Genome Sequencing Reveals Widespread Virulence Gene Exchange among Human Neisseria Species

Abstract

Commensal bacteria comprise a large part of the microbial world, playing important roles in human development, health and disease. However, little is known about the genomic content of commensals or how related they are to their pathogenic counterparts. The genus Neisseria, containing both commensal and pathogenic species, provides an excellent opportunity to study these issues. We undertook a comprehensive sequencing and analysis of human commensal and pathogenic Neisseria genomes. Commensals have an extensive repertoire of virulence alleles, a large fraction of which has been exchanged among Neisseria species. Commensals also have the genetic capacity to donate DNA to, and take up DNA from, other Neisseria. Our findings strongly suggest that commensal Neisseria serve as reservoirs of virulence alleles, and that they engage extensively in genetic exchange.

About the Authors:

Pradeep Reddy Marri

* E-mail: [email protected]

Affiliation: The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America

Mary Paniscus

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Graduate Interdisciplinary Program in Genetics, University of Arizona, Tucson, Arizona, United States of America

Nathan J. Weyand

Contributed equally to this work with: Nathan J. Weyand, María A. Rendón, Christine M. Calton

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America

María A. Rendón

Contributed equally to this work with: Nathan J. Weyand, María A. Rendón, Christine M. Calton

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America

Christine M. Calton

Contributed equally to this work with: Nathan J. Weyand, María A. Rendón, Christine M. Calton

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America, Department of Molecular Microbiology and Immunology, Oregon Health and Science University, Portland, Oregon, United States of America

Diana R. Hernández

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America

Dustin L. Higashi

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America

Erica Sodergren

Affiliation: The Genome Center, Washington University School of Medicine, St. Louis, Missouri, United States of America

George M. Weinstock

Affiliation: The Genome Center, Washington University School of Medicine, St. Louis, Missouri, United States of America

Steven D. Rounsley

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, School of Plant Sciences, University of Arizona, Tucson, Arizona, United States of America

Magdalene So

Affiliations The BIO5 Institute, University of Arizona, Tucson, Arizona, United States of America, Department of Immunobiology, University of Arizona, Tucson, Arizona, United States of America

Introduction

The genus Neisseria is a large group of β-Proteobacteria that are obligate symbionts of humans and animals. At least eight species of commensal Neisseria colonize human mucosal surfaces [1], [2]. These sites are also infected by two pathogenic Neisseria: Neisseria meningitidis, which causes epidemics of meningitis and septicemia, and Neisseria gonorrhoeae, a sexually transmitted bacterium. Because of their importance to global public health, research has focused mainly on the two pathogens, leading to the identification of many virulence factors that are important for infection in humans. Recent reports indicate that commensal Neisseria also possess virulence genes [3], [4], [5]. However, these studies focused either on a limited number of virulence genes or on only one commensal genome, that of Neisseria lactamica. The total virulence gene content of the Neisseria genus is unknown.

The rich diversity of Neisseria species at human mucosal surfaces raises the possibility of genetic exchange among these bacteria [6], [7]. Indeed, interspecies exchange of antibiotic resistance genes can occur in vitro [8]. These considerations, combined with the limited glimpse of the virulence gene content of commensals, led us to undertake a comprehensive analysis of commensal Neisseria genomes and to determine the extent of interspecies genetic exchange.

Results

We generated high quality draft genome sequences of eight species of human commensal Neisseria, and compared them to 11 published N. meningitidis, N. gonorrhoeae and N. lactamica genomes (see Table S1 for all strains used and their corresponding accession numbers). Commensal genomes were sequenced using a combination of the Roche 454 and Illumina platforms. Commensal genomes range between 1.8 and 2.8 Mb and contain 2,000 to 2,842 predicted genes. In contrast, pathogen genomes are ∼2.2 Mb and encode ∼2,000 predicted genes (Table S2). Genes for common metabolic processes, DNA replication, recombination, transcription and translation are conserved in all commensals (Data Set S1 and Text S1).

The core Neisseria genome – the set of genes present in all Neisseria species – consists of 896 genes, mostly with housekeeping function assignments. To determine the phylogenetic relationship of Neisseria species, we concatenated the DNA sequences from a subset of 636 Neisseria core genes that are shared with Chromobacterium violaceum, the outgroup used to root the tree. The N. meningitidis and N. gonorrhoeae genomes form a distinct monophyletic clade that is derived from the commensal genomes (Figure 1A). The topology of this tree is consistent with that generated by concatenating all 896 Neisseria core genes (Figure 1B), and with previously derived single gene phylogenies [2].

[Figure omitted. See PDF.]

Figure 1. Phylogenetic relationship of human Neisseria species.

(A) Rooted maximum likelihood Neisseria species tree (GTR + I + γ) based on concatenating the DNA sequences of a subset of 636 core Neisseria genes that are shared with the outgroup C. violaceum. A dagger denotes a bootstrap value of 100. The three N. meningitidis carrier strains are denoted by asterisks. (B) Maximum likelihood Neisseria species tree (GTR + I + γ) based on concatenating the DNA sequences of all 896 core Neisseria genes.

https://doi.org/10.1371/journal.pone.0011835.g001

Repetitive elements are important features of pathogenic Neisseria genomes, playing key roles in genetic transformation, gene expression and genome rearrangements [9], [10]. The 10 bp DNA Uptake Sequence (DUS) GCCGTCTGAA is essential for genetic transformation of N. meningitidis and N. gonorrhoeae. As in pathogenic Neisseria, the DUS is the most prominent repetitive element in commensals, occurring over 2,000 times in most species (Figure 2A). Intriguingly, Neisseria sicca and Neisseria mucosa, which form a distinct clade on the Neisseria species tree (Figure 1), have far fewer copies of the canonical DUS. Instead, they have >3,400 copies of a variant DUS (DUS1) with a one base mismatch: GtCGTCTGAA. This DUS1 functions in DNA uptake/transformation in N. meningitidis and N. gonorrhoeae, albeit less efficiently than the canonical sequence [11], [12]. Thus, all commensals appear to have functional DNA uptake sequences.

[Figure omitted. See PDF.]

Figure 2. Prevalence of repetitive elements in human Neisseria genomes.

