals was plotted as the left bar, the count of unaffected was plotted as the right bar. The risk genotype combinations, defined as ratio of affected/unaffected in each cell, were highlighted.
https://doi.org/10.1371/journal.pone.0006875.g001
[Figure omitted. See PDF.]
Table 2. Effect estimates of the gene-gene interaction.
https://doi.org/10.1371/journal.pone.0006875.t002
Replication of rs2004888
Based on the results of the GULP1 gene, we selected rs2004888 for replication in other samples. In addition to the ICCSS, we typed this marker in the German, Pittsburgh, Shanghai and Kunming samples. As shown in Table 3, of the 5 replication samples, only ICCSS and Kunming samples were nominally significant, but the associated alleles were different in these two samples. When the 3 Caucasian replication samples were combined (3139 subjects, 1378 affected), the result was very significant (p = 0.0003). For the two Chinese samples, the Shanghai sample had the same allele overrepresented in the affected individuals as the Caucasian samples. But the Kunming sample was in the opposite direction. When the Chinese samples combined (cases = 1458, controls = 1740), the results were not significant. When all 5 replication samples were combined (6131 subjects, 2836 affected), the association became weaker (p = 0.0057, Table 3) due to the Chinese samples. Given our limited testing in these genes, the p value for the Caucasian replication samples survived Bonferroni correction for experiment-wide significance. But when the 2 Chinese samples were added, while the overall p value was nominally significant, it would not survive experiment-wide correction. We verified these results by meta-analysis. When all samples were included in the meta-analyses, rs2004888 was significantly associated with the disease (OR = 1.09, 95% CI 1.02–1.16, p = 0.011). While the meta-analysis results for all replication samples were not significant (OR = 1.06, 95% CI 0.98–1.13, p = 0.152), the results for Caucasian samples were significant (OR = 1.15, 95% CI 1.03–1.29, p = 0.0140). These results were consistent with the combined analyses.
[Figure omitted. See PDF.]
Table 3. Replication of rs2004888*.
https://doi.org/10.1371/journal.pone.0006875.t003
Discussion
While there is compelling evidence that genetic factors are involved in the etiology of schizophrenia, the involvement of specific genes and variants remains elusive. Most recent efforts to identify the risk genes focus on genome-wide association followed by targeted replications. Using this strategy, some genes have been identified as promising candidates in very large samples [42], [43]. Our group has taken a different approach, focusing on the clearly defined biological pathways and interactions. Using this approach, we identified that both IL3 and CSF2RB are involved in the disease [4], [6], and independent studies [27], [38], [60] provide further support that CSF2RB, CSF2RA and IL3RA, the common and interleukin specific subunits of IL3 and CSF2 receptors, may also play an etiological role. Collectively, these studies support a role for the IL3/CSF2 pathway in schizophrenia. This study follows the same strategy and extends our finding of MEGF10 involvement in schizophrenia [7]. MEGF10 is the human ortholog of CED-1, a key component of apoptotic engulfment pathway in C. elegans. Studies have shown that this phagocytic pathway is evolutionarily conserved, and multiple orthologs of CED genes have been identified in Drosophila [1], mouse [2], rat [36] and human [28], [39], [62]. Furthermore, protein products of these ortholog genes perform similar biological functions in the same pathway [17], [23], [26], [28], [39], [58], [59], [62], [63], [68], [69]. To test whether other CED orthologs in human are involved in schizophrenia, we conducted association analyses of the GULP1, ABCA1 and ABCA7 genes that are the human orthologs of the CED-6 and CED-7 genes. In this study, we found nominal associations in all 3 genes. Most importantly, rs2004888, a marker in the GULP1 gene, was consistently significant (p = 0.0003) in combined Caucasian replication samples (3139 subjects, 1378 affected). In addition, we found significant gene-gene interactions in both our ISHDSF and ICCSS samples that involve all known human orthologs (MEGF10, GULP1, ABCA1 and ABCA7) of the CED-1, CED-6 and CED-7 pathway. Based on these data, we conclude that GULP1 and the CED-1, CED-6 and CED-7 pathway are involved in schizophrenia. This finding is significant that it opens the door for focused biological studies of the role of these genes in schizophrenia.
There may be ethnic heterogeneity at the rs2004888 locus. Four of the 6 samples used in this study are Caucasian and these samples identify the same risk allele in both family and case-control samples. Collectively, these 4 Caucasian samples produced a highly significant association (p = 0.0001, data not shown). In contrast, the combined Chinese samples were not significant. We compared the allele frequency between the Caucasian and Chinese samples, while the major alleles are the same in both Caucasian and Chinese samples, its frequency in the Caucasian sample is significantly lower than that of the Chinese sample (0.878 vs. 0.927). Since the two Chinese samples were not typed for other SNPs in this region, we compared the haplotype structure of GULP1 between Caucasian and Chinese populations using the SNPs typed in the dbSNP database. In both populations, rs2004888 is in high LD with other markers in this region. However, the frequency of the undertransmitted haplotype in the Caucasian population is significantly higher than that in the Chinese population (0.142 vs. 0.039). These differences in LD structure may be responsible for the differences in association signal observed at this locus.
We have noticed that the OR at rs2004888 is close to some promising candidates recently identified from genome-wide association studies [42], [43]. The ZNF804A gene (rs1344706) has an OR of 1.12 and rs17101921 (near FGFR2 gene) has an OR of 1.17. At rs2004888, we have an OR of 1.25 for the Caucasian case-control samples and an odds of transmission ratio of 1.17 in the family samples. Consistent with these other studies, our results clearly suggest that large samples are necessary to identify these risk genes. This may explain why some individual samples did not produce significant results.