(A) Numbers of repeat sequences (RS), insertion sequences (IS), Correia elements, and DNA Uptake Sequences (DUS) are given for each Neisseria species, with complete copies in parentheses. DUS refers to the canonical DNA uptake sequence GCCGTCTGAA. DUS1 refers to the DUS variant GtCGTCTGAA. Note the high copy number of DUS1 in N. sicca and N. mucosa, highlighted in bold. (B) Absence of repeat elements in the pgd/lpxC locus region in commensals. Nel: N. elongata; Nsi: N. sicca; Nmu: N. mucosa; Nsu: N. subflava; Nfl: N. flavescens; Nci: N. cinerea; Npo: N. polysaccharea; Nla: N. lactamica 23970; Nme: N. meningitidis MC58. Black bars represent dRS3 elements; blue bars represent Correia elements. Orthologous genes are the same color; orange represents a γ-glutamyltranspeptidase present in four commensal genomes; grey represents hypothetical proteins unique to each genome. (C) Absence of large repeat arrays in the murI-tbpA/B-potD-1 locus in commensals. Ngo: N. gonorrhoeae FA1090. Forward slashes (//) represent a break in chromosome contiguity. Orthologous genes are the same color; light blue denotes a hypothetical protein. All other features are the same as in (B).

https://doi.org/10.1371/journal.pone.0011835.g002

Correia and dRS3 elements [13] are the second most abundant repeats in commensal Neisseria. These elements function in gene regulation and sequence variation in pathogenic Neisseria [14], [15]. Commensals have fewer Correia and dRS3 elements than the pathogens. The only exception is N. sicca, which has more Correia elements than either of the pathogens (Figure 2A, 2B and 2C; Text S1). Moreover, commensal dRS3 elements are not arranged into large Intergenic Mosaic Element arrays, unlike their counterparts in pathogenic Neisseria (Figure 2B and 2C). This suggests that expansion of dRS3 elements occurred more recently in the pathogens.

In pathogenic Neisseria, repetitive elements facilitate two important immune evasion mechanisms: phase and antigenic variation. Many N. meningitidis and N. gonorrhoeae genes for outermembrane proteins undergo high frequency ON/OFF (phase) switching that results from intragenic recombination of repeat sequences in or near the coding sequence. Over 70% of the genes (52/72) known or hypothesized to be phase variable in pathogenic Neisseria [14], [16], [17] are present in commensals (Table S3). However, many of these (26/52) do not have tandem repeats, indicating that recombination-based phase switching of surface proteins occurs less frequently in commensals.

Studies of a few handpicked genes and whole genome microarrays centered on N. lactamica detected virulence genes in commensals [3], [4], [5]. To examine virulence gene content in the newly sequenced commensal genomes, we determined the distribution of 177 genes that have been reported to play a role in Neisseria virulence (Table S4) [4], [18], [19]. Seventy-five percent of these genes (133/177) are present in one or more commensals (Figure 3A), and 40% (70/177) are in all of them (Data Set S2). A large subset of Neisseria virulence genes is therefore present in the commensals.

[Figure omitted. See PDF.]

Figure 3. Virulence gene exchange among human Neisseria species.

(A) Number of genes present in different Neisseria species, out of the 177 genes known or hypothesized to be important for virulence (see methods for details). (B) Heatmap of AU test p-values obtained by comparing individual virulence gene tree topologies. The map is a 69×69 matrix of 69 virulence genes that are present in all Neisseria species (y-axis) and their corresponding topologies (x-axis). Blue indicates a p-value of 1 (trees are similar); red indicates a p-value of 0 (trees are significantly different).

https://doi.org/10.1371/journal.pone.0011835.g003

Among the virulence genes found in all commensal species are those encoding the Type IV pilus (Tfp), a surface structure that in pathogenic Neisseria promotes twitching motility, DNA uptake/genetic transformation, attachment, and host cell signaling [20]. Commensals have a complete set of Tfp biogenesis genes (Figure S1), including: pilE, encoding the Tfp structural subunit; pilD, encoding a pilin peptidase; pilF, encoding a pilin assembly ATPase; and pilT, encoding an ATPase required for Tfp retraction and DNA uptake. Commensals also have one or more pilin modification genes. The four commensals closest to the pathogen clade, N. lactamica, Neisseria polysaccharea, Neisseria cinerea, and Neisseria flavescens, have a pilC ortholog. However, the function of commensal pilC cannot be deduced due to sequence differences from pathogenic Neisseria pilC1 and pilC2. Commensals therefore have the genetic capacity to produce Tfp. The functions of commensal Tfp, if expressed, remain to be elucidated.

Tfp systems of commensal and pathogenic Neisseria differ in one major respect. In pathogenic Neisseria, pilin antigenic variation results from recombination of pilE with a silent variant pilin pseudogene, or pilS [21]. Pathogenic Neisseria have as many as 19 copies of pilS, while commensals have only 2–5 copies (Table S5). Moreover, in commensals the region upstream of pilE lacks the guanine-repeat element that is essential for pilE/pilS recombination [22]. Pilin antigenic variation is therefore unlikely to occur in commensals, at least via the guanine-repeat element mechanism. As pseudogenes lacking a function are rapidly lost from the population [23], the presence of pilS in commensal genomes is curious. The phylogeny of Neisseria (Figure 1) indicates that commensals are basal to the two pathogenic species, which form a single, derived monophyletic clade. The most parsimonious explanation for these observations is that pilE/pilS antigenic variation is a novel function that arose in the pathogens from a system originally evolved for another, yet unidentified purpose.

The Opa family of outermembrane proteins promote N. gonorrhoeae and N. meningitidis attachment, invasion, immune cell signaling and inflammation. Pathogen genomes harbor multiple variant opas; N. meningitidis has 3–4 opas, while N. gonorrhoeae has approximately 11 [24]. Most commensals lack opa genes and thus do not interact with host cells via this virulence factor. However, N. polysaccharea, N. flavescens and N. lactamica have 1, 2 and 3 variant opas, respectively (Table S5). All of these contain variable numbers of the CTCTT pentameric repeat that, in pathogenic Neisseria, undergoes slip-strand misrepair resulting in Opa phase and antigenic variation [25], [26]. Commensal Opas are therefore likely to undergo phase switching, but limited antigenic variation.

Iron scavenging from the host is an important virulence attribute of bacterial pathogens [27]. Commensal Neisseria have a diverse arsenal of iron acquisition genes (Figure 4). N. lactamica and N. cinerea have genes for acquiring iron from human transferrin and lactoferrin (tbpA/tbpB and lbpA/lbpB, respectively) [28]. These loci are important for N. gonorrhoeae infection and fitness [28]. Commensals also have hmbR and hpuAB, which are required for acquiring hemoglobin iron [28]. In N. meningitidis, HmbR promotes replication in the blood [29]. All commensals have the tonB/exbB/exbD iron transport locus, and fur, the iron-responsive regulatory element. Notably, commensals most distal to the pathogens have iron uptake genes that are missing from pathogenic Neisseria. These include genes for transport of hemin, Fe+3 and Fe+2, and for siderophore receptors and transport (Figure 4). Because Fe+2 is often complexed with protein in foodstuff, the Fe+2 uptake system, if expressed, may allow oral commensals to absorb iron from the host diet [28]. Thus, Neisseria species possess a diverse array of iron uptake genes. This diversity may help different Neisseria species to colonize the same niche without being affected by antibodies directed against the iron acquisition components of other species [30].

[Figure omitted. See PDF.]

Figure 4. Iron utilization genes in human Neisseria species.

Species and strain names are listed in the phylogenetic tree. N. meningitidis carrier strains are marked with asterisks. Each box represents an individual gene. Genes of the same color belong to the same iron utilization system. Genes connected by a horizontal line are contiguous in the chromosome. Loci confirmed by sequencing to be pseudogenes have a forward slash (/). N. meningitidis and N. gonorrhoeae gene names appear below each column. Genes are listed as locus tags if their iron utilization functions were deduced from other bacteria. General functions appear below the gene names.

https://doi.org/10.1371/journal.pone.0011835.g004

Several genes are found uniquely in commensals. Only four genes - encoding hypothetical proteins - are present in all commensals, while several are present in one or more commensals. Intriguingly, some commensal-specific genes encode proteins that function as hemolysins, adhesins or invasins in other bacterial pathogens (Data Sets S3 and S4). Others encode components of the Type IV and Type VI Secretion Systems and lipooligosaccharide modification enzymes (Text S1). Commensal-specific genes are generally smaller, have a lower %G+C content than Neisseria core genes, and have homologs in other bacterial genera, indicating that they were acquired recently via horizontal gene transfer.

We also identified several pathogen-specific genes (Data Set S5). Only 16 genes are present in all sequenced N. meningitidis genomes, and 81 in all sequenced N. gonorrhoeae genomes. Genes for biosynthesis of the polysaccharide capsule, which confers resistance to complement killing and phagocytosis, are unique to N. meningitidis (Figure S2). The ctrABCD and lipAB loci, encoding polysaccharide transporters, are found in some commensals (Text S1). However, the siaABC locus, which is required for capsule production, appears only in N. meningitidis. The tdfF locus which is essential for intracellular iron acquisition and thus for Neisseria intracellular replication, is found only in pathogen genomes (Figure 4) [31].

Some genes were found in all sequenced N. meningitidis and/or N. gonorrhoeae genomes, but only rarely in commensal species. For example, iga, encoding an IgA protease that cleaves human IgA and lysosomal membrane protein Lamp1 [20], is present only in pathogenic Neisseria genomes with one exception: an intact iga2 allele is found in both N. lactamica genomes. The 57 kb Gonococcal Genetic Island (GGI) [32] is largely absent from commensals. However, genes with varying degrees of nucleotide sequence identity to GGI encoded dsbC, topB, and parA are present in all commensal genomes (Text S1). In N. gonorrhoeae, dsbC and parA play roles in genetic transformation by secreting DNA [32]. Nf, an M13-like filamentous phage, is the only feature that distinguishes hyperinvasive N. meningitidis isolates from noninvasive ones [33], [34]. Nf genes are detected in N. flavescens and N. lactamica. N. flavescens has only a subset of Nf genes, while N. lactamica contains all the major M13-like life cycle genes.

Finally, it should be noted that NMB1646, encoding a putative hemolysin, was proposed to be specific to pathogenic Neisseria. Microarray studies found NMB1646 in N. meningitidis and N. gonorrhoeae, but absent from N. lactamica [4]. In our study, NMB1646 is also missing from N. lactamica. However, it was found in all other commensal genomes. Thus, NMB1646 is present in both commensal and pathogenic Neisseria.

Our study shows that commensals have a large number of virulence genes, as well as genes for DNA secretion and uptake, and an abundance of DUS. Additionally, previous work has demonstrated gene exchange among Neisseria species [8], [35], [36], [37]. Combined, these results suggest that genetic exchange among Neisseria may be more widespread than previously thought. We therefore determined the extent of genetic exchange among Neisseria species, using a phylogenetic method to analyze 69 virulence genes shared by all 19 Neisseria genomes (Data Set S2). This method relies on the phylogenetic congruence of individual gene trees: a gene tree that does not match the species tree indicates the gene in question has been transferred laterally. We generated individual gene trees for each of the 69 virulence genes using PhyML [38] and looked for the rejection of a set of these topologies by the 69 genes using an Approximate Unbiased (AU) test [39]. The p-value heatmap (Figure 3B) indicates that most gene trees showed divergent histories (depicted as groups of topologies with dissimilar p-value patterns) that are most likely due to horizontal gene transfer. A small group of topologies (topologies 58–69) were rejected by all the genes. Consistent with these findings, 45% (31/69) of the virulence genes rejected the concatenated tree, compared to 34% of the core genes (average of three replicates of 69 randomly selected core genes). These results suggest that there is widespread genetic exchange among Neisseria species, with virulence genes being exchanged at a slightly higher frequency than core genes.

The AU test relies on the rejection of a tree by a gene, rather than on its acceptance, and less divergent or saturated alignments may result in false predictions [40]. Moreover, high rates of recombination between N. meningitidis strains can also result in conflicting phylogenies. Therefore, we also looked for evidence of horizontal gene transfer using the program RDPv3.18 [41] to detect homologous intragenic recombination in the 69 virulence genes mentioned above. Evidence of recombination was detected in 53 of the 69 genes, and over half of these events (31/53) involved at least one commensal genome (Table S6). The intragenic recombination and AU tests provide strong evidence of genetic exchange among commensal and pathogenic Neisseria, suggesting that commensals act as reservoirs of new virulence alleles.

Discussion

In this comprehensive analysis of human commensal Neisseria genomes, we have identified the gene content of commensal Neisseria species, generated an extensive phylogenetic tree of this genus, and determined the distribution of virulence genes in its members. Commensal Neisseria have an extensive repertoire of virulence alleles from pathogenic Neisseria as well as other bacterial genera. Moreover, they have the genetic machinery for exchanging DNA with each other, and nearly half of Neisseria virulence genes have undergone intra- and interspecies recombination. High frequency horizontal gene transfer can increase pathogen fitness, accelerate host adaptation, and affect bacterial virulence. The prevalence of numerous Neisseria species in the same niches in the human body provides an opportunity for DNA exchange. The repertoire of virulence genes in Neisseria populations is therefore likely to be dynamic.

The large virulence gene set in commensal Neisseria raises an intriguing question: why are these bacteria generally not pathogenic? Although there are no ready answers to this question, we can offer possible explanations. First, a productive infection is determined by multiple factors, including the immediate environment of the infection site and host immune status. Commensals may not be able to express the entire constellation of virulence genes necessary for initiating infection under these circumstances. In this context, it is interesting to note that N. lactamica, which occasionally causes infections, has the largest set of virulence alleles of all the commensals. Secondly, there may be additional factors governing commensalism that have yet to be defined. N. meningitidis can cause asymptomatic infections in humans [42]. Yet, there is very little difference between the genomes of carrier and invasive strains [18]. This suggests that the ON/OFF phase switching of genes may be an important pathogenesis determinant. Indeed, many commensal orthologs of phase-variable genes lack the repeat elements that participate in phase variation. Third, a virulence allele in a commensal may differ from its pathogenic counterpart in its ability to cause disease. For example, N. gonorrhoeae expressing the N. lactamica porB allele is less able to invade cells [43]. Finally, our results add to the growing body of evidence that suggests the definition of virulence factor needs to be reassessed. Virulence factors have been defined as components whose absence attenuates bacterial virulence but not viability [44]. For example, Tfp is considered a virulence factor because it promotes attachment [45]. However, recent studies demonstrate that Tfp activates pro-survival pathways in epithelial cells [46], [47], a situation that benefits both host and microbe. The presence of Tfp biogenesis genes in commensals supports this idea. Thus, some virulence factors may be more appropriately termed “host adaptation” factors, as they allow bacteria to interact with and adapt to the host environment, but do not specifically promote virulence. The distinction between a true virulence factor versus a host adaptation factor will be clarified as the genomes of more commensal bacteria are sequenced and characterized.