The statistical interactions observed in this study are supported by physical contact and biological modulation. In one study, ABCA1 protein is found to physically interact with MEGF10 protein and functionally modulates the MEGF10-mediated engulfment of apoptotic cells [16]. In addition to phagocytosis, both ABCA1 and ABCA7 are involved in lipid metabolism and homeostasis [64], and there is evidence that these genes are regulated in a coordinated fashion [18]. We also notice that multiple polymorphisms in the ABCA1 gene have been found to be associated with Alzheimer's disease [11], [21], [49], [61], although the relationship between the Alzheimer disease and schizophrenia remains unclear.
At this time, we don't understand the mechanism how the apoptotic engulfment pathway contributes to schizophrenia. Based on the functions of this pathway, we can speculate how the apoptotic clearance and engulfment pathway might be involved in the disease. In the development of the central nervous system, programmed cell death, i.e. apoptosis, is evident in shaping the neuronal circuitries and functions [25], [31], [40]. Rapid clearance of cell corpses is essential for maintaining tissue homeostasis and preventing the release of potentially cytotoxic or antigenic molecules from dying cells. Defects in cell corpse clearance are closely associated with autoimmune and inflammatory responses in C. elegans [50]. There are reports that there are dysfunctions in autoimmune system and elevated amount of inflammatory cytokines in schizophrenia patients [20], [41], [45], [52], suggesting that autoimmune and inflammatory cytokines may be involved in the disease. The defects in the apoptotic pathway may be a factor contributing to dysfunctional autoimmune system and elevated inflammatory cytokines observed in schizophrenia patients. Specific to the genes, mutations in CED-1, CED-6 and CED-7 results in abnormal commisure patterns [51] and axon pruning [1], [30] in C. elegans and Drosophila. Since the genes are highly conserved, it would not be a surprise that mutations in their human orthologs (i.e. MEGF10, GULP1, ABCA1 and ABCA7) would cause similar abnormal projections and synaptic connections.
In this study, we provide genetic evidence that the GULP1 gene and the apoptotic engulfment pathway may be involved in schizophrenia. Since the engulfment pathway is evolutionarily conserved, many genetic and functional studies in model organisms can provide new insights to understand the pathophysiology of schizophrenia. Following the guidance of these animal model studies, it would be of great interest to examine the functions of these genes in humans and to determine how the dysfunction of these genes may lead to the disease.
Materials and Methods
Sample description
Ethics statement.
This study was conducted according to the principles expressed in the Declaration of Helsinki. The study was approved by Institutional Review Boards/Ethics Committees at Virginia Commonwealth University (ISHDSF and ICCSS), University of Pittsburgh (the Pittsburgh sample), Western Australian University (the German sample), the Zoology Institute of Chinese Academy of Science (Kunming sample) and Jiaotong University (Shanghai sample). All patients provided written informed consent for the collection of samples and subsequent analysis.
The ISHDSF sample.
The Irish study of high density schizophrenia families (ISHDSF) was collected in Northern Ireland, United Kingdom and the Republic of Ireland. Phenotypes were assessed using DSM-III-R. The diagnoses were originally classified a hierarchy of 10 categories reflecting the probable genetic relationship of these syndromes to classic schizophrenia. In this study, we used the narrow disease definition, which include only categories D1 and D2 in the original classification. In this narrow definition, only patients met DSM-III-R definitions of schizophrenia, poor-outcome schizoaffective disorder and simple schizophrenia were classified as affected. The sample contained 273 pedigrees and about 1350 subjects had DNA sample for genotyping. Of them, 515 were diagnosed as affected using definition described above. Detailed descriptions of the sample have been published previously [22].
The ICCSS sample.
The Irish case-control study of schizophrenia (ICCSS) sample was collected in the same geographic regions as that of the ISHDSF sample. The affected subjects were selected from in-patient and out-patient psychiatric facilities in the Republic of Ireland and Northern Ireland. Subjects were eligible for inclusion if they had a diagnosis of schizophrenia or poor-outcome schizoaffective disorder by DSM-III-R criteria, and the diagnosis was confirmed by a blind expert diagnostic review. Controls, selected from several sources, including blood donation centers, were included if they denied a lifetime history of schizophrenia. However, the controls were not screened by clinicians. Both cases and controls were included only if they reported all four grandparents as being born in Ireland or the United Kingdom. Using these criteria, a total of 1417 subjects (625 affected subjects and 792 controls) were included in this study.
The German family sample.
The German sample consisted of two subsamples, 79 affected sib pairs with parents and 125 proband-parents trios. Of the 79 sib pairs, 54 were used in the linkage study where overlapping linkage peak was found between the ISHDSF and German sib samples [53], [57]. The trios were selected from a larger trio sample [44] with positive family history (defined as at least one first or second degree relative of the proband meeting the DSM IV criteria of schizophrenia or schizoaffective disorder).
Pittsburgh family sample.
The Pittsburgh sample contained 247 nuclear families (case and parents) with a total of 729 subjects with DNA for genotyping. Subjects were recruited from inpatients and outpatients facilities within a 500 mile radius of Pittsburgh and met DSM IV criteria of schizophrenia or schizoaffective disorder. All probands self-reported as with Caucasian ancestry [10].
The Shanghai case control sample.
The Shanghai case control sample consisted of 942 unrelated patients with schizophrenia and 946 control individuals. All subjects were of Han Chinese origin. A clinical interview was administered by two independent senior psychiatrists to all patients according to the criteria of the DSM-IV. All patients were policlinic and recruited from the Shanghai Mental Health Center, East China. The healthy controls were drawn from the general population in the East China. None had a history of psychotic disorders. Participants were fully informed of, and gave written consent for, the genetics analysis, which was reviewed and approved by the Shanghai Ethics Committee of Human Genetic Resources.
The Kunming case control sample.
The Kunming case control sample consisted of 516 schizophrenia patients and 794 normal controls. All affected subjects were self-reported as Han Chinese and were recruited from Yunnan Mental Health Hospital, Kunming city, Yunnan Province, China. The patients were diagnosed by two trained psychiatrists independently and met the criteria of the Diagnostic and Statistical Manual of Mental Disorders, 4th edition (DSM-IV) for schizophrenia. Subjects with substance-induced psychotic disorders, learning disabilities, head injuries and other symptomatic psychoses were excluded. The controls were recruited from the same province, and all were self-reported as Han Chinese.
Marker selection and genotyping
We used the HapMap data (http://www.hapmap.org/) and the available assays developed by Applied BioSystems to assist in our selection of markers. For each gene, we decided to cover the transcribed genomic region plus 50 kb on both ends. We downloaded the Caucasian HapMap data from HapMap website, and analyzed the LD structure with the HaploView program [3]. We selected SNPs (r2> = 0.80) tagging major haplotypes (with frequency > = 5%) for each gene. SNPs tagging minor haplotypes (those with frequencies less than 5%) were not considered. The main reasons we considered only major haplotypes were twofold. First, minor haplotypes with low frequencies are normally less reliable because computational inference usually does not do a very good job when the allele frequencies are low. Second, given the sample size of our Irish samples, it is not very likely that we have sufficient power to detect these low frequency haplotypes. Based on these criteria, we obtained 10 SNPs for GULP1, 11 SNPs for ABCA7 and 5 SNPs for ABCA7.
Five samples used in this study (ISHDSF, ICCSS, the German, the Pittsburgh and the Shanghai samples) were typed with the TaqMan method [29]. The assays used were either validated assays or custom designed assays developed by Applied BioSystems Corporation (Foster city, CA). Genotypes were scored with a semi-automated procedures developed in our lab [65] or with software from the commercial providers. The Kunming sample was typed with single base extension with capillary electrophoresis. The PCR primers used were TTTTGGATTCGGCGGATTAGG and CTGGAAGTTCGCTCCTGGGTC, and the extension primer used was TTTTTTTTTTTTACCTTACCGCCCCTCGGGATATCAGCTTCT. All markers typed were checked for deviation from the Hardy-Weinberg Equilibrium (HWE) and Mendelian errors by the PEDSTATS program [66]. Detail information of these typed markers in the ISHDSF and ICCSS was listed in Table S1 in the supplementary materials.
Statistical analyses
Single marker association tests.
We used the pedigree disequilibrium test (PDT) [34] as implemented in the UNPHASED program (version 2.4, PDTPHASE module) [13] to analyze the ISHDSF sample. In these analyses, both vertical and horizontal transmissions were included. The p values reported were based on weighing all families equally (the ave option in the program). For the other 5 individual samples and the combined samples, the newer version of the UNPHASED program (version 3.11), which was designed to analyze case-control samples, family samples or combined case-control and family samples [14], was used to analyze single marker associations. In this analysis, ethnicity was used as a covariate. Meta-analyses were conducted using the Comprehensive Meta-Analysis software 2.0 from Biostat (Englewood, NJ, USA) (www.meta-analysis.com/). We used the HaploView program (version 4.0) [3] to estimate pairwise LD and to illustrate haplotype blocks. The haplotype blocks were partitioned by the confidence interval algorithm [15].
Gene-gene interaction.
The multifactor dimensionality reduction pedigree disequilibrium test (MDR-PDT) [35] was used to explore multi-locus associations in the ISHDSF sample. The MDR-PDT was a within-family measure of indirect or direct association between genotype and disease. As described previously [35], the PDT statistic [33] functioned within the framework of the MDR algorithm. Genotypes were classified as high and low-risk by comparing the PDT statistic to a threshold of 0, where positive statistics indicate evidence for association at that genotype. The MDR-PDT statistic was then calculated for the pooled high-risk genotypes for each set of loci. The models were ordered and evaluated by MDR-PDT statistics. A permutation test was applied to estimate the significance of the result, which inherently adjusted for the size of the search performed. The permutation test consisted of randomizing status for offspring, holding the proportion of affected individuals constant across permutations, calculating the statistic, and repeating many times to estimate the distribution of the null hypothesis. The test based on the permutation procedure would have the correct type I error rate, even for sparse data. This validity was due to all contingency table cells from each permutation containing the same number of observations as those from the unpermuted data. In this study, we limited our search to include only 2- and 3-locus interactions. To estimate the degree of effect modification between the MDR-PDT model SNPs, we fitted conditional logistic regression models with adjustment for residual correlation among affected offspring due to linkage [54]. For model fitting, the genotypes were specified as high or low-risk, denoted as exposed (1) or unexposed (0) respectively, by MDR-PDT analysis of individual loci.
For the ICCSS sample, we used the multifactor dimensionality reduction method (MDR) [37], [47], [48] to examine potential gene-gene interactions. MDR was a nonparametric method that performs an exhaustive search of all possible interactions and maps the data into a single dimension relevant to association. Similar to the MDR-PDT procedure, significance was evaluated via permutation testing, which inherently adjusted for the multiple comparisons from the search performed. As in the family sample, we limited our search to 2- and 3-locus interactions. The effect of interaction was estimated by generalized linear regression model as implemented in the SPSS software (SPSS for Windows, version 16.0).
Supporting Information
[Figure omitted. See PDF.]
Figure S1.
A comparison of LD between the ISHDSF and ICCSS samples for GULP1, ABCA1 and ABCA7 zgenes.
https://doi.org/10.1371/journal.pone.0006875.s001
(0.51 MB DOC)
Table S1.
Marker information.
https://doi.org/10.1371/journal.pone.0006875.s002
(0.07 MB DOC)
Table S2.
Single marker association analyses in the ABCA1 and ABCA7 genes.
https://doi.org/10.1371/journal.pone.0006875.s003
(0.06 MB DOC)
Acknowledgments
We are grateful to the patients and their families for participating in this study. The Northern Ireland Blood Transfusion Service assisted with collection of control sample.