Accession Numbers

Genome sequences generated in this study were deposited in GenBank. See Table S1 for the GenBank accession numbers for all genome sequences discussed in this paper. Updated versions of the eight commensal Neisseria genome sequences generated in this study are available at http://www.u.arizona.edu/~pradeepm/data.html.

Materials and Methods

Bacterial strains

The following strains were obtained from the American Type Culture Collection (ATCC): N. lactamica (ATCC 23970), N. polysaccharea (ATCC 43768), N. cinerea (ATCC 14685), N. sicca (ATCC 29256), N. mucosa (ATCC 25996), and Neisseria elongata subsp. glycolytica (ATCC 29315). Neisseria subflava (NJ9703) was provided by J.B. Kaplan [48]. N. flavescens (NRL30031 or H210) was a gift from E.L. Aho [49], [50]. All commensal Neisseria strains were grown on chocolate agar with 3.6% GC agar base (BD), 1% Isovitalex (BD), and 1% hemoglobin (Oxoid) for 18–24 hours in 5% CO2 at 37°C.

DNA isolation

Chromosomal DNA was isolated as described previously [51]. Briefly, cells from half of a 10 cm diameter petri dish were harvested with a sterile Dacron swab into 0.5 ml of 50 mM Tris-Cl, 20 mM EDTA, 50 mM NaCl (pH 8). SDS (1% final concentration) and RNAse A (Qiagen, 1 mg/ml) were added, and cells were lysed for five minutes. Two extractions with phenol-chloroform-isoamyl alcohol (25∶24∶1) and one with chloroform were used to remove proteins. DNA was precipitated by adding two volumes of isopropanol followed by suspension in TE (10 mM Tris, 1 mM EDTA, pH 8). Ammonium acetate was added to 2.5 M followed by precipitation with two volumes of ethanol. Following 70% ethanol washes and drying, DNA was suspended in water or 10 mM Tris, 0.1 mM EDTA (pH 8).

Genome sequencing and assembly

454 sequencing was performed using the Titanium platform (Roche) according to the manufacturer's instructions. Paired-end sequencing was completed using the Illumina Genome Analyzer II following protocols specified by the manufacturer. Draft genomes were assembled using the Newbler (Roche) and Velvet [52] assemblers.

Genome Annotation

Annotation was performed using a combination of RAST [53] and the Washington University Genome Center's gene prediction pipeline. Select loci were manually curated using previously published N. meningitidis and N. gonorrhoeae genome sequences as references.

Orthologs and core genome

Orthologous proteins were identified by BLASTP using reference proteins from previously sequenced N. meningitidis and N. gonorrhoeae genomes where possible. Predicted proteins were designated orthologs of a reference protein if the ratio of reference self-hit bitscore to predicted protein bitscore was greater than 0.4. The orthology of proteins unique to draft genomes was determined in the same manner, except randomly chosen predicted proteins were used as reference proteins. The orthology was confirmed by genome context whenever required. The 896 genes present in all 19 Neisseria genome sequences used in this study were designated as the core Neisseria genome.

Generation of Neisseria species tree

The subset of 636 core Neisseria genes also present in C. violaceum was used to find phylogenetic relationships among Neisseria species. The concatenated DNA sequences of these 636 genes were aligned using MAFFT [54] and the resulting alignment edited using Gblocks [55] to remove any gaps. A maximum likelihood tree (using the GTR + I + γ model in PAUP) was generated using the concatenated orthologous sequences from C. violaceum as the outgroup. Support for each branch was obtained by performing the bootstrap analysis with 100 replicates. Using the same method, an unrooted tree was also obtained with the concatenated sequences from all 896 core Neisseria genes.

Identification of repeat elements

Repetitive elements of commensal Neisseria were identified using the ‘fuzznuc’ application of EMBOSS [56]. DNA Uptake Sequences (DUS) were identified in each genome by looking for the pattern GCCGTCTGAA. Non-canonical DUS were found by allowing one mismatch to the canonical DUS pattern. The dRS3 elements were detected in each genome using the pattern ATTCCCNNNNNNNNGGGAAT [13], [14]. Each identified site was then manually checked to see if it had a lone dRS3 repeat or a complete RS element. Relaxing the search to allow one or two mismatches did not detect any additional RS elements. Correia repeats (CR) were identified by searching for the following patterns [15], [57], with three mismatches allowed per pattern:

TATAG[CT]GGATTAACAAAAATCAGGAC, TATAG[CT]GGATTAAATTTAAACCGGTAC, TATAG[CT]GGATTAACAAAAACCGGTAC, TATAG[CT]GGATTAAATTTAAATCAGGAC.

Each identified repeat was then manually checked to see if it had a lone CR or a complete Correia element.

Identification of virulence genes

A list of 177 virulence genes was created by searching published literature and available databases for Neisseria genes that are known or hypothesized to have virulence functions [4], [18], [19]. The protein sequences of these 177 genes were used as queries in a TBLASTN search against all commensal genome sequences with an E-value cutoff set at 1e−5. A gene was identified as present if it had >50% identity to the query protein and an alignment length of ≥75% of the query length.

Identification of phase variable genes

Searches of the published literature identified 72 Neisseria genes known or hypothesized to be phase variable [14], [16], [17]. The protein sequences of these 72 genes were used as queries in a TBLASTN search against all commensal genome sequences with an E-value cutoff set at 1e−5. A gene was identified as present if it had >50% identity to the query protein and an alignment length of ≥75% of the query length. To confirm the presence of the phase variable (PV) repeat, the corresponding gene from the commensal genome sequence was extracted and aligned to the appropriate reference gene sequence. The alignments were manually examined for the presence of the PV repeat.

Gene tree-to-species tree congruence

A phylogenetic method was used to detect the extent of genetic exchange among Neisseria species by examining 69 of the 70 virulence genes that are shared across all 19 Neisseria genome sequences. The pilE gene was not analyzed, as multiple copies of pilE in several of the genomes made identifying orthologs difficult. Phylogenies for each of the 69 genes were derived in PhyML [38] using a GTR + I + γ model of evolution with BIONJ starting tree. The site likelihood for each tree was computed using baseml (PAML package) [58]. The AU test [39] was then applied using Consel [59].