Author Contributions
Conceived and designed the experiments: XC. Performed the experiments: CS QC AS SGS RC XjL. Analyzed the data: XC TLE. Contributed reagents/materials/analysis tools: AO DW AHF KVC VLN AS SGS DBW RC WT YS LH XjL BS ZZ KSK. Wrote the paper: XC.
Citation: Chen X, Sun C, Chen Q, O'Neill FA, Walsh D, Fanous AH, et al. (2009) Apoptotic Engulfment Pathway and Schizophrenia. PLoS ONE4(9): e6875. https://doi.org/10.1371/journal.pone.0006875
1. Awasaki T, Tatsumi R, Takahashi K, Arai K, Nakanishi Y, et al. (2006) Essential role of the apoptotic cell engulfment genes draper and ced-6 in programmed axon pruning during Drosophila metamorphosis. Neuron 50: 855–867.T. AwasakiR. TatsumiK. TakahashiK. AraiY. Nakanishi2006Essential role of the apoptotic cell engulfment genes draper and ced-6 in programmed axon pruning during Drosophila metamorphosis.Neuron50855867
2. Banerjee H, Hawkins Z, Johnson T, Eley S, Alikhan A, et al. (2003) Identification of a mouse orthologue of the CED-6 gene of Caenorhabditis elegans. Plasmid 49: 30–33.H. BanerjeeZ. HawkinsT. JohnsonS. EleyA. Alikhan2003Identification of a mouse orthologue of the CED-6 gene of Caenorhabditis elegans.Plasmid493033
3. Barrett JC, Fry B, Maller J, Daly MJ (2005) Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics 21: 263–265.JC BarrettB. FryJ. MallerMJ Daly2005Haploview: analysis and visualization of LD and haplotype maps.Bioinformatics21263265
4. Chen Q, Wang X, O'Neill FA, Walsh D, Fanous A, et al. (2007) Association study of CSF2RB with schizophrenia in Irish family and case - control samples. Mol Psychiatry 13: 930–938.Q. ChenX. WangFA O'NeillD. WalshA. Fanous2007Association study of CSF2RB with schizophrenia in Irish family and case - control samples.Mol Psychiatry13930938
5. Chen Q, Wang X, O'Neill FA, Walsh D, Kendler KS, et al. (2008) Is the histidine triad nucleotide-binding protein 1 (HINT1) gene a candidate for schizophrenia? Schizophr Res 106: 200–207.Q. ChenX. WangFA O'NeillD. WalshKS Kendler2008Is the histidine triad nucleotide-binding protein 1 (HINT1) gene a candidate for schizophrenia?Schizophr Res106200207
6. Chen X, Wang X, Hossain S, O'Neill AF, Walsh D, et al. (2007) Interleukin 3 and schizophrenia: The impact of sex and family history. Mol Psychiatry 12: 273–282.X. ChenX. WangS. HossainAF O'NeillD. Walsh2007Interleukin 3 and schizophrenia: The impact of sex and family history.Mol Psychiatry12273282
7. Chen X, Wang X, Chen Q, Williamson V, van den OE, et al. (2008) MEGF10 association with schizophrenia. Biol Psychiatry 63: 441–448.X. ChenX. WangQ. ChenV. WilliamsonOE van den2008MEGF10 association with schizophrenia.Biol Psychiatry63441448
8. Chen X, Wang X, Hossain S, O'Neill FA, Walsh D, et al. (2006) Haplotypes spanning SPEC2, PDZ-G EF2 and ACSL6 genes are associated with schizophrenia. Hum Mol Genet 15: 3329–3342.X. ChenX. WangS. HossainFA O'NeillD. Walsh2006Haplotypes spanning SPEC2, PDZ-G EF2 and ACSL6 genes are associated with schizophrenia.Hum Mol Genet1533293342
9. Chen X, Wang X, Sun C, Chen Q, O'Neill FA, et al. (2008) FBXL21 association with schizophrenia in Irish family and case-control samples. Am J Med Genet B Neuropsychiatr Genet 147B: 1231–1237.X. ChenX. WangC. SunQ. ChenFA O'Neill2008FBXL21 association with schizophrenia in Irish family and case-control samples.Am J Med Genet B Neuropsychiatr Genet147B12311237
10. Chowdari KV, Mirnics K, Semwal P, Wood J, Lawrence E, et al. (2002) Association and linkage analyses of RGS4 polymorphisms in schizophrenia. Hum Mol Genet 11: 1373–1380.KV ChowdariK. MirnicsP. SemwalJ. WoodE. Lawrence2002Association and linkage analyses of RGS4 polymorphisms in schizophrenia.Hum Mol Genet1113731380
11. Chu LW, Li Y, Li Z, Tang AY, Cheung BM, et al. (2007) A novel intronic polymorphism of ABCA1 gene reveals risk for sporadic Alzheimer's disease in Chinese. Am J Med Genet B Neuropsychiatr Genet 144B: 1007–1013.LW ChuY. LiZ. LiAY TangBM Cheung2007A novel intronic polymorphism of ABCA1 gene reveals risk for sporadic Alzheimer's disease in Chinese.Am J Med Genet B Neuropsychiatr Genet144B10071013
12. Conradt B, Xue D (2005) Programmed cell death. WormBook 1–13.B. ConradtD. Xue2005Programmed cell death.WormBook113
13. Dudbridge F (2003) Pedigree disequilibrium tests for multilocus haplotypes. Genet Epidemiol 25: 115–121.F. Dudbridge2003Pedigree disequilibrium tests for multilocus haplotypes.Genet Epidemiol25115121
14. Dudbridge F (2008) Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data. Hum Hered 66: 87–98.F. Dudbridge2008Likelihood-based association analysis for nuclear families and unrelated subjects with missing genotype data.Hum Hered668798
15. Gabriel SB, Schaffner SF, Nguyen H, Moore JM, Roy J, et al. (2002) The structure of haplotype blocks in the human genome. Science 296: 2225–2229.SB GabrielSF SchaffnerH. NguyenJM MooreJ. Roy2002The structure of haplotype blocks in the human genome.Science29622252229