Detection of intragenic recombination

To provide a secondary method for measuring genetic exchange, the extent of intragenic recombination was also examined. Alignments for each of the 69 virulence genes were generated and recombination breakpoints identified using the program RDPv3.18 [41].

Confirmation of pseudogenes

Genes of interest were amplified from purified genomic DNA by PCR. All PCR reactions were performed in a 50 µl reaction volume using 50 ng of purified DNA as template, 1X Phusion HF master mix (Finnzymes) and 0.1 mM of the gene-specific primers (Table S7). Thermocycler conditions were as follows: 1 cycle at 98°C for 30 sec; 35 cycles at 98°C for 10 sec, 60°C for 30 seconds and 72°C for 15 sec; 1 cycle at 72°C for 10 min. The resulting PCR products were purified using a column-based method (Qiagen). Purified products were then sequenced using appropriate forward and reverse primers (Table S7) by the Sanger method at the University of Arizona Genetics Core (Tucson, AZ).

Supporting Information

[Figure omitted. See PDF.]

Text S1.

Supplemental text and references.

https://doi.org/10.1371/journal.pone.0011835.s001

(0.11 MB DOC)

Figure S1.

Human Neisseria type IV pilus (Tfp) biogenesis and pilin modification genes. Species and strain names are listed in the phylogenetic tree on the left. N. meningitidis carrier strains are denoted by asterisks. Each box represents an individual gene. Genes connected by a horizontal line are contiguous on the chromosome. A forward slash (/) indicates genes that have been confirmed as pseudogenes by sequencing. A backwards slash (\) represents hypothetical pseudogenes whose status has not been confirmed by experimentation. Genes in grey are not involved in Tfp biosynthesis or pilin modification. Tfp genes that have not yet been named are listed by their locus tag designations. The designations of commensal pilC orthologs are based on genome context and sequence homology to pilC1 or pilC2 of pathogenic Neisseria.

https://doi.org/10.1371/journal.pone.0011835.s002

(0.89 MB TIF)

Figure S2.

Capsular polysaccharide genes of human Neisseria species. The Neisseria capsular locus is made up of five regions: A, B, C, D, and E. Some sequences also contain a duplicate of the D region, denoted as D'. A composite of the multi-species capsular locus is depicted at the bottom of the figure and includes gene names based on published nomenclature. Each box represents an individual gene, except for numbered boxes, which represent genes of the number listed. Genes of the same color are part of the same pathway; grey boxes denote genes whose functions are unknown or unrelated to the capsule. Genes connected by a horizontal line are contiguous on the chromosome. A backwards slash (\) represents hypothetical pseudogenes whose status has not been confirmed by experimentation. Note that in N. subflava, the C and E regions as well as gene NLA0370 are in an inverted orientation compared to the other sequences. Also, whether N. elongata, N. sicca, and N. mucosa contain a D or D' region cannot be ascertained from the available data.

https://doi.org/10.1371/journal.pone.0011835.s003

(0.74 MB TIF)

Table S1.

Genome sequences used in this study.

https://doi.org/10.1371/journal.pone.0011835.s004

(0.07 MB PDF)

Table S2.

General characteristics of Neisseria genomes.

https://doi.org/10.1371/journal.pone.0011835.s005

(0.07 MB PDF)

Table S3.

Presence or absence of phase variable genes in commensal Neisseria. Targets were identified by searching the literature for genes known or hypothesized to be phase variable in pathogenic Neisseria.

https://doi.org/10.1371/journal.pone.0011835.s006

(0.17 MB PDF)

Table S4.

Genes known or hypothesized to be involved in Neisseria virulence. The 177 targets were identified by searching the literature for genes previously identified as having a role in Neisseria virulence. Genes in bold type are present in all 19 Neisseria genomes used in the study.

https://doi.org/10.1371/journal.pone.0011835.s007

(0.13 MB PDF)

Table S5.

Copy number of pilE, pilS and opa genes in Neisseria species. See supplemental references (Text S1) for additional information on N. meningitidis MC58 [3], [20] and N. gonorrhoeae FA1090 [20], [21].

https://doi.org/10.1371/journal.pone.0011835.s008

(0.08 MB PDF)

Table S6.

Recombination of virulence genes among Neisseria species. The RDPv3.18 program was used to test for recombination in 69 virulence genes that are shared by all Neisseria species.

https://doi.org/10.1371/journal.pone.0011835.s009

(0.13 MB PDF)

Table S7.

Primers used for PCR amplification and sequencing of potential pseudogenes.

https://doi.org/10.1371/journal.pone.0011835.s010

(0.07 MB PDF)

Data Set S1.

Common metabolic pathways present in commensal Neisseria. Genes from the N. meningitidis MC58 genome are included as a reference.

https://doi.org/10.1371/journal.pone.0011835.s011

(0.18 MB XLS)

Data Set S2.

Virulence genes present in all 19 Neisseria genomes. Note that the N. subflava and N. cinerea genome sequences both contain two copies of pilE; the second copy is listed directly below the first (see rows 74–75).

https://doi.org/10.1371/journal.pone.0011835.s012

(0.06 MB XLS)

Data Set S3.

Neisseria strain-specific genes. The name on each tab indicates the species included for the given table.

https://doi.org/10.1371/journal.pone.0011835.s013

(0.26 MB XLS)

Data Set S4.

Commensal Neisseria-specific genes. Genes present in two or more commensal genomes but absent from all N. meningitidis and N. gonorrhoeae genomes. See supplemental reference [19] (Text S1) for abbreviations of the COG categories.

https://doi.org/10.1371/journal.pone.0011835.s014

(0.22 MB XLS)

Data Set S5.

Pathogenic Neisseria-specific genes. Tab “N. meningitides” includes the seven N. meningitidis strains analyzed; tab “N. gonorrhoeae” includes the three N. gonorrhoeae genomes studied. See supplemental reference [19] (Text S1) for abbreviations of the COG categories.

https://doi.org/10.1371/journal.pone.0011835.s015

(0.04 MB XLS)

Acknowledgments

We gratefully acknowledge M. Wororbey, C.N. Cornelissen, L.A. Snyder, J.P. McCutcheon, M.W. van Passel, and N. Biais for their helpful comments. We thank J.B. Kaplan and E.L. Aho for providing strains, and J. Parkhill for providing access to the N. lactamica 020-06 genome sequence. We also thank J.S. Knapp, S. Hoffmann and J.G. Cannon for assistance in tracing the provenance of N. flavescens NRL30031.

Author Contributions

Conceived and designed the experiments: PRM NJW SDR MS. Performed the experiments: PRM MP NJW MAR DRH DLH ES GMW. Analyzed the data: PRM MP NJW MAR CMC DRH DLH ES GMW SDR MS. Contributed reagents/materials/analysis tools: GMW SDR MS. Wrote the paper: PRM NJW CMC MS.

Citation: Marri PR, Paniscus M, Weyand NJ, Rendón MA, Calton CM, Hernández DR, et al. (2010) Genome Sequencing Reveals Widespread Virulence Gene Exchange among Human Neisseria Species. PLoS ONE5(7): e11835. https://doi.org/10.1371/journal.pone.0011835

References

1. Janda WM, Knapp JS (2003) Neisseria and Moraxella catarrhalis. In: Murray PR, editor. Manual of clinical microbiology. Washington, D.C.: ASM Press. pp. 585–608.WM JandaJS Knapp2003Neisseria and Moraxella catarrhalis.PR MurrayManual of clinical microbiologyWashington, D.C.ASM Press5856088th ed. 8th ed.

2. Tonjum T (2005) Genus Neisseria. In: Garrity GM, editor. Bergey's manual of systematic bacteriology. New York: Springer-Verlag. pp. 777–798.T. Tonjum2005Genus Neisseria.GM GarrityBergey's manual of systematic bacteriologyNew YorkSpringer-Verlag7777982nd ed. 2nd ed.

3. Bennett JS, Thompson EA, Kriz P, Jolley KA, Maiden MC (2009) A common gene pool for the Neisseria FetA antigen. Int J Med Microbiol 299: 133–139.JS BennettEA ThompsonP. KrizKA JolleyMC Maiden2009A common gene pool for the Neisseria FetA antigen.Int J Med Microbiol299133139

4. Snyder LA, Saunders NJ (2006) The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as ‘virulence genes’. BMC Genomics 7: 128.LA SnyderNJ Saunders2006The majority of genes in the pathogenic Neisseria species are present in non-pathogenic Neisseria lactamica, including those designated as ‘virulence genes’.BMC Genomics7128

5. Stabler RA, Marsden GL, Witney AA, Li Y, Bentley SD, et al. (2005) Identification of pathogen-specific genes through microarray analysis of pathogenic and commensal Neisseria species. Microbiology 151: 2907–2922.RA StablerGL MarsdenAA WitneyY. LiSD Bentley2005Identification of pathogen-specific genes through microarray analysis of pathogenic and commensal Neisseria species.Microbiology15129072922

6. Knapp JS (1988) Historical perspectives and identification of Neisseria and related species. Clin Microbiol Rev 1: 415–431.JS Knapp1988Historical perspectives and identification of Neisseria and related species.Clin Microbiol Rev1415431

7. Saez Nieto JA, Marcos C, Vindel A (1998) Multicolonization of human nasopharynx due to Neisseria spp. Int Microbiol 1: 59–63.JA Saez NietoC. MarcosA. Vindel1998Multicolonization of human nasopharynx due to Neisseria spp.Int Microbiol15963

8. Catlin BW (1960) Interspecific transformation of Neisseria by culture slime containing deoxyribonucleate. Science 131: 608–610.BW Catlin1960Interspecific transformation of Neisseria by culture slime containing deoxyribonucleate.Science131608610

9. Liu SV, Saunders NJ, Jeffries A, Rest RF (2002) Genome analysis and strain comparison of correia repeats and correia repeat-enclosed elements in pathogenic Neisseria. J Bacteriol 184: 6163–6173.SV LiuNJ SaundersA. JeffriesRF Rest2002Genome analysis and strain comparison of correia repeats and correia repeat-enclosed elements in pathogenic Neisseria.J Bacteriol18461636173

10. Snyder LA, McGowan S, Rogers M, Duro E, O'Farrell E, et al. (2007) The repertoire of minimal mobile elements in the Neisseria species and evidence that these are involved in horizontal gene transfer in other bacteria. Mol Biol Evol 24: 2802–2815.LA SnyderS. McGowanM. RogersE. DuroE. O'Farrell2007The repertoire of minimal mobile elements in the Neisseria species and evidence that these are involved in horizontal gene transfer in other bacteria.Mol Biol Evol2428022815

11. Goodman SD, Scocca JJ (1988) Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae. Proc Natl Acad Sci U S A 85: 6982–6986.SD GoodmanJJ Scocca1988Identification and arrangement of the DNA sequence recognized in specific transformation of Neisseria gonorrhoeae.Proc Natl Acad Sci U S A8569826986

12. Qvarnstrom Y, Swedberg G (2006) Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species. BMC Microbiol 6: 11.Y. QvarnstromG. Swedberg2006Variations in gene organization and DNA uptake signal sequence in the folP region between commensal and pathogenic Neisseria species.BMC Microbiol611

13. Parkhill J, Achtman M, James KD, Bentley SD, Churcher C, et al. (2000) Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491. Nature 404: 502–506.J. ParkhillM. AchtmanKD JamesSD BentleyC. Churcher2000Complete DNA sequence of a serogroup A strain of Neisseria meningitidis Z2491.Nature404502506

14. Bentley SD, Vernikos GS, Snyder LA, Churcher C, Arrowsmith C, et al. (2007) Meningococcal genetic variation mechanisms viewed through comparative analysis of serogroup C strain FAM18. PLoS Genet 3: e23.SD BentleyGS VernikosLA SnyderC. ChurcherC. Arrowsmith2007Meningococcal genetic variation mechanisms viewed through comparative analysis of serogroup C strain FAM18.PLoS Genet3e23

15. Snyder LA, Cole JA, Pallen MJ (2009) Comparative analysis of two Neisseria gonorrhoeae genome sequences reveals evidence of mobilization of Correia Repeat Enclosed Elements and their role in regulation. BMC Genomics 10: 70.LA SnyderJA ColeMJ Pallen2009Comparative analysis of two Neisseria gonorrhoeae genome sequences reveals evidence of mobilization of Correia Repeat Enclosed Elements and their role in regulation.BMC Genomics1070

16. Jordan PW, Snyder LA, Saunders NJ (2005) Strain-specific differences in Neisseria gonorrhoeae associated with the phase variable gene repertoire. BMC Microbiol 5: 21.PW JordanLA SnyderNJ Saunders2005Strain-specific differences in Neisseria gonorrhoeae associated with the phase variable gene repertoire.BMC Microbiol521

17. Snyder LA, Saunders NJ, Shafer WM (2001) A putatively phase variable gene (dca) required for natural competence in Neisseria gonorrhoeae but not Neisseria meningitidis is located within the division cell wall (dcw) gene cluster. J Bacteriol 183: 1233–1241.LA SnyderNJ SaundersWM Shafer2001A putatively phase variable gene (dca) required for natural competence in Neisseria gonorrhoeae but not Neisseria meningitidis is located within the division cell wall (dcw) gene cluster.J Bacteriol18312331241

18. Schoen C, Blom J, Claus H, Schramm-Gluck A, Brandt P, et al. (2008) Whole-genome comparison of disease and carriage strains provides insights into virulence evolution in Neisseria meningitidis. Proc Natl Acad Sci U S A 105: 3473–3478.C. SchoenJ. BlomH. ClausA. Schramm-GluckP. Brandt2008Whole-genome comparison of disease and carriage strains provides insights into virulence evolution in Neisseria meningitidis.Proc Natl Acad Sci U S A10534733478