16. Hamon Y, Trompier D, Ma Z, Venegas V, Pophillat M, et al. (2006) Cooperation between Engulfment Receptors: The Case of ABCA1 and MEGF10. PLoS ONE 1: e120-.Y. HamonD. TrompierZ. MaV. VenegasM. Pophillat2006Cooperation between Engulfment Receptors: The Case of ABCA1 and MEGF10.PLoS ONE1e120-
17. Haskins KA, Russell JF, Gaddis N, Dressman HK, Aballay A (2008) Unfolded protein response genes regulated by CED-1 are required for Caenorhabditis elegans innate immunity. Dev Cell 15: 87–97.KA HaskinsJF RussellN. GaddisHK DressmanA. Aballay2008Unfolded protein response genes regulated by CED-1 are required for Caenorhabditis elegans innate immunity.Dev Cell158797
18. Hayashi M, be-Dohmae S, Okazaki M, Ueda K, Yokoyama S (2005) Heterogeneity of high density lipoprotein generated by ABCA1 and ABCA7. J Lipid Res 46: 1703–1711.M. HayashiS. be-DohmaeM. OkazakiK. UedaS. Yokoyama2005Heterogeneity of high density lipoprotein generated by ABCA1 and ABCA7.J Lipid Res4617031711
19. Jehle AW, Gardai SJ, Li S, Linsel-Nitschke P, Morimoto K, et al. (2006) ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages. J Cell Biol 174: 547–556.AW JehleSJ GardaiS. LiP. Linsel-NitschkeK. Morimoto2006ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages.J Cell Biol174547556
20. Jones AL, Mowry BJ, Pender MP, Greer JM (2005) Immune dysregulation and self-reactivity in schizophrenia: do some cases of schizophrenia have an autoimmune basis? Immunol Cell Biol 83: 9–17.AL JonesBJ MowryMP PenderJM Greer2005Immune dysregulation and self-reactivity in schizophrenia: do some cases of schizophrenia have an autoimmune basis?Immunol Cell Biol83917
21. Katzov H, Chalmers K, Palmgren J, Andreasen N, Johansson B, et al. (2004) Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism. Hum Mutat 23: 358–367.H. KatzovK. ChalmersJ. PalmgrenN. AndreasenB. Johansson2004Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism.Hum Mutat23358367
22. Kendler KS, Myers JM, O'Neill FA, Martin R, Murphy B, et al. (2000) Clinical features of schizophrenia and linkage to chromosomes 5q, 6p, 8p, and 10p in the Irish Study of High-Density Schizophrenia Families. Am J Psychiatry 157: 402–408.KS KendlerJM MyersFA O'NeillR. MartinB. Murphy2000Clinical features of schizophrenia and linkage to chromosomes 5q, 6p, 8p, and 10p in the Irish Study of High-Density Schizophrenia Families.Am J Psychiatry157402408
23. Kinchen JM, Cabello J, Klingele D, Wong K, Feichtinger R, et al. (2005) Two pathways converge at CED-10 to mediate actin rearrangement and corpse removal in C. elegans. Nature 434: 93–99.JM KinchenJ. CabelloD. KlingeleK. WongR. Feichtinger2005Two pathways converge at CED-10 to mediate actin rearrangement and corpse removal in C. elegans.Nature4349399
24. Kinchen JM, Ravichandran KS (2007) Journey to the grave: signaling events regulating removal of apoptotic cells. J Cell Sci 120: 2143–2149.JM KinchenKS Ravichandran2007Journey to the grave: signaling events regulating removal of apoptotic cells.J Cell Sci12021432149
25. Kurant E, Axelrod S, Leaman D, Gaul U (2008) Six-microns-under acts upstream of Draper in the glial phagocytosis of apoptotic neurons. Cell 133: 498–509.E. KurantS. AxelrodD. LeamanU. Gaul2008Six-microns-under acts upstream of Draper in the glial phagocytosis of apoptotic neurons.Cell133498509
26. Lamitina T, Cherry S (2008) Dangerous liaisons: the apoptotic engulfment receptor CED-1 links innate immunity to the unfolded protein response. Dev Cell 15: 3–4.T. LamitinaS. Cherry2008Dangerous liaisons: the apoptotic engulfment receptor CED-1 links innate immunity to the unfolded protein response.Dev Cell1534
27. Lencz T, Morgan TV, Athanasiou M, Dain B, Reed CR, et al. (2007) Converging evidence for a pseudoautosomal cytokine receptor gene locus in schizophrenia. Mol Psychiatry 12: 572–580.T. LenczTV MorganM. AthanasiouB. DainCR Reed2007Converging evidence for a pseudoautosomal cytokine receptor gene locus in schizophrenia.Mol Psychiatry12572580
28. Liu QA, Hengartner MO (1999) Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein CED-6. Curr Biol 9: 1347–1350.QA LiuMO Hengartner1999Human CED-6 encodes a functional homologue of the Caenorhabditis elegans engulfment protein CED-6.Curr Biol913471350
29. Livak KJ (1999) Allelic discrimination using fluorogenic probes and the 5′ nuclease assay. Genet Anal 14: 143–149.KJ Livak1999Allelic discrimination using fluorogenic probes and the 5′ nuclease assay.Genet Anal14143149
30. MacDonald JM, Beach MG, Porpiglia E, Sheehan AE, Watts RJ, et al. (2006) The Drosophila cell corpse engulfment receptor Draper mediates glial clearance of severed axons. Neuron 50: 869–881.JM MacDonaldMG BeachE. PorpigliaAE SheehanRJ Watts2006The Drosophila cell corpse engulfment receptor Draper mediates glial clearance of severed axons.Neuron50869881
31. Mallat M, Marin-Teva JL, Cheret C (2005) Phagocytosis in the developing CNS: more than clearing the corpses. Curr Opin Neurobiol 15: 101–107.M. MallatJL Marin-TevaC. Cheret2005Phagocytosis in the developing CNS: more than clearing the corpses.Curr Opin Neurobiol15101107
32. Mangahas PM, Zhou Z (2005) Clearance of apoptotic cells in Caenorhabditis elegans. Semin Cell Dev Biol 16: 295–306.PM MangahasZ. Zhou2005Clearance of apoptotic cells in Caenorhabditis elegans.Semin Cell Dev Biol16295306
33. Martin ER, Bass MP, Gilbert JR, Pericak-Vance MA, Hauser ER (2003) Genotype-based association test for general pedigrees: the genotype-PDT. Genet Epidemiol 25: 203–213.ER MartinMP BassJR GilbertMA Pericak-VanceER Hauser2003Genotype-based association test for general pedigrees: the genotype-PDT.Genet Epidemiol25203213
34. Martin ER, Monks SA, Warren LL, Kaplan NL (2000) A test for linkage and association in general pedigrees: the pedigree disequilibrium test. Am J Hum Genet 67: 146–154.ER MartinSA MonksLL WarrenNL Kaplan2000A test for linkage and association in general pedigrees: the pedigree disequilibrium test.Am J Hum Genet67146154
35. Martin ER, Ritchie MD, Hahn L, Kang S, Moore JH (2006) A novel method to identify gene-gene effects in nuclear families: the MDR-PDT. Genet Epidemiol 30: 111–123.ER MartinMD RitchieL. HahnS. KangJH Moore2006A novel method to identify gene-gene effects in nuclear families: the MDR-PDT.Genet Epidemiol30111123
36. Martins-Silva C, Ferreira LT, Cyr M, Koenen J, Fernandes DR, et al. (2006) A rat homologue of CED-6 is expressed in neurons and interacts with clathrin. Brain Res 1119: 1–12.C. Martins-SilvaLT FerreiraM. CyrJ. KoenenDR Fernandes2006A rat homologue of CED-6 is expressed in neurons and interacts with clathrin.Brain Res1119112
37. Moore JH (2004) Computational analysis of gene-gene interactions using multifactor dimensionality reduction. Expert Rev Mol Diagn 4: 795–803.JH Moore2004Computational analysis of gene-gene interactions using multifactor dimensionality reduction.Expert Rev Mol Diagn4795803
38. Moskvina V, Craddock N, Holmans P, Nikolov I, Pahwa JS, et al. (2008) Gene-wide analyses of genome-wide association data sets: evidence for multiple common risk alleles for schizophrenia and bipolar disorder and for overlap in genetic risk. Mol Psychiatry -. V. MoskvinaN. CraddockP. HolmansI. NikolovJS Pahwa2008Gene-wide analyses of genome-wide association data sets: evidence for multiple common risk alleles for schizophrenia and bipolar disorder and for overlap in genetic risk.Mol Psychiatry -
39. Moynault A, Luciani MF, Chimini G (1998) ABC1, the mammalian homologue of the engulfment gene ced-7, is required during phagocytosis of both necrotic and apoptotic cells. Biochem Soc Trans 26: 629–635.A. MoynaultMF LucianiG. Chimini1998ABC1, the mammalian homologue of the engulfment gene ced-7, is required during phagocytosis of both necrotic and apoptotic cells.Biochem Soc Trans26629635
40. Napoli I, Neumann H (2008) Microglial clearance function in health and disease. Neuroscience -. I. NapoliH. Neumann2008Microglial clearance function in health and disease.Neuroscience -
41. Nunes SO, Matsuo T, Kaminami MS, Watanabe MA, Reiche EM, et al. (2006) An autoimmune or an inflammatory process in patients with schizophrenia, schizoaffective disorder, and in their biological relatives. Schizophr Res-. SO NunesT. MatsuoMS KaminamiMA WatanabeEM Reiche2006An autoimmune or an inflammatory process in patients with schizophrenia, schizoaffective disorder, and in their biological relatives.Schizophr Res-
42. O'Donovan MC, Craddock N, Norton N, Williams H, Peirce T, et al. (2008) Identification of loci associated with schizophrenia by genome-wide association and follow-up. Nat Genet 40: 1053–1055.MC O'DonovanN. CraddockN. NortonH. WilliamsT. Peirce2008Identification of loci associated with schizophrenia by genome-wide association and follow-up.Nat Genet4010531055
43. O'Donovan MC, Norton N, Williams H, Peirce T, Moskvina V, et al. (2009) Analysis of 10 independent samples provides evidence for association between schizophrenia and a SNP flanking fibroblast growth factor receptor 2. Mol Psychiatry 14: 30–36.MC O'DonovanN. NortonH. WilliamsT. PeirceV. Moskvina2009Analysis of 10 independent samples provides evidence for association between schizophrenia and a SNP flanking fibroblast growth factor receptor 2.Mol Psychiatry143036
44. Petryshen TL, Middleton FA, Tahl AR, Rockwell GN, Purcell S, et al. (2005) Genetic investigation of chromosome 5q GABAA receptor subunit genes in schizophrenia. Mol Psychiatry 10: 1074–88, 1057.TL PetryshenFA MiddletonAR TahlGN RockwellS. Purcell2005Genetic investigation of chromosome 5q GABAA receptor subunit genes in schizophrenia.Mol Psychiatry10107488, 1057
45. Potvin S, Stip E, Sepehry AA, Gendron A, Bah R, et al. (2008) Inflammatory cytokine alterations in schizophrenia: a systematic quantitative review. Biol Psychiatry 63: 801–808.S. PotvinE. StipAA SepehryA. GendronR. Bah2008Inflammatory cytokine alterations in schizophrenia: a systematic quantitative review.Biol Psychiatry63801808
46. Ritchie MD, Hahn LW, Moore JH (2003) Power of multifactor dimensionality reduction for detecting gene-gene interactions in the presence of genotyping error, missing data, phenocopy, and genetic heterogeneity. Genet Epidemiol 24: 150–157.MD RitchieLW HahnJH Moore2003Power of multifactor dimensionality reduction for detecting gene-gene interactions in the presence of genotyping error, missing data, phenocopy, and genetic heterogeneity.Genet Epidemiol24150157