19. Tettelin H, Saunders NJ, Heidelberg J, Jeffries AC, Nelson KE, et al. (2000) Complete genome sequence of Neisseria meningitidis serogroup B strain MC58. Science 287: 1809–1815.H. TettelinNJ SaundersJ. HeidelbergAC JeffriesKE Nelson2000Complete genome sequence of Neisseria meningitidis serogroup B strain MC58.Science28718091815

20. Merz AJ, So M (2000) Interactions of pathogenic neisseriae with epithelial cell membranes. Annu Rev Cell Dev Biol 16: 423–457.AJ MerzM. So2000Interactions of pathogenic neisseriae with epithelial cell membranes.Annu Rev Cell Dev Biol16423457

21. Hill SA, Davies JK (2009) Pilin gene variation in Neisseria gonorrhoeae: reassessing the old paradigms. FEMS Microbiol Rev 33: 521–530.SA HillJK Davies2009Pilin gene variation in Neisseria gonorrhoeae: reassessing the old paradigms.FEMS Microbiol Rev33521530

22. Cahoon LA, Seifert HS (2009) An alternative DNA structure is necessary for pilin antigenic variation in Neisseria gonorrhoeae. Science 325: 764–767.LA CahoonHS Seifert2009An alternative DNA structure is necessary for pilin antigenic variation in Neisseria gonorrhoeae.Science325764767

23. van Passel MW, Marri PR, Ochman H (2008) The emergence and fate of horizontally acquired genes in Escherichia coli. PLoS Comput Biol 4: e1000059.MW van PasselPR MarriH. Ochman2008The emergence and fate of horizontally acquired genes in Escherichia coli.PLoS Comput Biol4e1000059

24. Dehio C, Gray-Owen SD, Meyer TF (1998) The role of neisserial Opa proteins in interactions with host cells. Trends Microbiol 6: 489–495.C. DehioSD Gray-OwenTF Meyer1998The role of neisserial Opa proteins in interactions with host cells.Trends Microbiol6489495

25. Muralidharan K, Stern A, Meyer TF (1987) The control mechanism of opacity protein expression in the pathogenic Neisseriae. Antonie Van Leeuwenhoek 53: 435–440.K. MuralidharanA. SternTF Meyer1987The control mechanism of opacity protein expression in the pathogenic Neisseriae.Antonie Van Leeuwenhoek53435440

26. Murphy GL, Connell TD, Barritt DS, Koomey M, Cannon JG (1989) Phase variation of gonococcal protein II: regulation of gene expression by slipped-strand mispairing of a repetitive DNA sequence. Cell 56: 539–547.GL MurphyTD ConnellDS BarrittM. KoomeyJG Cannon1989Phase variation of gonococcal protein II: regulation of gene expression by slipped-strand mispairing of a repetitive DNA sequence.Cell56539547

27. Payne SM (1993) Iron acquisition in microbial pathogenesis. Trends Microbiol 1: 66–69.SM Payne1993Iron acquisition in microbial pathogenesis.Trends Microbiol16669

28. Cornelissen CN (2004) Iron transport system in pathogenic bacteria: Neisseria. In: Cronin A, editor. Iron transport in bacteria. Washington, D.C.: ASM Press. CN Cornelissen2004Iron transport system in pathogenic bacteria: Neisseria.A. CroninIron transport in bacteriaWashington, D.C.ASM Press

29. Stojiljkovic I, Hwa V, de Saint Martin L, O'Gaora P, Nassif X, et al. (1995) The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulence. Mol Microbiol 15: 531–541.I. StojiljkovicV. HwaL. de Saint MartinP. O'GaoraX. Nassif1995The Neisseria meningitidis haemoglobin receptor: its role in iron utilization and virulence.Mol Microbiol15531541

30. Snyder LA, Davies JK, Ryan CS, Saunders NJ (2005) Comparative overview of the genomic and genetic differences between the pathogenic Neisseria strains and species. Plasmid 54: 191–218.LA SnyderJK DaviesCS RyanNJ Saunders2005Comparative overview of the genomic and genetic differences between the pathogenic Neisseria strains and species.Plasmid54191218

31. Hagen TA, Cornelissen CN (2006) Neisseria gonorrhoeae requires expression of TonB and the putative transporter TdfF to replicate within cervical epithelial cells. Mol Microbiol 62: 1144–1157.TA HagenCN Cornelissen2006Neisseria gonorrhoeae requires expression of TonB and the putative transporter TdfF to replicate within cervical epithelial cells.Mol Microbiol6211441157

32. Hamilton HL, Dominguez NM, Schwartz KJ, Hackett KT, Dillard JP (2005) Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system. Mol Microbiol 55: 1704–1721.HL HamiltonNM DominguezKJ SchwartzKT HackettJP Dillard2005Neisseria gonorrhoeae secretes chromosomal DNA via a novel type IV secretion system.Mol Microbiol5517041721

33. Bille E, Zahar JR, Perrin A, Morelle S, Kriz P, et al. (2005) A chromosomally integrated bacteriophage in invasive meningococci. J Exp Med 201: 1905–1913.E. BilleJR ZaharA. PerrinS. MorelleP. Kriz2005A chromosomally integrated bacteriophage in invasive meningococci.J Exp Med20119051913

34. Kawai M, Uchiyama I, Kobayashi I (2005) Genome comparison in silico in Neisseria suggests integration of filamentous bacteriophages by their own transposase. DNA Res 12: 389–401.M. KawaiI. UchiyamaI. Kobayashi2005Genome comparison in silico in Neisseria suggests integration of filamentous bacteriophages by their own transposase.DNA Res12389401

35. Bowler LD, Zhang QY, Riou JY, Spratt BG (1994) Interspecies recombination between the penA genes of Neisseria meningitidis and commensal Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural events and laboratory simulation. J Bacteriol 176: 333–337.LD BowlerQY ZhangJY RiouBG Spratt1994Interspecies recombination between the penA genes of Neisseria meningitidis and commensal Neisseria species during the emergence of penicillin resistance in N. meningitidis: natural events and laboratory simulation.J Bacteriol176333337

36. Linz B, Schenker M, Zhu P, Achtman M (2000) Frequent interspecific genetic exchange between commensal Neisseriae and Neisseria meningitidis. Mol Microbiol 36: 1049–1058.B. LinzM. SchenkerP. ZhuM. Achtman2000Frequent interspecific genetic exchange between commensal Neisseriae and Neisseria meningitidis.Mol Microbiol3610491058

37. Maiden MC (1998) Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria. Clin Infect Dis 27: Suppl 1S12–20.MC Maiden1998Horizontal genetic exchange, evolution, and spread of antibiotic resistance in bacteria.Clin Infect Dis27Suppl 1S1220

38. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst Biol 52: 696–704.S. GuindonO. Gascuel2003A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood.Syst Biol52696704

39. Shimodaira H (2002) An approximately unbiased test of phylogenetic tree selection. Syst Biol 51: 492–508.H. Shimodaira2002An approximately unbiased test of phylogenetic tree selection.Syst Biol51492508

40. Susko E, Leigh J, Doolittle WF, Bapteste E (2006) Visualizing and assessing phylogenetic congruence of core gene sets: a case study of the gamma-proteobacteria. Mol Biol Evol 23: 1019–1030.E. SuskoJ. LeighWF DoolittleE. Bapteste2006Visualizing and assessing phylogenetic congruence of core gene sets: a case study of the gamma-proteobacteria.Mol Biol Evol2310191030

41. Martin DP, Williamson C, Posada D (2005) RDP2: recombination detection and analysis from sequence alignments. Bioinformatics 21: 260–262.DP MartinC. WilliamsonD. Posada2005RDP2: recombination detection and analysis from sequence alignments.Bioinformatics21260262

42. Glitza IC, Ehrhard I, Muller-Pebody B, Reintjes R, Breuer T, et al. (2008) Longitudinal study of meningococcal carrier rates in teenagers. Int J Hyg Environ Health 211: 263–272.IC GlitzaI. EhrhardB. Muller-PebodyR. ReintjesT. Breuer2008Longitudinal study of meningococcal carrier rates in teenagers.Int J Hyg Environ Health211263272

43. Bauer FJ, Rudel T, Stein M, Meyer TF (1999) Mutagenesis of the Neisseria gonorrhoeae porin reduces invasion in epithelial cells and enhances phagocyte responsiveness. Mol Microbiol 31: 903–913.FJ BauerT. RudelM. SteinTF Meyer1999Mutagenesis of the Neisseria gonorrhoeae porin reduces invasion in epithelial cells and enhances phagocyte responsiveness.Mol Microbiol31903913

44. Casadevall A, Pirofski LA (1999) Host-pathogen interactions: redefining the basic concepts of virulence and pathogenicity. Infect Immun 67: 3703–3713.A. CasadevallLA Pirofski1999Host-pathogen interactions: redefining the basic concepts of virulence and pathogenicity.Infect Immun6737033713

45. Craig L, Pique ME, Tainer JA (2004) Type IV pilus structure and bacterial pathogenicity. Nat Rev Microbiol 2: 363–378.L. CraigME PiqueJA Tainer2004Type IV pilus structure and bacterial pathogenicity.Nat Rev Microbiol2363378

46. Howie HL, Glogauer M, So M (2005) The N. gonorrhoeae type IV pilus stimulates mechanosensitive pathways and cytoprotection through a pilT-dependent mechanism. PLoS Biol 3: e100.HL HowieM. GlogauerM. So2005The N. gonorrhoeae type IV pilus stimulates mechanosensitive pathways and cytoprotection through a pilT-dependent mechanism.PLoS Biol3e100

47. Lee SW, Higashi DL, Snyder A, Merz AJ, Potter L, et al. (2005) PilT is required for PI(3,4,5)P3-mediated crosstalk between Neisseria gonorrhoeae and epithelial cells. Cell Microbiol 7: 1271–1284.SW LeeDL HigashiA. SnyderAJ MerzL. Potter2005PilT is required for PI(3,4,5)P3-mediated crosstalk between Neisseria gonorrhoeae and epithelial cells.Cell Microbiol712711284

48. Kaplan JB, Fine DH (2002) Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria. Appl Environ Microbiol 68: 4943–4950.JB KaplanDH Fine2002Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria.Appl Environ Microbiol6849434950

49. Aho EL, Keating AM, McGillivray SM (2000) A comparative analysis of pilin genes from pathogenic and nonpathogenic Neisseria species. Microb Pathog 28: 81–88.EL AhoAM KeatingSM McGillivray2000A comparative analysis of pilin genes from pathogenic and nonpathogenic Neisseria species.Microb Pathog288188

50. Berger U, Husmann D (1972) Studies on the normal occurrence of Neisseria flavescens (Branham, 1930). Med Microbiol Immunol 158: 121–127.U. BergerD. Husmann1972Studies on the normal occurrence of Neisseria flavescens (Branham, 1930).Med Microbiol Immunol158121127

51. Seifert HS, Ajioka RS, Paruchuri D, Heffron F, So M (1990) Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence. J Bacteriol 172: 40–46.HS SeifertRS AjiokaD. ParuchuriF. HeffronM. So1990Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lower DNA transformation competence.J Bacteriol1724046

52. Zerbino DR, Birney E (2008) Velvet: algorithms for de novo short read assembly using de Bruijn graphs. Genome Res 18: 821–829.DR ZerbinoE. Birney2008Velvet: algorithms for de novo short read assembly using de Bruijn graphs.Genome Res18821829

53. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, et al. (2008) The RAST Server: rapid annotations using subsystems technology. BMC Genomics 9: 75.RK AzizD. BartelsAA BestM. DeJonghT. Disz2008The RAST Server: rapid annotations using subsystems technology.BMC Genomics975

54. Katoh K, Kuma K, Toh H, Miyata T (2005) MAFFT version 5: improvement in accuracy of multiple sequence alignment. Nucleic Acids Res 33: 511–518.K. KatohK. KumaH. TohT. Miyata2005MAFFT version 5: improvement in accuracy of multiple sequence alignment.Nucleic Acids Res33511518

55. Castresana J (2000) Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis. Mol Biol Evol 17: 540–552.J. Castresana2000Selection of conserved blocks from multiple alignments for their use in phylogenetic analysis.Mol Biol Evol17540552

56. Rice P, Longden I, Bleasby A (2000) EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet 16: 276–277.P. RiceI. LongdenA. Bleasby2000EMBOSS: the European Molecular Biology Open Software Suite.Trends Genet16276277

57. Correia FF, Inouye S, Inouye M (1986) A 26-base-pair repetitive sequence specific for Neisseria gonorrhoeae and Neisseria meningitidis genomic DNA. J Bacteriol 167: 1009–1015.FF CorreiaS. InouyeM. Inouye1986A 26-base-pair repetitive sequence specific for Neisseria gonorrhoeae and Neisseria meningitidis genomic DNA.J Bacteriol16710091015

58. Yang Z (1997) PAML: a program package for phylogenetic analysis by maximum likelihood. Comput Appl Biosci 13: 555–556.Z. Yang1997PAML: a program package for phylogenetic analysis by maximum likelihood.Comput Appl Biosci13555556

59. Shimodaira H, Hasegawa M (2001) CONSEL: for assessing the confidence of phylogenetic tree selection. Bioinformatics 17: 1246–1247.H. ShimodairaM. Hasegawa2001CONSEL: for assessing the confidence of phylogenetic tree selection.Bioinformatics1712461247