47. Ritchie MD, Hahn LW, Moore JH (2003) Power of multifactor dimensionality reduction for detecting gene-gene interactions in the presence of genotyping error, missing data, phenocopy, and genetic heterogeneity. Genet Epidemiol 24: 150–157.MD RitchieLW HahnJH Moore2003Power of multifactor dimensionality reduction for detecting gene-gene interactions in the presence of genotyping error, missing data, phenocopy, and genetic heterogeneity.Genet Epidemiol24150157
48. Ritchie MD, Hahn LW, Roodi N, Bailey LR, Dupont WD, et al. (2001) Multifactor-dimensionality reduction reveals high-order interactions among estrogen-metabolism genes in sporadic breast cancer. Am J Hum Genet 69: 138–147.MD RitchieLW HahnN. RoodiLR BaileyWD Dupont2001Multifactor-dimensionality reduction reveals high-order interactions among estrogen-metabolism genes in sporadic breast cancer.Am J Hum Genet69138147
49. Rodriguez-Rodriguez E, Mateo I, Llorca J, Sanchez-Quintana C, Infante J, et al. (2007) Association of genetic variants of ABCA1 with Alzheimer's disease risk. Am J Med Genet B Neuropsychiatr Genet 144B: 964–968.E. Rodriguez-RodriguezI. MateoJ. LlorcaC. Sanchez-QuintanaJ. Infante2007Association of genetic variants of ABCA1 with Alzheimer's disease risk.Am J Med Genet B Neuropsychiatr Genet144B964968
50. Savill J, Dransfield I, Gregory C, Haslett C (2002) A blast from the past: clearance of apoptotic cells regulates immune responses. Nat Rev Immunol 2: 965–975.J. SavillI. DransfieldC. GregoryC. Haslett2002A blast from the past: clearance of apoptotic cells regulates immune responses.Nat Rev Immunol2965975
51. Schmitz C, Kinge P, Hutter H (2007) Axon guidance genes identified in a large-scale RNAi screen using the RNAi-hypersensitive Caenorhabditis elegans strain nre-1(hd20) lin-15b(hd126). Proc Natl Acad Sci U S A 104: 834–839.C. SchmitzP. KingeH. Hutter2007Axon guidance genes identified in a large-scale RNAi screen using the RNAi-hypersensitive Caenorhabditis elegans strain nre-1(hd20) lin-15b(hd126).Proc Natl Acad Sci U S A104834839
52. Schmitz T, Chew LJ (2008) Cytokines and myelination in the central nervous system. ScientificWorldJournal 8: 1119–1147.T. SchmitzLJ Chew2008Cytokines and myelination in the central nervous system.ScientificWorldJournal811191147
53. Schwab SG, Eckstein GN, Hallmayer J, Lerer B, Albus M, et al. (1997) Evidence suggestive of a locus on chromosome 5q31 contributing to susceptibility for schizophrenia in German and Israeli families by multipoint affected sib-pair linkage analysis. Mol Psychiatry 2: 156–160.SG SchwabGN EcksteinJ. HallmayerB. LererM. Albus1997Evidence suggestive of a locus on chromosome 5q31 contributing to susceptibility for schizophrenia in German and Israeli families by multipoint affected sib-pair linkage analysis.Mol Psychiatry2156160
54. Siegmund KD, Langholz B, Kraft P, Thomas DC (2000) Testing linkage disequilibrium in sibships. Am J Hum Genet 67: 244–248.KD SiegmundB. LangholzP. KraftDC Thomas2000Testing linkage disequilibrium in sibships.Am J Hum Genet67244248
55. Stefansson H, Sigurdsson E, Steinthorsdottir V, Bjornsdottir S, Sigmundsson T, et al. (2002) Neuregulin 1 and susceptibility to schizophrenia. Am J Hum Genet 71: 877–892.H. StefanssonE. SigurdssonV. SteinthorsdottirS. BjornsdottirT. Sigmundsson2002Neuregulin 1 and susceptibility to schizophrenia.Am J Hum Genet71877892
56. Straub RE, Jiang Y, MacLean CJ, Ma Y, Webb BT, et al. (2002) Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia. Am J Hum Genet 71: 337–348.RE StraubY. JiangCJ MacLeanY. MaBT Webb2002Genetic variation in the 6p22.3 gene DTNBP1, the human ortholog of the mouse dysbindin gene, is associated with schizophrenia.Am J Hum Genet71337348
57. Straub RE, MacLean CJ, O'Neill FA, Walsh D, Kendler KS (1997) Support for a possible schizophrenia vulnerability locus in region 5q22-31 in Irish families. Mol Psychiatry 2: 148–155.RE StraubCJ MacLeanFA O'NeillD. WalshKS Kendler1997Support for a possible schizophrenia vulnerability locus in region 5q22-31 in Irish families.Mol Psychiatry2148155
58. Su HP, Brugnera E, Van CW, Smits E, Hengartner M, et al. (2000) Identification and characterization of a dimerization domain in CED-6, an adapter protein involved in engulfment of apoptotic cells. J Biol Chem 275: 9542–9549.HP SuE. BrugneraCW VanE. SmitsM. Hengartner2000Identification and characterization of a dimerization domain in CED-6, an adapter protein involved in engulfment of apoptotic cells.J Biol Chem27595429549
59. Su HP, Nakada-Tsukui K, Tosello-Trampont AC, Li Y, Bu G, et al. (2002) Interaction of CED-6/GULP, an adapter protein involved in engulfment of apoptotic cells with CED-1 and CD91/low density lipoprotein receptor-related protein (LRP). J Biol Chem 277: 11772–11779.HP SuK. Nakada-TsukuiAC Tosello-TrampontY. LiG. Bu2002Interaction of CED-6/GULP, an adapter protein involved in engulfment of apoptotic cells with CED-1 and CD91/low density lipoprotein receptor-related protein (LRP).J Biol Chem2771177211779
60. Sun S, Wang F, Wei J, Cao LY, Wu GY, et al. (2008) Association between interleukin-3 receptor alpha polymorphism and schizophrenia in the Chinese population. Neurosci Lett 440: 35–37.S. SunF. WangJ. WeiLY CaoGY Wu2008Association between interleukin-3 receptor alpha polymorphism and schizophrenia in the Chinese population.Neurosci Lett4403537
61. Sundar PD, Feingold E, Minster RL, DeKosky ST, Kamboh MI (2007) Gender-specific association of ATP-binding cassette transporter 1 (ABCA1) polymorphisms with the risk of late-onset Alzheimer's disease. Neurobiol Aging 28: 856–862.PD SundarE. FeingoldRL MinsterST DeKoskyMI Kamboh2007Gender-specific association of ATP-binding cassette transporter 1 (ABCA1) polymorphisms with the risk of late-onset Alzheimer's disease.Neurobiol Aging28856862
62. Suzuki E, Nakayama M (2007) MEGF10 is a mammalian ortholog of CED-1 that interacts with clathrin assembly protein complex 2 medium chain and induces large vacuole formation. Exp Cell Res 313: 3729–3742.E. SuzukiM. Nakayama2007MEGF10 is a mammalian ortholog of CED-1 that interacts with clathrin assembly protein complex 2 medium chain and induces large vacuole formation.Exp Cell Res31337293742
63. Suzuki E, Nakayama M (2007) The mammalian Ced-1 ortholog MEGF10/KIAA1780 displays a novel adhesion pattern. Exp Cell Res 313: 2451–2464.E. SuzukiM. Nakayama2007The mammalian Ced-1 ortholog MEGF10/KIAA1780 displays a novel adhesion pattern.Exp Cell Res31324512464
64. Takahashi K, Kimura Y, Nagata K, Yamamoto A, Matsuo M, et al. (2005) ABC proteins: key molecules for lipid homeostasis. Med Mol Morphol 38: 2–12.K. TakahashiY. KimuraK. NagataA. YamamotoM. Matsuo2005ABC proteins: key molecules for lipid homeostasis.Med Mol Morphol38212
65. van den Oord EJ, Jiang Y, Riley BP, Kendler KS, Chen X (2003) FP-TDI SNP scoring by manual and statistical procedures: a study of error rates and types. Biotechniques 34: 610–20, 622.EJ van den OordY. JiangBP RileyKS KendlerX. Chen2003FP-TDI SNP scoring by manual and statistical procedures: a study of error rates and types.Biotechniques3461020, 622
66. Wigginton JE, Cutler DJ, Abecasis GR (2005) A note on exact tests of Hardy-Weinberg equilibrium. Am J Hum Genet 76: 887–893.JE WiggintonDJ CutlerGR Abecasis2005A note on exact tests of Hardy-Weinberg equilibrium.Am J Hum Genet76887893
67. Yu X, Lu N, Zhou Z (2008) Phagocytic receptor CED-1 initiates a signaling pathway for degrading engulfed apoptotic cells. PLoS Biol 6: e61-.X. YuN. LuZ. Zhou2008Phagocytic receptor CED-1 initiates a signaling pathway for degrading engulfed apoptotic cells.PLoS Biol6e61-
68. Yu X, Odera S, Chuang CH, Lu N, Zhou Z (2006) C. elegans Dynamin mediates the signaling of phagocytic receptor CED-1 for the engulfment and degradation of apoptotic cells. Dev Cell 10: 743–757.X. YuS. OderaCH ChuangN. LuZ. Zhou2006C. elegans Dynamin mediates the signaling of phagocytic receptor CED-1 for the engulfment and degradation of apoptotic cells.Dev Cell10743757
69. Zhou Z, Hartwieg E, Horvitz HR (2001) CED-1 is a transmembrane receptor that mediates cell corpse engulfment in C. elegans. Cell 104: 43–56.Z. ZhouE. HartwiegHR Horvitz2001CED-1 is a transmembrane receptor that mediates cell corpse engulfment in C. elegans.Cell1044356
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2009 Chen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (the “License”), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Background
Apoptosis has been speculated to be involved in schizophrenia. In a previously study, we reported the association of the MEGF10 gene with the disease. In this study, we followed the apoptotic engulfment pathway involving the MEGF10, GULP1, ABCA1 and ABCA7 genes and tested their association with the disease.
Methodology/Principal Findings
Ten, eleven and five SNPs were genotyped in the GULP1, ABCA1 and ABCA7 genes respectively for the ISHDSF and ICCSS samples. In all 3 genes, we observed nominally significant associations. Rs2004888 at GULP1 was significant in both ISHDSF and ICCSS samples (p = 0.0083 and 0.0437 respectively). We sought replication in independent samples for this marker and found highly significant association (p = 0.0003) in 3 Caucasian replication samples. But it was not significant in the 2 Chinese replication samples. In addition, we found a significant 2-marker (rs2242436 * rs3858075) interaction between the ABCA1 and ABCA7 genes in the ISHDSF sample (p = 0.0022) and a 3-marker interaction (rs246896 * rs4522565 * rs3858075) amongst the MEGF10, GULP1 and ABCA1 genes in the ICCSS sample (p = 0.0120). Rs3858075 in the ABCA1 gene was involved in both 2- and 3-marker interactions in the two samples.
Conclusions/Significance
From these data, we concluded that the GULP1 gene and the apoptotic engulfment pathway are involved in schizophrenia in subjects of European ancestry and multiple genes in the pathway may interactively increase the risks to the disease.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer